Recombinant escherichia coli and method for producing L-methionine by using recombinant escherichia coli

Abstract

The invention discloses recombinant escherichia coli and a method for producing L-methionine by using the recombinant escherichia coli. L-methionine is produced through fermentation culture of recombinant escherichia coli, sulfur source optimization is carried out on a sulfur source culture medium used during fermentation culture, the sulfur source utilization efficiency is improved, and the yield of L-methionine is increased; in the optimization process, generation of hydrogen sulfide in a culture medium is detected by lead acetate test paper, so that metZ genes for expressing and coding O-succinyl homoserine sulfhydrylase are introduced into plasmid pAm to obtain plasmid pAmZ, and the plasmid pAmZ is introduced into strains M2 / pAm and M2-HPBC / pAm to obtain recombinant escherichia coli M2 / pAmZ and M2-HPBC / pAmZ, so that the toxic action of hydrogen sulfide on cells is reduced, and the yield of hydrogen sulfide is increased. The yield of the L-methionine can be increased; according to the present invention, the recombinant escherichia coli M2 / pAmZK and the recombinant escherichia coli M2-HPBC / pAmZK are obtained by further introducing the ppnk gene expressing and coding NAD + kinase into the plasmid pAmZ, and introducing the ppnk gene into the bacterial strains M2 / pAmZ and M2-HPBC / pAmZ to obtain the recombinant escherichia coli M2 / pAmZK and M2-HPBC / pAmZK, such that the intracellular NADPH level is improved, and the L-methionine yield is further improved;

Description

Technical Field

[0001] The present invention relates to the field of synthetic biology, in particular to recombinant Escherichia coli and a method for producing L-methionine therefrom. Background Art

[0002] L-methionine (L-Met), also known as L-methionine, is systematically named (S)-2-amino-4-methylthiobutyric acid. It belongs to the aspartic acid family of amino acids and is the only sulfur-containing amino acid among the eight essential amino acids. L-methionine participates in the transmethylation in cells and plays an important role in protein synthesis, immunity, anti-oxidation and lipid metabolism, and has important physiological functions. Moreover, L-methionine is the first limiting amino acid in poultry feed and the second limiting amino acid in pig feed. As a feed additive, it has the largest consumer market, and its domestic demand has also increased significantly. In addition, the demand for L-methionine in food additives, medicines and cosmetics is also on the rise.

[0003] The synthesis methods of L-methionine mainly include chemical synthesis, bio-enzyme catalysis and microbial fermentation. When L-methionine is synthesized by chemical method, the raw materials and intermediate products such as methyl mercaptan and cyanide are not environmentally friendly, and the products generated are mostly D, L-methionine, which requires further racemization treatment to obtain the target product, and the operation is relatively cumbersome. The bio-enzyme catalysis method is to first produce L-homoserine succinate by microbial fermentation, and then add methyl mercaptan to produce L-methionine by enzymatic method. It has the disadvantages of high cost and complex production and control process, which is not conducive to large-scale industrial production.

[0004] Microbial fermentation is a method of efficiently synthesizing L-methionine using biomass as raw materials, and has the advantages of mild reaction conditions and environmental friendliness. For example, the invention patent with application publication number CN 118109378 A discloses an engineered Escherichia coli with high L-methionine production and a method for producing L-methionine by full fermentation. The engineered strain uses the recombinant strain M2 / pAm as the starting strain, and the genome is modified with a strong promoter P trc Replace one or more original promoters of the cysPUWAM gene cluster, cysH gene, trxB gene, and trxC gene. The resulting high-yield L-methionine Escherichia coli engineered bacteria strain has a yield of 3.21 g / L. However, in the process of synthesizing L-methionine, there is still a problem of low sulfur source utilization efficiency in the fermentation medium, which is not conducive to the increase of L-methionine production. Summary of the invention

[0005] To solve the above problems, in a first aspect, the present invention reconstructs a plasmid and a recombinant Escherichia coli introduced with the plasmid, wherein the recombinant Escherichia coli can produce L-methionine by fermentation culture.

[0006] The technical solution of the present invention to solve the above problems is as follows:

[0007] The present invention provides a plasmid, the plasmid is pAmZ, which is obtained by overexpressing the metZ gene encoding O-succinyl homoserine sulfhydrylase on the pAm plasmid, wherein the metZ gene is derived from Pseudomonas aeruginosa PAO1; the plasmid pAm is based on the ptrc99A plasmid to enhance metA fbr 、yjeH、serA fbr plasmid; the nucleotide sequence of the metZ gene is shown in SEQ ID NO.1.

[0008] SEQ ID NO.1:

[0009]

[0010] The present invention also provides a plasmid, wherein the plasmid is pAmZK, which is a plasmid encoding NAD + The ppnk gene of kinase is obtained; the ppnk gene is derived from Corynebacterium glutamicum SCgG2, and the nucleotide sequence of the ppnk gene is shown in SEQ ID NO.2.

[0011] SEQ ID NO.2:

[0012] ATGACTGCGCCAACTAACGCAGGTGAACTGCGTCGTGTTCTGCTGGTTCCACACACTGG TCGTAGCTCTAACATCGAATCTGCGATCTTGGCGGCTAAACTGCTGGATGACGCGGGTATCGATGTTCGTGTTCTGATCAACGATGCGGATGATCCAATCGCTGAACATCCGGTATTGGGCCGTTTCACTCACGTTCGTCACGCGGCAGACGCTGCGGAAGGTGCTGAACTGGTTCTCGTTCTGGGTGGTGATGGTACGTTTCTGCGTGCGGCAGACATGGCGCACGCTGTTGACCTGCCGGTGCTGGGTATCAACCTGGGTCACGTTGGCTTTCTGGCTGAATGGGAATCTGACTCTCTGGAAGAAGCTCTGAAACGTGTTATCGACCGTGACTACCGTATCGAAGATCGTATGACCTTGACCGTTGTTGTTCTGGACGGTGGTGGTGAAGAAATCGGTCGTGGTTGGGCGCTGAACGAAGTGTCTATCGAGAACCTGAACCGTCGTGGTGTTCTGGATGCTACTCTGGAAGTTGATGCTCGTCCGGTTGCAAGTTTCGGTTGCGACGGCGTTCTGATCTCTACTCCGACTGGTTCTACTGCTTACGCATTCAGCGCAGGTGGTCCGGTTCTGTGGCCAGAACTGGATGCGATTCTGGTAGTTCCGAACAACGCACACGCTCTGTTCACCAAACCGCTGGTGGTTAGTCCGAAATCTACTGTTGCTGTTGAATCTAACTCTGATACCTCTGCTGCTATGGCTGTTATGGACGGTTTCCGTCCGATTCCAATGCCGCCGGGTAGCCGTGTTGAAGTTACTCGTGGTGAACGTCCGGTTCGTTGGGTTCGTCTGGACTCTTCCCCATTCACCGATCGTCTGGTTTCCAAACTGCGTCTGCCAGTTACCGGCTGGCGTGGTCCGCAGAAACAGGCGGAGAACAAAGATCCGCGTAGCGCGGGTTAA

[0013] The present invention also provides a recombinant Escherichia coli, which is obtained by transforming the above-mentioned plasmid into a chassis strain.

[0014] Preferably, the chassis strain is M2 / pAm; the genotype of M2 / pAm is E. coli W3110ΔmetJΔmetIΔlysA Trc-metH Trc-metF Trc-cysE Trc-serB Trc-serC / pAm.

[0015] Preferably, the recombinant Escherichia coli is M2 / pAmZ, which is obtained by overexpressing the metZ gene on the pAm plasmid using M2 / pAm as the chassis strain.

[0016] Preferably, the recombinant Escherichia coli is M2 / pAmZK, which is obtained by overexpressing the ppnk gene on the pAmZ plasmid using the recombinant Escherichia coli M2 / pAmZ as the chassis strain.

[0017] Preferably, the chassis strain is M2-HPBC / pAm; the genotype of the M2-HPBC / pAm is E.coliW3110ΔmetJΔmetIΔlysA Trc-metH Trc-metF Trc-cysE Trc-serB Trc-serC Trc-cysPTrc-cysH Trc-trxB Trc-trxC / pAm.

[0018] The chassis strain M2-HPBC has been disclosed in the invention patent with application publication number CN 118109378 A.

[0019] Preferably, the recombinant Escherichia coli is M2-HPBC / pAmZ, which is obtained by overexpressing the metZ gene on the pAm plasmid using M2-HPBC / pAm as the chassis strain.

[0020] Preferably, the recombinant Escherichia coli is M2-HPBC / pAmZK, which is obtained by overexpressing the ppnk gene on the pAmZ plasmid using the above-mentioned M2-HPBC / pAmZ as the chassis strain.

[0021] The above-mentioned recombinant E. coli M2 / pAmZ and M2 / pAmZK were constructed according to the following steps:

[0022] S1. Using strain M2 / pAm as the chassis strain, the codon-optimized O-succinylhomoserine sulfhydrylase metZ gene from Pseudomonas aeruginosa PAO1 was overexpressed on the plasmid: using pAm plasmid as a template, pAm-XF / pAm-XR primers were used to obtain the linearized plasmid pAm; the linearized plasmid pAm was connected with the codon-optimized metZ gene fragment shown in SEQ ID NO.1 by homologous recombination technology to construct the plasmid pAmZ, and the plasmid was transformed into the competent cells of strain M2 / pAm to obtain the engineered bacteria M2 / pAmZ, i.e., the recombinant Escherichia coli M2 / pAmZ capable of high-yield L-methionine;

[0023] S2, using strain M2 / pAmZ as the chassis strain, overexpressing codon-optimized NAD from Corynebacterium glutamicum SCgG2 on the plasmid + Kinase ppnk gene: using pAmZ plasmid as template and pAmZ-XF / pAmZ-XR primers to obtain linearized plasmid pAmZK; connecting the linearized plasmid pAmZ and the codon-optimized ppnk gene fragment shown in SEQ ID NO.2 by homologous recombination technology to construct plasmid pAmZK, and transforming the plasmid into competent cells of strain M2 / pAmZ to obtain engineered bacteria M2 / pAmZK, i.e., recombinant Escherichia coli M2 / pAmZK capable of high production of L-methionine.

[0024] In a second aspect, the present invention also provides a method for producing L-methionine by the above-mentioned recombinant Escherichia coli, wherein the recombinant Escherichia coli is inoculated into an LB medium containing kanamycin, and cultured overnight on a shaker at 35-39°C and 180-220rpm for 12-14h, and then the culture solution is inoculated into a sulfur source medium at a volume concentration of 3-8%. After the fermentation is completed, a fermentation solution containing L-methionine is obtained; the LB medium includes: 9-11g / L peptone, 4-6g / L yeast powder, 9-11g / L sodium chloride, and the solvent is deionized water.

[0025] Preferably, the sulfur source medium comprises a basal medium and a sulfur source, and the basal medium (g / L) comprises the following components in parts by mass:

[0026] Glucose 25.0~35.0, KH2PO4 0.5~1.5, MgCl2 0.1~0.3, yeast powder 1.5~2.5, FeSO4·7H2O 0.003~0.007, MnSO4·8H2O 0.003~0.007, ZnSO4 0.003~0.007, solvent is deionized water, pH natural;

[0027] The sulfur source (g / L) is selected from at least one of the following combinations of components by weight:

[0028] Combination of (NH4)2SO415.0~17.0 and Na2SO41.0~3.0,

[0029] Combination of (NH4)2SO415.0~17.0 and Na2S2O31.0~3.0,

[0030] A combination of (NH4)2SO415.0~17.0 and Na2S2O30.5~1.5 and Na2SO40.5~1.5,

[0031] A combination of (NH4)2SO415.0~17.0 and Na2S2O30.5~1.5 and (NH4)2S2O30.5~1.5.

[0032] Preferably, the sulfur source medium (g / L) comprises the following components in parts by mass:

[0033] Glucose 25.0~35.0, KH2PO4 0.5~1.5, MgCl2 0.1~0.3, yeast powder 1.5~2.5, FeSO4·7H2O 0.003~0.007, MnSO4·8H2O 0.003~0.007, ZnSO4 0.003~0.007, (NH4)2SO4 12.0~20.0, Na2S2O3 1.0~10, the solvent is deionized water, pH is natural.

[0034] Preferably, the mass ratio of sulfate to thiosulfate in the sulfur source culture medium is (2-10):(1-2).

[0035] Preferably, the fermentation culture conditions in the sulfur source culture medium are: fermentation culture at 27-33° C. and 180 rpm-220 rpm for 40-56 hours.

[0036] L-methionine, systematically named (S)-2-amino-4-methylthiobutyric acid, in the sulfur source medium, ammonium sulfate is used as a nitrogen source and a sulfur source, and the combination of sodium thiosulfate and ammonium sulfate is a sulfur source combination suitable for producing L-methionine, and the utilization rate of sulfur source substances is high. However, when sodium thiosulfate is contained in the culture medium, hydrogen sulfide is produced, which harms the growth of recombinant Escherichia coli.

[0037] By consulting the literature, it was found that other microorganisms can use hydrogen sulfide to synthesize L-methionine, which is called the direct sulfhydrylation pathway: O-succinylhomoserine sulfhydrylase uses O-succinylhomoserine as a substrate and hydrogen sulfide as a sulfur donor to synthesize homocysteine ​​in one step, and then generates L-methionine through methylation.

[0038] The invention overexpresses the metZ gene encoding O-succinyl homoserine sulfhydrylase on the pAm plasmid to obtain pAmZ; uses M2 / pAm as a chassis strain to obtain recombinant Escherichia coli M2 / pAmZ; uses M2-HPBC / pAm as a chassis strain to obtain recombinant Escherichia coli M2-HPBC / pAmZ.

[0039] Escherichia coli consumes a large amount of cofactors to synthesize L-methionine. The synthesis of 1 mol of L-methionine requires 8 mol of NADPH (reduced coenzyme II). In order to increase the intracellular NADPH level, the ppnk gene encoding NAD+ kinase from Corynebacterium glutamicum SCgG2 was introduced.

[0040] Therefore, the present invention overexpresses the ppnk gene encoding NAD+ kinase on the pAmZ plasmid to obtain pAmZK; and uses M2 / pAmZ as the chassis strain to obtain the recombinant Escherichia coli M2 / pAmZK, and uses M2-HPBC / pAmZ as the chassis strain to obtain the recombinant Escherichia coli M2-HPBC / pAmZK.

[0041] When the above four types of Escherichia coli are used to produce L-methionine through fermentation culture in a sulfur source medium, the toxic effect of hydrogen sulfide on cells can be reduced, which is beneficial to the growth of Escherichia coli and the synthesis of L-methionine.

[0042] The present invention has the following beneficial effects:

[0043] The present invention produces L-methionine by fermentation culture of recombinant Escherichia coli, and improves the sulfur source utilization efficiency by optimizing the sulfur source culture medium used in the fermentation culture, thereby increasing the L-methionine yield;

[0044] During the optimization process, lead acetate test paper was used to detect the production of hydrogen sulfide in the culture medium. Therefore, the metZ gene encoding O-succinylhomoserine sulfhydrylase was introduced into the plasmid pAm to obtain the plasmid pAmZ, which was introduced into the strains M2 / pAm and M2-HPBC / pAm to obtain recombinant Escherichia coli M2 / pAmZ and M2-HPBC / pAmZ, which reduced the toxic effect of hydrogen sulfide on cells and was beneficial to increase the production of L-methionine. The production of L-methionine in the M2 / pAmZ strain reached 2.80 g / L at the shake flask level, and the production of L-methionine in the M2-HPBC / pAmZ strain reached 3.42 g / L at the shake flask level.

[0045] The plasmid pAmZ was further introduced to express the gene encoding NAD +The ppnk gene of kinase was expressed in 100 μg / L kinase and introduced into strains M2 / pAmZ and M2-HPBC / pAmZ to obtain recombinant Escherichia coli M2 / pAmZK and M2-HPBC / pAmZK, which increased the intracellular NADPH level and further improved the L-methionine production. The L-methionine production of the M2 / pAmZK strain reached 3.05 g / L at the shake flask level, and the L-methionine production of the M2-HPBC / pAmZK strain reached 3.47 g / L at the shake flask level. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 is the OD of M2 / pAm fermentation with different sulfur sources in Example 1 600 , residual glucose, L-methionine titer change graph;

[0047] Figure 2 is the OD of the sulfur source combination on M2 / pAm fermentation in Example 2 600 and L-methionine titer change graph;

[0048] Figure 3 OD of M2 / pAm fermentation with different ratios of ammonium sulfate and sodium thiosulfate in Example 3 600 and L-methionine titer change graph;

[0049] Figure 4 This is a graph showing hydrogen sulfide production by different culture media in Example 4;

[0050] Figure 5 This is the plasmid map of pAmZK in Example 6;

[0051] Figure 6 is the OD of M2 / pAmZ in Example 5 600 and L-methionine titer change graph;

[0052] Figure 7 is the OD of M2 / pAmZK in Example 6 600 and L-methionine titer change graph;

[0053] Figure 8 is the OD of M2-HPBC / pAm, M2-HPBC / pAmZ, and M2-HPBC / pAmZK in Example 7 600 And the L-methionine titer change graph. DETAILED DESCRIPTION

[0054] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0055] The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0056] Unless otherwise specified, the test materials used in the following examples are all conventional biochemical reagents.

[0057] The room temperature is 25-30° C. The strain E. coli W3110 is from the ColiGenetic Stock Center of Yale University, with a deposit date of August 5, 1975, and a deposit number of CGSC#4474, which has been disclosed in patents US2009 / 0298132A1 and US2010 / 0248311A1.

[0058] LB liquid medium composition: peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, solvent is deionized water. LB solid medium needs to add agar with a final concentration of 20g / L to LB liquid medium.

[0059] The genotype of the starting strain M2 / pAm of the present invention is E. coli W3110ΔmetJΔmetIΔlysA Trc-metHTrc-metF Trc-cysE Trc-serB Trc-serC / pAm, and the plasmid pAm is based on the ptrc99A plasmid to enhance metA fbr 、yjeH、serA fbr Plasmid; the construction of the starting strain M2 / pAm was based on Jian-Feng Huang et al. Systematic Analysis of Bottlenecks in a Multibranched and Multilevel Regulated Pathway: The Molecular Fundamentals of L-Methionine Biosynthesis in Escherichia coli. ACS Synthetic Biology. 2018, 16; 7(11): 2577-2589.

[0060] The strain M2-HPBC in the embodiment of the present invention has been disclosed in the invention patent application publication number CN 118109378 A.

[0061] Those skilled in the art can repeatedly obtain the above strains based on literature records.

[0062] The genes and corresponding pathways involved in gene editing in the following examples are shown in Table 1.

[0063] Table 1: Genes and corresponding pathways involved in gene editing

[0064]

[0065] The primer sequences involved in the following examples are shown in Table 2.

[0066] Table 2: Primer sequence list

[0067]

[0068] Example 1: Determination of L-methionine content in M2 / pAm strains in different sulfur source media 1. Fermentation method:

[0069] The M2 / pAm strain was inoculated into 10 mL of LB medium containing 50 mg / L kanamycin (Kan), cultured at 37°C for 12 to 14 h, and then the culture solution was inoculated into 20 mL of fermentation medium containing 50 mg / L Kan of different sulfur sources at an inoculum concentration of 5% by volume, and fermented at 30°C and 200 rpm for 48 h to obtain a fermentation broth.

[0070] The fermentation medium of the different sulfur sources is composed as follows:

[0071] Thiosulfate medium (g / L): glucose 30.0, KH2PO4 1.0, MgCl2 0.2, yeast powder 2.0, FeSO4·7H2O 0.005, MnSO4·8H2O 0.005, ZnSO4 0.005, (NH4)2S2O3 17.9, Na2S2O3·5H2O 3.14;

[0072] Sulfate medium (g / L): glucose 30.0, KH2PO4 1.0, MgCl2 0.2, yeast powder 2.0, FeSO4·7H2O 0.005, MnSO4·8H2O 0.005, ZnSO4 0.005, (NH4)2SO4 16.0, Na2SO4 1.80;

[0073] Sulfite medium (g / L): glucose 30.0, KH2PO4 1.0, MgCl2 0.2, yeast powder 2.0, FeSO4·7H2O 0.005, MnSO4·8H2O 0.005, ZnSO4 0.005, (NH4)2SO3·H2O 16.3, Na2SO3 1.60;

[0074] The solvents were all deionized water with a natural pH. 4 μL IPTG (0.5 mol / L), 20 μL L-Lys (10 g / L), and 20 μL VB 12 (0.2 mg / L) and separately sterilized calcium carbonate (15 g / L).

[0075] 2. Determination method

[0076] After the fermentation, 1 mL of the fermentation liquid was taken and centrifuged at 12000 rpm for 5 min to obtain the supernatant containing L-methionine and the precipitate containing the bacterial cells. 1 mL of 2 mol / L hydrochloric acid aqueous solution was added to the precipitate, and the excess CaCO3 was removed by blowing with a pipette. The OD was measured by a UV spectrophotometer. 600 Obtain the amount of bacteria; use 4-chloro-3,5-dinitrotrifluorotoluene (CNBF) as a derivatization reagent, and the derivatization concentration is 0.27g / 10mL acetonitrile. Sample derivatization method: 100μL sample is added with 300μL CNBF derivatization solution and 500μL pH=9.0 boric acid buffer. Place in a metal bath, 60℃, 400rpm, and react in the dark for 1h. After the reaction is completed, filter with a 0.22μm organic filter membrane, and use Agilent 1260 high performance liquid chromatograph (Agilent 1260Infinity II LCSystem) to detect L-methionine and analyze the amino acid titer.

[0077] The detection conditions of the high performance liquid chromatography are as follows: a C18 chromatographic column (250×4.6 mm, 5 μm) is used; a UV detector with a detection wavelength of 260 nm and an injection volume of 10 μL; a column temperature of 30°C; an AB two-phase gradient elution is used as the mobile phase, with phase A being pure acetonitrile and phase B being a pH 4.9 triethylamine buffer, water:acetonitrile:triethylamine=84.8:15:0.2 (volume ratio), a flow rate of 0.8 mL / min, and the gradient elution program in Table 3 is used to separate L-methionine.

[0078] Table 3 Liquid phase elution program

[0079]

[0080]

[0081] OD of M2 / pAm strain in different sulfur source medium 600, residual glucose, L-methionine titer Figure 1 As shown, the results show that when different sulfur sources are used, the L-methionine production of sulfate is the highest. The reason may be that ammonium sulfate, ammonium thiosulfate and ammonium sulfite in the culture medium serve as both sulfur and nitrogen sources. From the bacterial growth and residual glucose, it can be seen that ammonium sulfate is more suitable as a nitrogen and sulfur source. Therefore, it is determined that ammonium sulfate is more suitable as a nitrogen and sulfur source in the L-methionine fermentation medium.

[0082] Example 2: M2 / pAm strain in different sulfur source combination medium and determination of L-methionine titer

[0083] When it was determined that ammonium sulfate was more suitable as a nitrogen source and sulfur source in the L-methionine fermentation medium, on this basis, different sulfur sources were added to the medium to determine the most suitable sulfur source combination for L-methionine fermentation.

[0084] The M2 / pAm strain was inoculated into 10 mL of LB medium containing 50 mg / L kanamycin (Kan), cultured at 37°C for 12 to 14 h, and then the culture solution was inoculated into 20 mL of fermentation medium containing 50 mg / L Kan with different sulfur source combinations at an inoculum concentration of 5% by volume, and fermented at 30°C and 200 rpm for 48 h to obtain a fermentation broth.

[0085] The medium composition of the sulfur source combination is as follows: basic medium (g / L): glucose 30.0, KH2PO4 1.0, MgCl2 0.2, yeast powder 2.0, FeSO4·7H2O 0.005, MnSO4·8H2O 0.005, ZnSO4 0.005, (NH4)2SO4 16.0, and other sulfur sources are added as shown in Table 4; the solvent is deionized water, the pH is natural, and 4 μL IPTG (0.5 mol / L), 20 μL L-Lys (10 g / L), and 20 μL VB are added during inoculation. 12 (0.2 mg / L) and separately sterilized calcium carbonate (15 g / L).

[0086] Table 4 Sulfur source combination table

[0087]

[0088] OD of M2 / pAm strain in different sulfur source combination medium 600 and L-methionine titer Figure 2 The results showed that when different sulfur source combinations were used, the combination of ammonium sulfate and sodium thiosulfate had the highest L-methionine production, but the biomass OD 600 Compared with combination A, the biomass OD 600The value is lower than 0.8, which indicates that sodium thiosulfate can cause damage to cells, indicating that the combination of sodium thiosulfate and ammonium sulfate is the most suitable sulfur source combination for L-methionine fermentation, but it can cause damage to the growth of recombinant Escherichia coli.

[0089] Example 3: Fermentation of M2 / pAm strain in medium with different sulfur source ratios and determination of L-methionine titer

[0090] The M2 / pAm strain was inoculated into 10 mL of LB medium containing 50 mg / L kanamycin (Kan), cultured at 37°C for 12 to 14 h, and then the culture solution was inoculated into 20 mL of fermentation medium containing 50 mg / L Kan of different sulfur sources at an inoculum concentration of 5% by volume, and fermented at 30°C and 200 rpm for 48 h to obtain a fermentation broth.

[0091] The sulfur source culture medium with different proportions is composed of (g / L): glucose 30.0, KH2PO4 1.0, MgCl2 0.2, yeast powder 2.0, FeSO4·7H2O 0.005, MnSO4·8H2O 0.005, ZnSO4 0.005, (NH4)2SO4 16.0, the amount of sodium thiosulfate added is adjusted to make the mass ratio of sulfate to thiosulfate 2, 4, 6, 8, 10, the solvent is deionized water, the pH is natural, and 4 μL IPTG (0.5 mol / L), 20 μL L-Lys (10 g / L), and 20 μL VB are added during inoculation. 12 (0.2 mg / L) and separately sterilized calcium carbonate (15 g / L).

[0092] OD of M2 / pAm strain in medium with different sulfur source ratios 600 and L-methionine titer Figure 3 The results showed that when the ratio of sulfate to thiosulfate was 10:1, the yield of L-methionine was the highest. When the thiosulfate content in the culture medium increased, the OD 600 The production of amino acids and L-methionine decreased. The possible reason is that sodium thiosulfate produces hydrogen sulfide, which is toxic to cells and causes a decrease in cell biomass.

[0093] Example 4: Hydrogen sulfide detection of M2 / pAm strain in different culture media

[0094] The M2 / pAm strain was inoculated into 10 mL of LB medium containing 50 mg / L kanamycin (Kan), cultured at 37°C for 12 to 14 h, and then the culture solution was inoculated into 10 mL of different culture media for hydrogen sulfide determination containing 50 mg / L Kan at an inoculum concentration of 5% by volume. The culture was fermented at 30°C and 200 rpm for 12 to 24 h, and the production of hydrogen sulfide was determined using lead acetate test paper.

[0095] The different culture media for the hydrogen sulfide assay are as follows:

[0096] Medium No. 1 (g / L): glucose 30.0, KH2PO4 1.0, MgCl2 0.2, yeast powder 2.0, FeSO4·7H2O 0.005, MnSO4·8H2O 0.005, ZnSO4 0.005, (NH4)2SO4 16.0, Na2SO4 1.80;

[0097] Medium No. 2 (g / L): glucose 30.0, KH2PO4 1.0, MgCl2 0.2, yeast powder 2.0, FeSO4·7H2O 0.005, MnSO4·8H2O 0.005, ZnSO4 0.005, (NH4)2SO4 16.0, Na2S2O 32.00;

[0098] Medium No. 3 (g / L): glucose 30.0, KH2PO4 1.0, MgCl2 0.2, yeast powder 2.0, FeSO4·7H2O 0.005, MnSO4·8H2O 0.005, ZnSO4 0.005, (NH4)2SO4 16.0, Na2SO3 1.70;

[0099] Medium No. 4 (g / L): glucose 30.0, KH2PO4 1.0, MgCl2 0.2, yeast powder 2.0, FeSO4·7H2O 0.005, MnSO4·8H2O 0.005, ZnSO4 0.005, (NH4)2SO4 16.0, (NH4)2S2O 31.88;

[0100] Medium No. 5: LB liquid medium, i.e., peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L;

[0101] The solvents were all deionized water with a natural pH. 4 μL IPTG (0.5 mol / L), 100 μL L-Lys (10 g / L), and 20 μL VB were added during inoculation. 12 (0.2mg / L).

[0102] The results of M2 / pAm strain in different culture media for hydrogen sulfide determination are as follows Figure 4 As shown, the results show that hydrogen sulfide will be produced only when the culture medium contains sodium thiosulfate.

[0103] Example 5: Construction of effective strain M2 / pAmZ and shake flask fermentation

[0104] (1) Construction of pAmZ plasmid: Using pAm plasmid as template and pAm-XF / pAm-XR in Table 2 as primers, the PCR product was digested with DpnⅠ at 37°C for 2h, and the DNA fragment was recovered by Clean up kit to obtain linearized pAm-Line plasmid. Using pTrc99a plasmid (purchased from Qingke Biotech) containing codon-optimized heterologous metZ as template and metZ-F / metZ-R in Table 2 as primers for amplification, the PCR product was recovered by Clean up kit to obtain metZ fragment (nucleotide sequence as shown in SEQ ID NO.1); linearized pAm-Line plasmid and metZ fragment were connected together according to the instructions of One step clone kit (Vazyme Biotech, Nanjing, China), and the connection product was transformed into E. coli DH5α competent cells by chemical transformation, cultured and screened at 37°C, and finally clones were selected and sequenced and verified by primers pAm-VF / pAm-VR to obtain pAmZ plasmid.

[0105] (2) Preparation of M2 chemical transformation competent cells. For detailed process, see (Molecular Cloning: A Laboratory Manual, 3rd Edition, 99-102).

[0106] (3) The constructed pAmZ plasmid was transformed into the M2 competent cell by chemical transformation to obtain the M2 / pAmZ strain.

[0107] (4) The constructed production strain M2 / pAmZ was fermented in a shake flask according to the following fermentation medium and tested according to Example 1. The fermentation medium (g / L) included 20.0 g of glucose, 1.0 g of KH2PO4, 2.0 g of yeast powder, 16 g of (NH4)2SO4, 32 g of Na2S2O, and 1 mL / L of trace element solution. Trace elements (g / L) included 5 g of FeSO4·7H2O, 5 g of MnSO4·8H2O, 5 g of ZnSO4, and 500 g / L of MgSO4·7H2O. The solvent was deionized water with a natural pH and an inoculation size of 5%. During inoculation, 4 μL of IPTG (0.5 mol / L), 20 μL of L-Lys (10 g / L), and 20 μL of VB were added. 12 (0.2 mg / L), 20 μL kanamycin (50 g / L) and sterilized calcium carbonate (10 g / L). M2 / pAm was used as the control group, and OD 600 And the L-methionine content in the fermentation supernatant Figure 6 As shown,

[0108] Depend on Figure 6It can be seen that overexpression of metZ on the plasmid increased the L-methionine production from 2.42 g / L to 2.80 g / L, and the biomass OD 600 The increase from 6.04 to 7.23 indicated that overexpression of metZ was beneficial to the growth of E. coli and the synthesis of L-methionine, and reduced the toxic effect of hydrogen sulfide on cells.

[0109] Example 6: Construction of effective strain M2 / pAmZK and shake flask fermentation

[0110] (1) Construction of pAmZK plasmid: Using the pAmZ plasmid constructed in Example 5 as a template and pAmZ-XF / pAmZ-XR in Table 2 as primers, the PCR product was digested with DpnⅠ at 37°C for 2 h, and the DNA fragment was recovered using a Clean up kit to obtain a linearized pAmZ-Line plasmid. The pTrc99a plasmid containing codon-optimized heterologous ppnk (purchased from Qingke Biotech) was used as a template, ppnk-F / ppnk-R in Table 2 was used for primer amplification, and the PCR product was recovered by a Clean up kit to obtain a ppnk fragment (nucleotide sequence as shown in SEQ ID NO.1); the linearized pAmZ-Line plasmid and the ppnk fragment were connected together according to the instructions of (One step clonekit, Vazyme Biotech, Nanjing, China), and the connection product was transformed into E. coli DH5α competent medium by chemical transformation, cultured and screened at 37°C, and finally clones were selected and verified by sequencing with primers pAm-VF / pAm-VR to obtain pAmZK plasmid.

[0111] (2) Preparation of M2 chemical transformation competent cells. For detailed process, see (Molecular Cloning: A Laboratory Manual, 3rd Edition, 99-102).

[0112] (3) The constructed pAmZK plasmid was transformed into the M2 competent cell by chemical transformation to obtain the M2 / pAmZK strain.

[0113] (4) The constructed production strain M2 / pAmZK was fermented in shake flasks according to Example 5 and tested according to Example 1. The OD 600 And the L-methionine content in the fermentation supernatant Figure 7 As shown,

[0114] Depend on Figure 7 It can be seen that overexpression of ppnk on the plasmid increased the L-methionine production from 2.80 g / L to 3.05 g / L, and the biomass OD 600The changes were not significant, indicating that overexpression of ppnk was beneficial to the synthesis and growth of L-methionine in Escherichia coli.

[0115] Example 7: Construction of effective strains M2-HPBC / pAmZ, M2-HPBC / pAmZK and shake flask fermentation thereof

[0116] (1) Preparation of M2-HPBC chemical transformation competent cells. For detailed process, see (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99-102).

[0117] (2) The pAmZ and pAmZK plasmids constructed in Example 5 and Example 6 were transformed into the competent cells of M2-HPBC by chemical transformation to obtain M2-HPBC / pAmZ and M2-HPBC / pAmZK strains.

[0118] (3) The constructed production strains M2-HPBC / pAmZ and M2-HPBC / pAmZK were fermented in shake flasks according to Example 5 and tested according to Example 1. The OD 600 And the L-methionine content in the fermentation supernatant Figure 8 As shown,

[0119] Depend on Figure 8 It can be seen that by overexpressing metZ and ppnk on the plasmid, the L-methionine production of strain M2-HPBC increased from 3.14 g / L to 3.42 g / L and 3.47 g / L, indicating that the simultaneous overexpression of metZ and ppnk is beneficial to the synthesis of L-methionine in Escherichia coli.

Claims

1. A plasmid, characterized in that The plasmid is pAmZ, which is obtained by overexpressing the metZ gene encoding O-succinyl homoserine sulfhydrylase on the pAm plasmid, and the metZ gene is derived from Pseudomonas aeruginosa PAO1; the plasmid pAm is based on the ptrc99A plasmid to enhance metA fbr 、yjeH、serA fbr plasmid; the nucleotide sequence of the metZ gene is shown in SEQ ID NO.

1.

2. A plasmid, characterized in that The plasmid is pAmZK, which is a plasmid encoding NAD overexpressed on the pAmZ plasmid of claim 1. + The ppnk gene of kinase is obtained; the ppnk gene is derived from Corynebacterium glutamicum SCgG2, and the nucleotide sequence of the ppnk gene is shown in SEQ ID NO.

2.

3. A recombinant Escherichia coli, characterized in that The recombinant Escherichia coli is obtained by transforming the plasmid according to any one of claims 1 to 2 into a chassis strain.

4. The recombinant Escherichia coli according to claim 3, characterized in that The chassis strain is M2 / pAm; the genotype of M2 / pAm is E. coli W3110ΔmetJΔmetIΔlysA Trc-metH Trc-metF Trc-cysE Trc-serB Trc-serC / pAm.

5. The recombinant Escherichia coli according to claim 3, characterized in that The chassis strain is M2-HPBC / pAm; the genotype of M2-HPBC / pAm is E. coli W3110ΔmetJΔmetIΔlysA Trc-metH Trc-metF Trc-cysE Trc-serB Trc-serC Trc-cysH Trc-cysP Trc-trxB Trc-trxC / pAm.

6. A method for producing L-methionine by recombinant Escherichia coli, characterized in that: The recombinant Escherichia coli according to any one of claims 3 to 5 is inoculated into an LB medium containing kanamycin, and cultured overnight on a shaker at 35 to 39° C. and 180 to 220 rpm for 12 to 14 hours, and then the culture solution is inoculated into a sulfur source medium at a volume concentration of 3 to 8%. After the fermentation is completed, a fermentation solution containing L-methionine is obtained; the LB medium comprises: 9 to 11 g / L peptone, 4 to 6 g / L yeast powder, 9 to 11 g / L sodium chloride, and the solvent is deionized water.

7. The method according to claim 6, characterized in that The sulfur source medium comprises a basic medium and a sulfur source, and the basic medium (g / L) comprises the following components in parts by mass: Glucose 25.0~35.0, KH2PO4 0.5~1.5, MgCl2 0.1~0.3, yeast powder 1.5~2.5, FeSO4·7H2O 0.003~0.007, MnSO4·8H2O 0.003~0.007, ZnSO4 0.003~0.007, solvent is deionized water, pH natural; The sulfur source (g / L) is selected from at least one of the following combinations of components by weight: Combination of (NH4)2SO415.0~17.0 and Na2SO41.0~3.0, Combination of (NH4)2SO415.0~17.0 and Na2S2O31.0~3.0, A combination of (NH4)2SO415.0~17.0 and Na2S2O30.5~1.5 and Na2SO40.5~1.5, A combination of (NH4)2SO415.0~17.0 and Na2S2O30.5~1.5 and (NH4)2S2O30.5~1.

5.

8. The method according to claim 6, characterized in that The sulfur source medium (g / L) includes the following components in parts by mass: Glucose 25.0~35.0, KH2PO4 0.5~1.5, MgCl2 0.1~0.3, yeast powder 1.5~2.5, FeSO4·7H2O 0.003~0.007, MnSO4·8H2O 0.003~0.007, ZnSO4 0.003~0.007, (NH4)2SO4 12.0~20.0, Na2S2O3 1.0~10, the solvent is deionized water, pH is natural.

9. The method according to claim 8, characterized in that The mass ratio of sulfate to thiosulfate in the sulfur source culture medium is (2-10):(1-2).

10. The method according to claim 6, characterized in that The fermentation culture conditions in the sulfur source culture medium are: fermentation culture at 27-33° C. and 180-220 rpm for 40-56 hours.

Images