Enzyme mutant with high thermal stability based on deep learning modification

Abstract

The invention belongs to the technical field of gene engineering, and discloses an enzyme mutant with high thermal stability based on deep learning modification. The deep learning method can be applied to enzyme molecule modification. A deep learning method is adopted, and dominant mutants can be screened. According to the invention, key amino acid residues for regulating and controlling the thermal stability of the enzyme are found, the important guiding significance is realized on the improvement of the catalytic performance of the enzyme at high temperature, and meanwhile, powerful reference is provided for large-scale application of the enzyme in industrial production.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering and relates to an enzyme mutant with high thermal stability transformed based on deep learning. Background Art

[0002] Protein engineering is widely used in enzyme molecular modification, mainly by modifying the gene to change the protein structure to achieve the improvement of enzyme catalytic efficiency, thermal stability, substrate specificity, etc. The main methods involved are directed evolution, rational design and semi-rational design. Many examples of directed evolution have confirmed that large-scale screening of random mutations at any position in the enzyme by high-throughput screening methods can produce the desired mutants. However, due to the size of the protein and the time-consuming nature of screening, directed evolution using error-prone PCR as the main method is usually relatively inefficient. Therefore, it is necessary to rationally or semi-rationally design protein engineering with the help of computer methods. Artificial intelligence methods such as machine learning and deep learning with the help of computers are applied to protein engineering, showing unique advantages in enzyme structure prediction, stability / selectivity / catalytic activity, and guiding enzyme design. It provides new possibilities for enzyme molecular design and greatly improves experimental efficiency.

[0003] The nitrilase superfamily can be divided into 13 branches based on sequence similarity and structural functional domain classification. However, only one branch in the nitrilase superfamily has the ability to convert nitriles, while the other branches preferentially show amide hydrolysis or condensation characteristics. Most superfamily members have a common α-β-β-α structural fold and a Cys-Glu-Lys catalytic site. Nitrilase (EC3.5.5) is an enzyme in the nitrilase superfamily that can catalyze a series of nitriles into corresponding carboxylic acids and release ammonia in a one-step reaction. Nitrilase-mediated biocatalytic reactions have the advantages of mild environment, environmental friendliness, no by-products, and excellent regioselectivity, chemoselectivity and stereoselectivity of the products. Compared with the harsh acid-base reaction conditions and the generation of undesirable by-products required by traditional chemical pathways, nitrilase is expected to become a substitute for traditional chemical pathways in fine chemical production. Nitrilases have been used to catalyze the production of valuable fine chemicals such as nicotinic acid, (R)-mandelic acid, acrylic acid, glycolic acid, 1,5-dimethyl-2-piperidone, atorvastatin, gabapentin, (R)-baclofen, and (S)-pregabalin. Summary of the invention

[0004] In order to improve the thermal stability of nitrilase, the present invention provides an enzyme mutant with high thermal stability based on deep learning transformation. Based on deep learning transformation, the present invention uses nitrilase ZJB09122 as the parent and simultaneously mutates the three sites of F168, V305 and F307 to obtain a combined mutant F168V / V305L / F307Y, which greatly improves the thermal stability of nitrilase and improves the potential of nitrilase in the synthesis of gabapentin.

[0005] The specific technical scheme of the present invention is: In one aspect, the present invention provides a nitrilase mutant with high thermal stability, whose amino acid sequence is shown in SEQ ID NO.1. The present invention is based on deep learning transformation, using Acidovorax Facilis The nitrilase ZJB09122 from the original source was used as the parent, and the three sites of F168, V305 and F307 were mutated at the same time to obtain the combined mutant F168V / V305L / F307Y, which greatly improved the thermal stability of the nitrilase and increased the potential of the nitrilase in the synthesis of gabapentin.

[0006] In a second aspect, the present invention provides a gene encoding a nitrilase mutant with high thermal stability.

[0007] Specifically, the present invention provides a nucleotide sequence of a gene encoding a nitrilase mutant with high thermal stability, as shown in SEQ ID NO.2.

[0008] In a third aspect, the present invention provides a recombinant vector comprising the above-mentioned encoding gene.

[0009] In a fourth aspect, the present invention provides a genetically engineered bacterium, wherein the engineered bacterium comprises the above-mentioned encoding gene or the above-mentioned recombinant vector.

[0010] Preferably, the host bacteria of the genetically engineered bacteria is Escherichia coli.

[0011] In a fifth aspect, the present invention provides the use of the above-mentioned nitrilase mutant or the above-mentioned genetically engineered bacteria in the synthesis of gabapentin. By simultaneously mutating the three sites of F168, V305 and F307 to F168V, V305L and F307Y, the thermal stability of the nitrilase is greatly improved, thereby enhancing the potential of the nitrilase in the synthesis of gabapentin.

[0012] In a sixth aspect, the present invention provides a D-type amino acid oxidase mutant, the amino acid sequence of the D-type amino acid oxidase mutant is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4.

[0013] In a seventh aspect, the present invention provides a nitroreductase mutant, the amino acid sequence of the nitroreductase mutant is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6.

[0014] Based on the deep learning transformation method, D-type amino acid oxidase and nitroreductase can be transformed and mutated, which can also improve their thermal stability, which is beneficial to their application in the synthesis of L-phosphinothricin precursor 2-carbonyl-4[hydroxy(methyl)phosphonyl]butyric acid and 3-amino-2-hydroxyacetophenone.

[0015] Compared with the prior art, the present invention has the following technical effects: The present invention is based on Acidovorax Facilis The nitrilase ZJB09122 from the source is taken as the parent, and the combined mutant ZJB09122_M3 is screened by high-throughput screening using a deep learning method. The mutant ZJB09122_M3 is obtained by simultaneously mutating the three sites F168V, V305L, and F307Y. Specifically, a recombinant strain containing mutations is constructed, and a nitrilase mutant ZJB09122_M3 with the largest improvement in thermal stability is screened out after induction culture. The optimal pH of the mutant ZJB09122_M3 of the present invention is between 7.5-8.0; the optimal temperature is between 45-50°C; and the pH is 7.0 in Na 2 HPO 4 -NaH 2 PO 4 In the buffer solution, when the reaction temperature was 45℃, the specific activities of ZJB09122 and ZJB09122_M3 were 7.18 U / mg and 8.16 U / mg, respectively. 1 / 2 In terms of thermal stability, after ZJB09122 and ZJB09122_M3 were kept at 65°C for a period of time, the residual enzyme activities were 18.91% and 60.52% of the initial enzyme activities, respectively, and the T 50 The value is 65.0°C, which is 5.9°C higher than that of the wild type ZJB09122 at 59.1°C. Therefore, the nitrilase mutant ZJB09122_M3 of the present invention has the characteristic of high thermal stability, and the high thermal stability nitrilase mutant of the present invention has great application potential in the synthesis of gabapentin. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the SDS-PAGE analysis of the highly thermostable nitrilase mutant, where M is a low molecular weight protein marker; A and B are the purified wild enzyme ZJB09122 and mutant ZJB09122_M3, respectively; Figure 2 is the optimal pH for the highly thermostable nitrilase mutant and the wild type; Figure 3 pH stability of high specific activity thermostable xylanase mutant and wild type; Figure 4 is the optimum temperature of the highly thermostable nitrilase mutant and the wild type; Figure 5 The thermal stability of the highly thermostable nitrilase mutant and the wild type; Figure 6 The thermal stability of the highly thermostable D-amino acid oxidase mutant and the wild type; Figure 7 The thermal stability of the highly thermostable nitroreductase mutant and the wild type. DETAILED DESCRIPTION

[0017] Experimental materials and detection methods used in the examples: 1. Strains and vectors: Expression host E. coli BL21 is kept in this laboratory.

[0018] 2. Enzymes and other biochemical reagents: High-fidelity DNA polymerase was purchased from Vazyme, 1-cyanocyclohexylacetonitrile was purchased from Carbosynth China Ltd, and 1-cyanocyclohexylacetic acid was provided by Zhejiang Yongtai Chemical Co., Ltd. D,L-phosphinothricin was purchased from Sigma-Aldrich; 2,4-dinitrophenylhydrazine (DNPH) was purchased from Aladdin Reagents (Shanghai, China), and commercial micrococcal catalase was purchased from Sigma Aldrich (Shanghai, China). m-Nitroacetophenone and 3-amino-2-hydroxyacetophenone were purchased from Aladdin Reagents (Shanghai, China). Other reagents can be purchased from general biochemical reagent companies.

[0019] 3. Culture medium: 1) LB medium (liquid): 1% peptone, 0.5% yeast extract, 1% NaCl; 2) LB medium (solid): 1% peptone, 0.5% yeast extract, 1% NaCl, 1% agar powder.

[0020] 4. Detection method: The HPLC analysis method for the product 1-cyanocyclohexylacetic acid is as follows: the chromatographic column is a J&K Scientific C18-H column (4.6×250mm, 5 μm, 120 Å), the mobile phase is a buffer (0.58 g / L ammonium dihydrogen phosphate, 1.8375 g / L sodium perchlorate, the pH is adjusted to 1.8 with perchloric acid, and the solvent is deionized water): acetonitrile = 76:24 (v:v), the flow rate is 1 mL / min, the injection volume is 10 μL, the UV detection wavelength is 215 nm, and the column temperature is 40°C.

[0021] The HPLC analysis method of the product 2-carbonyl-4[hydroxy(methyl)phosphonyl]butyric acid (PPO) is as follows: column temperature / Welchrom®C18; column temperature / 30°C; flow rate / 1mL / min; detection wavelength / 232nm; mobile phase A is pure acetonitrile, and mobile phase B is 1‰ tetrabutylammonium bromide (NH2)HPO4 (50mM pH 3.8). A and B are mixed in a ratio of 12:88 (V / V).

[0022] The HPLC analysis method of the product 3-amino-2-hydroxyacetophenone is as follows: chromatographic column / Avantor® phenyl; column temperature / 40°C; flow rate / 1mL / min; detection wavelength / 235nm; mobile phase: 13.5mM trifluoroacetic acid: pure acetonitrile (V / V) = 75:25.

[0023] Definition of pure enzyme activity: Under certain conditions, the amount of enzyme required to catalyze the substrate to produce 1 μmol of product per minute is defined as one activity unit, denoted as U.

[0024] Example 1 Obtaining a gene encoding an enzyme mutant with improved thermal stability This embodiment is based on a deep learning method, with nitrilase ZJB09122 as the parent, and the nitrilase mutant ZJB09122_M3 is obtained by design. The nitrilase mutant ZJB09122_M3 is obtained by simultaneously mutating the three sites of F168, V305 and F307 of nitrilase ZJB09122, and the mutations are: F168V, V305L, F307Y. The amino acid sequence of the nitrilase mutant ZJB09122_M3 is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.2. A person of ordinary skill in the art can obtain an enzyme mutant based on the above sequence.

[0025] Example 2 Obtaining a highly thermostable nitrilase mutant In this example, the expression plasmid pET-28b(+)-ZJB09122 was used as a template, and the whole plasmid was amplified. The primer sequences in Table 1 were used to perform point mutations on sites 168, 194, and 305 to obtain the mutant ZJB09122_M3.

[0026] Table 1 Primer sequences Serial number Primer name Sequence (5'—3') 1 F168V-f GCTGGGAGCACGTTCAGCCGCTGT 2 F168V-r GTGCTCCCAGCAGTTCAGACCAC 3 L194A-f ATGTCCCCGGCACAACCGGACGTG 4 L194A-r GTCCGGTTGTGCCGGGGACATAG 5 V305L-f GTCCTGTCCCTACAGTTCGACCCG 6 V305L-r GGACAGGACATCAGGGCG The PCR (50 μL) amplification system was as follows: 25 μL 2× PCR buffer, 2 μL upstream and downstream primers, 1 μL template plasmid, 1 μL dNTP, 0.5 μL high-fidelity enzyme, and ddH 2 Add 0.1% HO to make up to 50 μL.

[0027] The PCR amplification program was as follows: (1) pre-denaturation at 95°C for 5 min, (2) denaturation at 95°C for 30 s, (3) annealing at 60°C for 30 s, (4) extension at 72°C for 5 min, 30 cycles, (5) extension at 72°C for 10 min, and (6) storage at 4°C. pET-28b(+)-ZJB09122 and pET-28b(+)-ZJB09122_M3 were transfected into E. coli BL21 to obtain wild-type BL21 / ZJB09122 and BL21 / ZJB09122_M3, and ZJB09122 and ZJB09122_M3 were cultured. The steps are as follows: 30 μL of glycerol bacterial solution (30% glycerol: bacterial solution (v / v) = 1:1) was taken into 10 mL of LB medium containing 50 μg / mL kanamycin, and cultured in a shaker at 37°C and 180 rpm for 8 h; inoculated into a flask containing 100 mL of LB liquid medium at a volume ratio of 2%, and 100 μL of 50 μg / mL kanamycin was added, and cultured in a shaker at 37°C and 150 rpm. When OD600 = 0.4-0.6, 100 μL of 0.1 mmol / L IPTG was added, and cultured in a shaker at 28°C and 150 rpm for 14 h. The cultured bacterial solution was centrifuged at 8000 rpm for 10 min to obtain wet cells, and 10 mL of 0.2 mol / L Na 2 HPO 4 -NaH 2 PO 4Buffer (pH 7.0) was blown and mixed to make a cell suspension, which was placed in an ice-water bath at 4°C for ultrasonic disruption. The conditions for ultrasonic disruption were: 400 W, 10 min, disruption for 2 s, and pause for 4 s. The disrupted product was centrifuged at 8000 rpm for 10 min, and the supernatant was taken as the crude enzyme solution. The crude enzyme solution was treated by nickel column affinity chromatography to obtain pure nitrilase enzyme solution for enzymatic property determination and comparison. The protein expression of ZJB09122 and ZJB09122_M3 was detected by SDS-PAGE, as shown in Figure 1 As shown, A is the protein purified from ZJB09122, and B is the protein purified from ZJB09122_M3, and the protein sizes are both 42 kDa.

[0028] Example 3 Comparative analysis of the enzymatic properties of the highly thermostable nitrilase mutant and the wild type 1. Determination of the optimal pH of highly thermostable nitrilase mutants and wild type The purified nitrilase mutant and wild type of Example 2 were reacted at pH 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0, respectively, to determine their optimal pH. The results are shown in Figure 2 The reaction system is as follows: 0.2 mol / L substrate 1-cyanocyclohexylacetonitrile is added to different pH buffer solutions, the volume of the buffer solution is 1 mL, 0.01 g of enzyme is added, and then the reaction is carried out at 35°C for 10 min to determine the nitrilase activity. The pH buffer solution is composed of citric acid-sodium citrate buffer (pH 4.0-5.0), NaHPO-NaH 2 PO 4 Buffer (pH 6.0-8.0) and glycine sodium hydroxide buffer (pH 9.0) were mixed and prepared.

[0029] Depend on Figure 2 It can be seen that the optimal reaction pH of the wild-type nitrilase ZJB09122 and the mutant nitrilase ZJB09122_M3 are 7.5 and 8.0, respectively.

[0030] 2. Determination of pH stability of highly thermostable nitrilase mutants and wild type The nitrilase mutants and wild type were diluted with buffer solutions at pH 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0, respectively, and then placed in a 35°C constant temperature water bath for 10 min. The relative residual enzyme activity was then determined at pH 7.0 and 35°C. The reaction system was: 0.2 mol / L substrate 1-cyanocyclohexylacetonitrile, 1 mL pH 7.0 Na 2 HPO 4 -NaH2 PO 4 Buffer, 0.01 g enzyme, react at 35°C for 10 min. The untreated enzyme activity was taken as 100% for control. The results are shown in Figure 3 .

[0031] The results are as follows Figure 3 As shown, the nitrilase mutant was more stable than the wild type under acidic conditions (pH 5.0-6.5).

[0032] 3. Determination of the optimal temperature of highly thermostable nitrilase mutants and wild type In 0.2 mol / L Na, pH 7.0 2 HPO 4 -NaH 2 PO 4 In the buffer system, the enzymatic reaction was carried out at different temperatures (30°C, 35°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C). The results are shown in Figure 4 The enzyme reaction system was: 0.2 mol / L substrate 1-cyanocyclohexylacetonitrile, 1 mL pH 7.0 NaHPO-NaH 2 PO 4 Buffer, 0.01 g enzyme mass, reaction at different temperatures for 10 min.

[0033] The results are as follows Figure 4 As shown, the optimum temperatures of the recombinant highly thermostable nitrilase mutant and the wild-type nitrilase are 50°C and 45°C, respectively, and the optimum temperature of the mutant is 5°C higher than that of the wild-type.

[0034] 4. Determination of the thermal stability of highly thermostable nitrilase mutants and wild type The thermal stability of the nitrilase mutant ZJB09122_M3 and the wild-type nitrilase ZJB09122 was determined as follows: the nitrilase mutant and the wild-type were kept at 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, and 75°C for 10 min, and then 0.2 mol / L of substrate was added and the enzymatic reaction was carried out at 35°C. The reaction system was: 0.2 mol / L substrate 1-cyanocyclohexylacetonitrile, 1 mL pH 7.0 NaHPO-NaH 2 PO 4 Buffer, 0.01 g enzyme, react at 35°C for 10 min. Detect the remaining enzyme activity.

[0035] The results are as follows Figure 5 As shown, the T of the nitrilase mutant ZJB09122_M3 50 The value was 65.0℃, which was 5.9℃ higher than that of the wild type (59.1℃).

[0036] 5. Determination of the t of the highly thermostable nitrilase mutant and wild-type nitrilase 1 / 2 value The purified nitrilase was heated in 0.2 mol / L NaHPO-NaH 2 PO 4 Incubate in buffer and measure residual activity at regular intervals to determine the half-life of heat inactivation. 1 / 2 The initial and residual activities were measured by HPLC, and the first-order rate constant of irreversible thermal denaturation was analyzed based on the slope of the initial activity / residual activity versus time curve, and the half-life (t 1 / 2 The results are shown in Table 2.

[0037] The results are shown in Table 2. At 45°C, the specific activity of the wild type ZJB09122 was 7.18 U / mg, and the specific activity of the mutant ZJB09122_M3 was 8.16 U / mg, which was higher than that of the wild type. 1 / 2 The expression of β-catenin in the wild type was 48 h, which was 32 h longer than the wild type (16 h).

[0038] Table 2 Specific activity and t of wild type and mutants at 45℃ 1 / 2 Compare Specific activity (U / mg) <![CDATA[t 1 / 2 (h)]]> ZJB09122 7.18±0.56 16±0.5 ZJB09122_M3 8.16±0.63 48±1.0 Example 4 Obtaining a highly thermostable D-type amino acid oxidase mutant This example is derived from fungi Rasamsonia emersonii The D-type amino acid oxidase A0A499UB99 was used as the parent, and the A50C, D100S, and A250G mutations were made to obtain the mutant A0A499UB99_M3. The amino acid sequence of the D-type amino acid oxidase mutant A0A499UB99-M3 is shown in SEQ ID NO: 3, and the nucleotide sequence is shown in SEQ ID NO: 4. The primer sequences are shown in Table 3, and the PCR amplification system is the same as in Example 2.

[0039] Table 3 Primer sequences Serial number Primer name Sequence (5'—3') 1 A50C-f AGTCCGTGGTGTGGTGCAAATTATCTG 2 A50C-r AATTTGCACCACACCACGGACTACAAT 3 D100S-f CGTACCAAAAGCCAGGGTTCTACAACA 4 D100S-r AGAACCCTGGCTTTTGGTACGATTATA 5 A250G-f ACACGTGCAGGTGGTGGTGGTACAA 6 A250G-r ACCACCACCTGCACGTGTCATCAT pET-28b(+)-A0A499UB99 and pET-28b(+)-A0A499UB99_M3 were transfected into E. coli BL21 to obtain wild-type BL21 / A0A499UB99 and BL21 / A0A499UB99_M3, and A0A499UB99 and A0A499UB99_M3 were cultured. The steps are as follows: Pipette 30 μL of glycerol bacterial solution (mass concentration of 30% glycerol: bacterial solution (v / v) = 1:1) into 10 mL of LB medium containing 50 μg / ml streptomycin sulfate, and culture it in a shaker at 37°C and 180 rpm for 8 h; inoculate it into a flask containing 100 mL of LB liquid medium at a volume ratio of 2%, add 100 μL of 50 μg / mL kanamycin, and culture it in a shaker at 37°C and 150 rpm until OD 600 =0.4-0.6, add 100 μL of 0.1 mmol / L IPTG, and culture in a shaker at 28°C and 150 rpm for 14 h. Centrifuge the cultured bacterial solution at 8000 rpm for 10 min to obtain wet cells.

[0040] Example 5 Comparison of thermal stability of wild-type and mutant D-amino acid oxidase The thermal stability of A0A499UB99 and A0A499UB99_M3 was determined as follows: the mutant and wild type were kept at 35°C, 45°C, 50°C, 55°C, 60°C, 65°C, and 70°C for 10 min, then 0.1 mol / L substrate was added and the enzymatic reaction was carried out at 35°C. The reaction system was: 0.1 mol / L substrate racemic glufosinate ammonium salt, 1 mL pH 7.0 NaHPO-NaH 2 PO 4 Buffer, 0.03 g enzyme, react at 35°C for 10 min. The untreated enzyme activity was taken as 100% as a control, and the remaining enzyme activity of each was detected.

[0041] The results are as follows Figure 6 As shown, the T of mutant A0A499UB99_M3 50 The value was 53.0℃, which was 4.8℃ higher than that of the wild type (48.2℃).

[0042] Example 6 Obtaining nitroreductase mutants This embodiment is derived from Bartonella henselae The wild-type nitroreductase K8099RS04 was used as the parent, and the mutant K8099RS04_M3 was obtained by mutating A41G, I59C, and D139C. The amino acid sequence of the D-type amino acid oxidase mutant K8099RS04_M3 is shown in SEQ ID NO: 5, and the nucleotide sequence is shown in SEQ ID NO: 6. The primer sequences are shown in Table 4, and the PCR amplification system is the same as in Example 2.

[0043] Table 4 Primer sequences Serial number Primer name Sequence (5'—3') 1 A41G-f GCTGCTCGTGGTCCATCTGGTACC 2 A41G-r ACCAGATGGACCACGAGCAGCCAG 3 I59C-f ACCGGTAAGTGTCTGCAGAAAGTG 4 I59C-r TTTCTGCAGACACTTACCGGTCAG 5 D139C-f TTCACCATCTGTCACGACATGGAA 6 D139C-r CATGTCGTGACAGATGGTGAACAG pET-28b(+)-K8099RS04 and pET-28b(+)-K8099RS04_M3 were respectively transfected into Escherichia coli BL21 to obtain wild-type BL21 / K8099RS04 and BL21 / K8099RS04_M3. K8099RS04 and K8099RS04_M3 were cultured according to the method of Example 2 to obtain bacteria and enzymes.

[0044] Example 7 Comparison of thermal stability of wild-type and mutant nitroreductase The thermal stability determination method of K8099RS04 and K8099RS04_M3 is as follows: the mutant and wild type are kept at 45℃, 50℃, 55℃, 60℃, 65℃, 70℃, and 75℃ for 10 min, then 0.1 mol / L substrate is added, and the enzymatic reaction is carried out at 35℃. The reaction system is: 1mL reaction system includes: 10 g / L m-nitroacetophenone, 100mM pH8.0 phosphate buffer, 10g / L nitroreductase or its mutant frozen cells, and the reaction is carried out at 35℃ for 10min. The untreated enzyme activity is taken as 100% for control, and the residual enzyme activity of each is detected.

[0045] The results are as follows Figure 7 As shown, the T of mutant A0A499UB99_M3 50 The value was 56.1℃, which was 5.3℃ higher than that of the wild type (50.8℃).

[0046] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0047] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. An enzyme mutant with high thermal stability modified based on deep learning, characterized in that: The amino acid sequence is shown in SEQ ID NO.

1.

2. A gene encoding the enzyme mutant according to claim 1.

3. The coding gene according to claim 2, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

2.

4. A recombinant vector, characterized in that: The recombinant vector comprises the coding gene according to claim 2.

5. A genetically engineered bacterium, characterized in that: The engineered bacteria comprises the coding gene according to claim 2 or the recombinant vector according to claim 4.

6. The genetically engineered bacterium according to claim 5, characterized in that: The host bacteria of the genetically engineered bacteria is Escherichia coli.

7. Use of the enzyme mutant according to claim 1 in the synthesis of gabapentin.

8. Use of the genetically engineered bacteria as claimed in claim 5 in the synthesis of gabapentin.

Images