Application of ATOH8 in preparation of medicine for treating prostatic cancer

Abstract

The invention relates to application of a eukaryotic cell tumor inhibition transcription factor ATOH8 in preparation of a medicine for treating prostatic cancer. It is found that ATOH8 can inhibit transcription of downstream prostate cancer related genes SLC7A11 and CDK2. The invention finds that the in-vivo tumorigenic ability of prostate cancer cells is obviously reduced after exogenous direct up-regulation of ATOH8 expression. The invention finds that UBR5 can specifically degrade ATOH8 in a ubiquitination manner, and the degradation of ATOH8 can be reduced by specifically inhibiting the expression of UBR5 or the function of UBR5, so that the content of ATOH8 in tumor cells is indirectly increased. According to the invention, ATOH8 is used as a new target for preparing a new prostatic cancer treatment drug, and direct and / or indirect up-regulation of ATOH8 expression can be used as a brand-new prostatic cancer treatment method.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of ATOH8 in preparing medicine for treating prostate cancer. Background Art

[0002] Prostate cancer is a malignant tumor that occurs in prostate epithelial cells. It is the second most common cancer in men worldwide and the eighth leading cause of cancer-related deaths. Currently, the mainstream treatment for prostate cancer is androgen deprivation therapy (ADT), which inhibits the growth of cancer cells by reducing or blocking the effects of androgens. However, many patients develop drug resistance after receiving ADT, which poses a serious threat to the patient's life. Therefore, it is crucial to find new treatment strategies to overcome drug resistance, such as targeting other signaling pathways, immunotherapy, or combination drug therapy.

[0003] Gene therapy for prostate cancer is to introduce some exogenous genes into the nucleus of human cells to make up for or correct the defects of some human genes, so as to achieve the purpose of correcting cell defects and treating diseases. The genes used for gene therapy for prostate cancer mainly include genes related to homologous recombination repair (HRR), such as: BRCA1 and BRCA2; ATM; PALB2 and RAD51D; CHEK2 and CDK12. Mutations in these genes may make prostate cancer cells more sensitive to certain drugs, such as PARP inhibitors. In addition, some studies have mentioned other genes that may be related to the development of prostate cancer, such as ACSL3 and ACSL42.

[0004] ATOH8 is a member of the basic helix-loop-helix (bHLH) protein transcription factor family. ATOH8 is reported to play an important role in embryonic development, regulating the development of nerves, kidneys, pancreas, muscle, bone and cartilage. Currently, the mechanism by which ATOH8 participates in tumor cell regulation has not been fully studied, and it has not yet been used for the treatment of prostate cancer. Summary of the invention

[0005] 1. Technical issues to be solved

[0006] In view of the deficiencies in the prior art, the present invention provides the use of ATOH8 in the preparation of a drug for treating prostate cancer.

[0007] (II) Technical solution

[0008] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0009] In one aspect, the present invention provides a use of a eukaryotic cell tumor suppressor transcription factor ATOH8 in the preparation of a drug for treating prostate cancer. The ATOH8 is upregulated, and the cDNA sequence of the ATOH8 is shown in SEQ ID NO: 1. The upregulation of the ATOH8 expression is achieved by directly exogenously overexpressing ATOH8 or using an inhibitor of the ATOH8 key ubiquitin ligase UBR5.

[0010] In one aspect, the present invention provides a use of a plasmid containing a gene encoding a eukaryotic tumor suppressor transcription factor ATOH8 in the preparation of a drug for treating prostate cancer.

[0011] In one aspect, the present invention provides an inhibitor of a key ubiquitin ligase UBR5 for use in the preparation of a drug for treating prostate cancer or an agent for inhibiting ubiquitin degradation of eukaryotic cell tumor suppressor transcription factor ATOH8. The amino acid sequence of UBR5 is shown in SEQ ID NO:2.

[0012] In one aspect, the present invention provides a shRNA for the key ubiquitin ligase UBR5, wherein the targeting sequence of the shRNA is shown in SEQ ID NO:3.

[0013] In one aspect, the present invention provides a plasmid, wherein the plasmid expresses shRNA of UBR5, and preferably, the backbone vector of the plasmid is a plko.1 vector.

[0014] In one aspect, the present invention provides the use of UBR5 shRNA and its plasmid in the preparation of a drug for treating prostate cancer or an agent for inhibiting ubiquitination and degradation of eukaryotic cell tumor suppressor transcription factor ATOH8.

[0015] In one embodiment, the UBR5 inhibitor includes siRNA, dsRNA, miRNA, shRNA targeting the UBR5 gene, a gene editing system targeting the UBR5 gene, and / or an antibody, antigen binding fragment or other small molecule drug targeting the UBR5 protein.

[0016] In one embodiment, exogenously directly upregulating its expression significantly reduces the in vivo tumorigenicity of prostate cancer cells. Exogenously directly upregulating its expression can inhibit the growth of tumor cells by inhibiting the expression of downstream target genes including but not limited to SLC7A11 and CDK2.

[0017] In one embodiment, the key ubiquitination ligase UBR5 for protein ubiquitination degradation of ATOH8 is highly expressed in tumor cells including but not limited to prostate cancer, resulting in ubiquitination degradation of ATOH8. The K225R mutation of ATOH8 can prevent it from being ubiquitinated and degraded.

[0018] In one embodiment, the expression of UBR5 or its biological function is targetedly inhibited exogenously in tumor cells, and the specific methods include but are not limited to 1) using targeted knockout technology of UBR5 (such as CRISP / Cas9 system); 2) using targeted knockdown technology of UBR5 gene (such as expressing shRNA that targets and inhibits UBR5 expression through lentiviral vector); 3) using various small molecule inhibitors that inhibit UBR5 function (including but not limited to the function of UBR5 to ubiquitinate and degrade ATOH8). These methods inhibit UBR5 expression, thereby maintaining the content of ATOH8 in tumor cells and retaining its function of transcriptionally inhibiting downstream target genes (including but not limited to target genes such as SLC7A11 and CDK2), which can be applied to the treatment of tumors including but not limited to prostate cancer.

[0019] (III) Beneficial effects

[0020] The present invention provides the use of ATOH8 in the preparation of a drug for treating prostate cancer. Compared with the prior art, it has the following beneficial effects:

[0021] 1. The present invention discovered for the first time that ATOH8 can inhibit the transcription of downstream prostate cancer-related genes SLC7A11 and CDK2. Existing studies have shown that increased expression of SLC7A11 and CDK2 can help tumor cells resist oxidative stress and promote tumor cell proliferation. Changes in the activity of these two genes are closely related to the viability of prostate cancer cells and their response to treatment.

[0022] 2. The present invention is the first to discover that the in vivo tumor-forming ability of prostate cancer cells is significantly reduced after direct exogenous overexpression of ATOH8.

[0023] 3. The present invention discovered for the first time that specific knockout or knockdown of UBR5 can indirectly upregulate the content of ATOH8 in tumor cells, and the in vivo tumorigenic ability of prostate cancer cells is significantly reduced.

[0024] In general, the present invention uses ATOH8 as a new target for preparing new prostate cancer therapeutic drugs, and directly and / or indirectly upregulating ATOH8 expression can be used as a new prostate cancer therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1Overexpression of ATOH8 was shown to inhibit prostate cancer proliferation in vitro; Figure 1 After A-1B overexpressed ATOH8, the mRNA and protein expression levels of ATOH8 were significantly upregulated compared with the empty vector control; Figure 1 The absorbance OD value of CCK8 reagent used to reflect cell activity at 450nM was significantly reduced from 1.7±0.02 in the control group to 1.3±0.03.

[0027] Figure 2 Overexpression of ATOH8 was shown to inhibit prostate cancer growth in vivo.

[0028] Figure 3 ATOH8 was shown to inhibit the expression of SLC7A11 and CDK2; Figure 3 A The expression of ATOH8 was negatively correlated with that of SLC7A11. In DU145 cells overexpressing ATOH8, the mRNA and protein expression levels of SLC7A11 were significantly decreased. Figure 3 B In DU145 cells overexpressing ATOH8, the mRNA and protein expression levels of CDK2 were significantly decreased.

[0029] Figure 4 It was shown that UBR5 can degrade ATOH8 through ubiquitination; Figure 4 A. Immunoprecipitation results showed that ATOH8 could bind to UBR5; Figure 4 B After knocking down UBR5 in DU145 cells, the protein content of ATOH8 in the cells increased significantly.

[0030] Figure 5 It was shown that UBR5 is highly expressed in prostate cancer.

[0031] Figure 6 showed that knockdown of UBR5 inhibited prostate cancer growth in vitro.

[0032] Figure 7 showed that knockdown of UBR5 inhibited prostate cancer growth in vivo.

[0033] Figure 8 The K225R mutation of ATOH8 was shown to prevent its degradation by ubiquitination.

[0034] In the above figures, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] The embodiments of the present invention reveal for the first time that the in vivo tumorigenicity of prostate cancer cells is significantly reduced after directly and / or indirectly upregulating ATOH8 expression, indicating that ATOH8 can be used to prepare drugs for treating prostate.

[0037] The technical solution in the embodiment of the present application is to solve the above technical problems, and the overall idea is as follows:

[0038] 1. The present invention first discovered that ATOH8 inhibits the transcription of prostate cancer-related genes SLC7A11 and CDK2. Therefore, the present invention provides a method for exogenously upregulating ATOH8 expression for use in preparing a drug for treating prostate cancer.

[0039] 2. The present invention screened immunoprecipitated proteins that may interact with ATOH8 through mass spectrometry analysis, and found that UBR5, an E3 ubiquitin ligase, can specifically ubiquitinate and degrade ATOH8, which is in a state of high expression in tumor cells, thereby reducing the content of its substrate ATOH8. Therefore, by specifically inhibiting the expression or function of UBR5, the degradation of ATOH8 can be reduced, and the content of ATOH8 in tumor cells can be indirectly increased. Based on this, the present invention also provides a method for exogenous specific knockout / knockdown of UBR5 expression or inhibition of its function to indirectly upregulate ATOH8 expression for the preparation of drugs for the treatment of prostate cancer.

[0040] 3. The present invention also provides relevant evidence to confirm that overexpression of ATOH8 can exert a transcriptional inhibitory effect on downstream target genes, two of which are known important molecules related to prostate cancer, SLC7A11 and CDK2.

[0041] In order to better understand the above technical solution, the above technical solution will be described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0042] Example 1: Inhibitory effect of ATOH8 on the growth of prostate cancer cells

[0043] (1) Construct an expression plasmid for exogenous overexpression of ATOH8.

[0044] The ATOH8 cDNA sequence obtained by PCR was homologously recombined into the plenti vector by restriction digestion with EcoRI and BamHI to obtain the plenti-ATOH8 overexpression plasmid.

[0045] (2) Production of lentivirus: The target plasmid was mixed with the viral packaging plasmid psPAX2, pMD2G (purchased from addgene, catalog number 12260, 12259) at a mass ratio of 3:2:1, and then 3 volumes of polybrene (1 μg / μl) were added, vortexed and allowed to stand for 15 min. 293T cells (purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, catalog number: SCSP-502) were plated on a 10 cm dish and replaced with serum-free medium before transfection. After 6 h of transfection, the medium was replaced with complete medium containing 10% FBS. After 48 h, the cell supernatant was collected and centrifuged at 2000 rpm for 5 min to obtain the supernatant. After filtering with a 0.4 μM filter, the virus solution was stored in a -80°C refrigerator for subsequent use.

[0046] (3) Transfection of prostate cancer cells: Add the virus solution and 10% FBSDMEM culture medium into DU145 cells (purchased from Shanghai Cell Bank, Chinese Academy of Sciences, catalog number: SCSP-5024) in a 1:1 ratio, add polybrene (millipore, TR-1003-G) at a final concentration of 8 μg / ml, and change the medium after 16 hours; after 48 hours, add puromycin (purchased from Biosharp, BS111) at a final concentration of 0.1 μg / ml for screening, and obtain a stable monoclonal cell line after 2 weeks of screening.

[0047] (4) Determination of cell activity: Overexpressing ATOH8 (named DU145 ATOH8 OE cells) and control DU145 cells (named DU145 Vector cells) were plated into 96-well plates. After overnight attachment, cell activity was detected every 24 hours. Specifically, the original culture medium was discarded, serum-free DMEM medium containing 10% CCK8 (purchased from Biosharp, BS350C) was added, and the reaction was carried out at 37°C for 1 hour, and the absorbance was measured at 450 nM using an enzyme reader.

[0048] The experimental results showed that after overexpression of ATOH8, the mRNA of ATOH8 (see Figure 1 A) and protein expression levels (see Figure 1 B) was significantly upregulated compared with the empty vector control. The absorbance OD value of the CCK8 reagent used to reflect cell activity at 450 nM was significantly downregulated from 1.7 ± 0.02 in the control group to 1.3 ± 0.03 (see Figure 1 C) These experimental results indicate that overexpression of ATOH8 can inhibit the growth of prostate cancer cells in vitro.

[0049] Example 2: Overexpression of ATOH8 significantly reduced the tumorigenicity of prostate cancer cells in vivo

[0050] Tumor formation in nude mice: Ten male BALB / c nude mice were divided into two groups. Each group was subcutaneously injected with a 1:1 mixture of 3x10^6 DU145 Vector or DU145 ATOH8 OE cells and matrix gel (purchased from Corning, 354234). After 4 weeks, the nude mice were killed, and the tumor tissues were collected and measured for weight.

[0051] The experimental results showed that the tumor-forming ability of nude mice subcutaneously implanted with DU145 cells overexpressing ATOH8 was significantly reduced (OE-ATOH8 group) (see Figure 2 ). It can be seen that overexpression of ATOH8 significantly weakened the tumorigenic ability of prostate cancer cells.

[0052] Example 3: Overexpression of ATOH8 inhibits the expression of SLC7A11 and CDK2 in prostate cancer (1) The GEPIA2 online website was used to explore the relationship between ATOH8 expression and SLC7A11 and CDK2 expression in the TCGA prostate cancer dataset, and they showed a significant negative correlation.

[0053] (2) DU145 Vector was extracted using RNAfast200 kit (purchased from Fastagen, catalog number 220011), and total RNA of DU145 ATOH8 OE cells was reverse transcribed to obtain total cDNA as PCR template, and the mRNA expression of SLC7A11 and CDK2 was detected by fluorescence quantitative PCR. When DU145 cells overexpressed ATOH8, the mRNA expression of SLC7A11 and CDK2 was reduced.

[0054] (3) The primer sequences for related gene expression detection are shown in Table 1.

[0055] Table 1 Primer sequences for related gene expression detection

[0056] serial number name sequence SEQ ID NO:5 SLC7A11-F TCTCCAAAGGAGGTTACCTGC SEQ ID NO:6 SLC7A11-R AGACTCCCCTCAGTAAAGTGAC SEQ ID NO:7 CDK2-F ATGGATGCCTCTGCTCTCACTG SEQ ID NO:8 CDK2-R CCCGATGAGAATGGCAGAAAGC SEQ ID NO:9 ACTB-F CACCATTGGCAATGAGCGGTTC SEQ ID NO:10 ACTB-R AGGTCTTTGCGGATGTCCACGT

[0057] (4) RIPA with protease inhibitor (purchased from Bio-Tech, catalog number P1005)

[0058] Lysis buffer (purchased from Biyuntian, product number P0013B) was used to extract DU145 Vector, DU145

[0059] Total protein of ATOH8 OE cells, detection of SLC7A11 by western blot

[0060] (Proteintech, 26864-1-AP), CDK2 (Proteintech, 10122-1-AP) expression. When DU145 cells overexpress ATOH8, the protein expression of SLC7A11 and CDK2 is reduced.

[0061] The experimental results showed that the gene expression correlation analysis of the relevant data in the TCGA-PRAD database showed that the expression of ATOH8 was negatively correlated with that of SLC7A11. In DU145 cells overexpressing ATOH8, the mRNA and protein expression levels of SLC7A11 were significantly decreased (see Figure 3 A). Similarly, the above bioinformatics analysis revealed that the expression of ATOH8 was negatively correlated with that of CDK2. In DU145 cells overexpressing ATOH8, the mRNA and protein expression levels of CDK2 were significantly decreased (see Figure 3 B) These results suggest that overexpression of ATOH8 can inhibit the expression of downstream SLC7A11 and CDK2.

[0062] Example 4: UBR5 ubiquitin-degrades ATOH8

[0063] (1) Immunoprecipitation: Total protein from DU145 ATOH8-Flag OE cells was extracted, 10 μl Flag beads (purchased from MCE, catalog number HY-K0207) were added, and the cells were incubated at 4°C overnight. Nonspecific binding proteins were washed away, and proteins such as ATOH8 (abcam, ab106377) and UBR5 (CST, 65344) were detected by Western blot.

[0064] (2) Construction of DU145 sh UBR5 cell line: A shUBR5 expression plasmid was constructed, and the targeting sequence was: 5'-GGATACACCTCAACTAGAACG-3' (SEQ ID NO: 3). The sequence was cloned into the plko.1 vector (purchased from Addgene, catalog number 10878). The corresponding lentivirus was produced and infected with DU145 cells according to the method of lentivirus production in step (2) of Example 1. The subclone cell line stably expressing sh-UBR5 was obtained by screening with puromycin (0.1 μg / ml) and named DU145 sh-UBR5 cell line. The corresponding control was named DU145 sh-CTRL cell line.

[0065] (3) Detection of ATOH8 protein expression after knockdown of UBR5 expression: Proteins of UBR5 knockdown and control DU145 cells were extracted, and the expression of UBR5 and ATOH8 was detected by Western blot technology.

[0066] The experimental results showed that ATOH8 can bind to UBR5. After knocking down UBR5 in DU145 cells, the protein content of ATOH8 in the cells increased significantly (see Figure 4 ). It can be seen that UBR5 can degrade ATOH8 through ubiquitination.

[0067] Example 5: Bioinformatics analysis suggests that UBR5 is highly expressed in prostate cancer

[0068] Using the UALCAN website (http: / / ualcan.path.uab.edu / ) to search for the expression of UBR5 in prostate cancer, we found that data analysis of clinical data sets suggested that UBR5 is highly expressed in a variety of human tumors, including prostate cancer (see Figure 5 ).

[0069] Example 6: Knockdown of UBR5 inhibits the growth of prostate cancer cells in vitro

[0070] Determination of cell activity: The UBR5 knockdown DU145 cells or control DU145 cells constructed in Example 5 were plated into a 96-well plate. After overnight attachment, the cell activity was detected every 24 hours, specifically by adding serum-free DMEM culture medium containing 10% CCK8 (purchased from Biosharp, BS350C), reacting at 37°C for 1 hour, and measuring the absorbance at 450 nM using a microplate reader.

[0071] The experimental results showed that after knocking down UBR5, the absorbance OD value of CCK8 reagent used to reflect cell activity at 450nM was significantly reduced from 2.3±0.01 in the control group to 1.7±0.02 (see Figure 6 ). These experimental results indicate that knocking down UBR5 can inhibit the growth of prostate cancer cells in vitro.

[0072] Example 7: The in vivo tumorigenic ability of prostate cancer cells was significantly reduced after knocking down UBR5.

[0073] Subcutaneous tumor bearing experiment in nude mice: 10 male BALB / c nude mice were divided into 2 groups. Each group was subcutaneously injected with 3x10^6 DU145 sh-CTRL or DU145 sh-UBR5 cells and a 1:1 mixture of matrix gel (purchased from Corning, 354234). After 4 weeks, the nude mice were killed, and the tumor tissues were collected and measured for weight.

[0074] The experimental results showed that the tumor-forming ability of nude mice subcutaneously implanted with DU145 cells with UBR45 knockdown was significantly reduced (sh-UBR5 group) (see Figure 7 ).

[0075] Example 8: K225R mutation of ATOH8 prevents it from being degraded by ubiquitination

[0076] (1) Construction of DU145 ATOH8 K225R overexpression cell line: Construct ATOH8 K225R overexpression plasmid, the cDNA sequence is SEQ ID NO: 4. This sequence was cloned into plko.1

[0077] Vector (purchased from Addgene, catalog number 10878). According to the method of lentivirus production in Example 2 (2), the corresponding lentivirus was produced and infected to DU145 cells, and the subclone cell line stably expressing ATOH8 K225R was obtained by puromycin (0.1 μg / ml) screening, and was named DU145 ATOH8 K225R cell line.

[0078] (2) Detection of ATOH8 K225R protein stability: The aforementioned DU145 ATOH8 OE and DU145 K225R OE cells were plated in six-well plates and treated with cycloheximide (CHX, purchased from MCE, catalog number HY-12320) for 0, 3, 6, and 9 h.

[0079] Afterwards, protein was extracted and the expression of ATOH8 was detected by Western blot.

[0080] The experimental results showed that after inhibiting protein synthesis, ATOH8 K225R was less degraded than ATOH8WT, indicating that the K225R mutation of ATOH8 can prevent it from being degraded by ubiquitination (see Figure 8 ).

[0081] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of a eukaryotic cell tumor suppressor transcription factor ATOH8 in the preparation of a drug for treating prostate cancer.

2. The use according to claim 1, characterized in that: The cDNA sequence of ATOH8 is shown in SEQ ID NO:

1.

3. The use according to claim 1 or 2, characterized in that: Upregulation of ATOH8 expression was achieved by directly overexpressing ATOH8 exogenously or using an inhibitor of UBR5, a key ubiquitination ligase of ATOH8.

4. Use of a plasmid containing a gene encoding the eukaryotic tumor suppressor transcription factor ATOH8 in the preparation of a drug for treating prostate cancer.

5. Use of an inhibitor of a key ubiquitin ligase UBR5 in the preparation of a drug for treating prostate cancer or an agent for inhibiting ubiquitination degradation of the eukaryotic cell tumor suppressor transcription factor ATOH8.

6. The use according to claim 5, characterized in that: The amino acid sequence of UBR5 is shown in SEQ ID NO:

2.

7. The use according to any one of claims 4 to 6, characterized in that: The UBR5 inhibitors include siRNA, dsRNA, miRNA, shRNA targeting the UBR5 gene, a gene editing system targeting the UBR5 gene, and / or antibodies, antigen-binding fragments or other small molecule drugs targeting the UBR5 protein.

8. A shRNA for a key ubiquitin ligase UBR5, characterized in that The targeting sequence of the shRNA is shown in SEQ ID NO:

3.

9. A plasmid, characterized in that The plasmid expresses the shRNA according to claim 8, and preferably, the backbone vector of the plasmid is a plko.1 vector.

10. Use of the shRNA according to claim 8 or the plasmid according to claim 9 in the preparation of a drug for treating prostate cancer or an agent for inhibiting ubiquitination and degradation of eukaryotic cell tumor suppressor transcription factor ATOH8.

Images