Application of StSDD1 and amiR-SDD1 to regulation and control of leaf stomatal density and improvement of drought resistance of potatoes

Abstract

The invention provides the application of the StSDD1 gene in enhancing the drought tolerance of the potatoes by regulating and controlling the stomatal development of the potatoes, reducing the stomatal density and enhancing the oxidation resistance of the potatoes. The stomatal density and drought resistance of a transgenic plant are analyzed, the molecular mechanism that the StSDD1 gene regulates the potato to respond to drought stress by regulating the stomatal density is analyzed, and a candidate gene is provided for purposefully utilizing the gene to carry out potato molecular breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of plant bioengineering, and particularly relates to application of StSDD1 and amiR-SDD1 in changing the stomatal density of potato leaves. Background Art

[0002] During the growth and development of higher plants, special cell structures, stomata, appear on their surfaces. As microchannels for communication between leaves and the atmosphere, stomata rely on changes in the gaps between guard cells (GC) to precisely regulate gas and water circulation. The stomatal complex is a specialized structure on the epidermis of higher plants that can finely regulate plant transpiration, photosynthesis and respiration. Stomata also control leaf temperature and prevent pathogen invasion by regulating the transpiration rate. According to records, stomata appeared about 400 million years ago, allowing plants to grow and survive normally on land. Plants can balance water loss by adjusting stomatal density and stomatal opening. In the long river of evolution, various plants began to appear and formed different stomata. The most typical example is the dicotyledonous plant Arabidopsis, whose stomatal distribution is randomly arranged and consists of a pair of kidney-shaped guard cells; while the stomatal distribution in the monocotyledonous plant rice is highly ordered, generally consisting of a pair of dumbbell-shaped guard cells and a pair of accessory cells on both sides. In order to improve the ion exchange rate with neighboring cells, stomata form their unique stomatal spatial distribution pattern. The stomatal development process in plants is regulated by multiple genes, including transcription factors, enzymes and multiple functional genes, and is affected by environmental conditions. In nature, the opening and closing of stomata cannot adapt to the constantly changing environment, which requires adjusting the epidermal stomatal density by changing the stomatal development pattern. Therefore, regulating plant drought resistance by adjusting stomatal density has become one of the ideal solutions for studying plant resistance.

[0003] The SDD1 gene was first discovered in Arabidopsis and is a key component of stomatal development. SDD1 belongs to the subtilisin family, which consists of 63 members in rice, 15 members in tomato, and 56 members in Arabidopsis. It is the only gene among its members that can cause phenotypic changes. SDD1 has three major functions: first, it can disrupt the number of protodermal cells before reaching the stomatal formation path; second, it can ensure that the MMC undergoes three non-equivalent divisions before forming stomata; third, it can ensure that the stomata formed by neighboring cells (NC) are arranged in place and prevent the connection between satellite cells (SC) and MMC. Previous studies have shown that the loss of the SDD1 gene leads to a 2-4-fold increase in the stomatal density of Arabidopsis, whereas overexpression of SDD1 in the wild type reduces the stomatal density by 2-4 times; SDD1 isolated from the traditional Chinese herbal medicine Isatis indigotica (IiSDD1) has a high homology with AtSDD1. During the development of tetraploid Isatis indigotica, the expression of IiSDD1 was downregulated after ABA, GA, salt stress, darkness, cold or drought treatment, resulting in an increase in the number of plant stomata. At the same time, we also found that the number of stomata in transgenic plants overexpressing ZmSDD1 was reduced by about 30%, and the survival rate of maize overexpressing ZmSDD1 after rehydration after drought stress was significantly improved compared with the wild type. However, experimental cases supporting these molecular regulatory mechanisms are still unclear in potato.

[0004] Potato is an important food crop with weak stress resistance and high requirements for water and environment. Drought stress is one of the main factors affecting potato yield and quality. SDD1 is a negative regulator of stomatal development, which can negatively regulate stomatal density. Loss of SDD1 function will lead to increased leaf density in plants. Due to its obvious regulatory effect on stomatal density, it has been considered as a potential gene for improving plant WUE and plays an important role in improving plant drought tolerance. At present, SDD1 regulation of plant drought tolerance has been analyzed in Arabidopsis, tomato, corn, woad and other plants, but no detailed reports have been seen in potatoes. In this study, the potato variety "Atlantic" was used as the experimental material, and the potato StSDD1 gene was cloned. Through bioinformatics analysis, subcellular localization analysis and genetic transformation, the stomatal density and drought resistance of transgenic plants were analyzed, and the molecular mechanism of StSDD1 gene regulating potato response to drought stress by regulating stomatal density was analyzed, providing candidate genes for the purposeful use of this gene for potato molecular breeding. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention provides the use of StSDD1 (Soltu.DM.09G018920.1|CDS) and amiR-SDD1 to change the stomatal density of potato leaves. In order to achieve the above purpose, the present invention adopts the following technical solutions:

[0006] 1. Potato StSDD1 gene, the potato StSDD1 gene transcript is shown in the sequence listing SEQ No.1.

[0007] 2. A method for verifying the function of potato StSDD1, the method specifically comprising: (1) cloning of potato StSDD1 gene, (2) tissue difference analysis of potato StSDD1 gene, (3) subcellular localization analysis of potato StSDD1 gene, (4) construction of potato StSDD1 gene inhibition expression vector, (5) genetic transformation of potato, (6) determination of stomatal density of transgenic plants, (7) determination of drought resistance-related indicators of transgenic plants. The construction of potato StSDD1 gene inhibition expression vector is achieved by using amiR-SDD1; the sequence of amiR-SDD1 is shown in SEQ No. 2 in the sequence table.

[0008] 3. Application of overexpressing StSDD1 gene to reduce stomatal density in potato, wherein the transcript of StSDD1 gene is shown in the sequence list SEQ No. 1.

[0009] 4. Application of overexpressing StSDD1 gene to induce increased expression of TMM, MAPK3 and MAPK6 genes, wherein the StSDD1 gene transcript is shown in the sequence table SEQ No. 1.

[0010] 5. Application of overexpressing StSDD1 gene to enhance drought resistance of potato, wherein the transcript of StSDD1 gene is shown in the sequence table SEQ No. 1; the enhanced drought resistance of potato is achieved by reducing the water loss rate of detached leaves and increasing the relative water content of leaves.

[0011] 6. Overexpression of the StSDD1 gene improves photosynthetic rate and water use efficiency under water-cut-off conditions. The StSDD1 gene transcript is shown in the sequence table SEQ No. 1.

[0012] 7. Application of overexpressing StSDD1 gene to enhance antioxidant capacity of potato under water-cut-off treatment conditions, wherein the transcript of StSDD1 gene is shown in the sequence table SEQ No. 1; the enhanced antioxidant capacity is achieved by enhancing the activities of SOD, POD and PRO and reducing the accumulation of MDA.

[0013] Beneficial effects: The present invention first discovered that the StSDD1 gene enhances potato drought resistance by regulating potato stomatal development, reducing stomatal density, and enhancing potato antioxidant capacity. The molecular mechanism of StSDD1 regulating potato response to drought stress by regulating stomatal density was analyzed, providing candidate genes for purposeful molecular breeding of potato drought resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Cloning of potato StSDD1 gene

[0015] Figure 2 Expression analysis of StSDD1 in different tissues of potato

[0016] Figure 3 Subcellular localization analysis of StSDD1 gene

[0017] Figure 4 Construction of potato StSDD1 gene silencing expression vector pCAMBIA1300-amiR-StSDD1

[0018] Figure 5 The process of obtaining transgenic plants for genetic transformation of potato

[0019] Figure 6 The stomatal density and expression of stomatal development genes in the leaves of transgenic plants.

[0020] Figure 7 Drought resistance analysis of transgenic plants under normal conditions and after 10 days of drought treatment.

[0021] Figure 8 The stomatal density and expression of stomatal development genes in the leaves of transgenic plants.

[0022] Fig. 9 The complementary position of StSDD1 gene sequence and amiR-SDD1. Specific implementation methods

[0024] The methods and devices used in the following embodiments of the present invention are conventional methods and devices unless otherwise specified; the equipment and reagents used are conventional equipment and reagents purchased by the reagent company. In order to make the purpose, technical scheme and advantages of the present invention clearer, the specific implementation methods of the present invention are described in detail in conjunction with specific embodiments. Examples of these preferred implementations are illustrated in the specific embodiments. It should also be noted that in order to avoid obscuring the technical scheme of the present invention due to unnecessary details, only the technical schemes and / or processing steps closely related to the scheme of the present invention are shown in the embodiments, and other details that are not very relevant are omitted.

[0025] Example 1

[0026] This embodiment provides potato StSDD1 and amiR-SDD1, specifically including: the StSDD1 gene transcript is shown in the sequence list SEQ No. 1; the amiR-SDD1 sequence is shown in the sequence list SEQ No. 2 (TAATAGAGTTAGGGTTCGCCA). The complementary positions of amiR-SDD1 and StSDD1 are shown in Fig. 9 shown.

[0027] Example 2

[0028] This embodiment provides a method for verifying the functions of potato StSDD1 and amiR-SDD1, which specifically includes:

[0029] 1. Cloning of potato StSDD1 gene

[0030] Total RNA from potato leaves was extracted using Beijing Jinsha TRNzol Universal total RNA extraction reagent, and cDNA was obtained by reverse transcription by adding reagents according to the instructions of the Sewell reverse transcription kit. The AtSDD1 protein sequence (At1g04110.1) was retrieved in the Arabidopsis database TAIR, and the StSDD1 protein sequence (ID: Soltu.DM.09G018920.1) was obtained by homologous Blastp alignment in the potato database Spud DB. The CDS region of the StSDD1 gene was cloned using the leaf cDNA of the potato variety "Atlantic" as a template. Specific primers were designed using the Takara online tool, and primer synthesis and sequencing were completed by Sangon Biotech (Shanghai). The primer sequences are shown in Table 1 below.

[0031] The sample was added under low temperature conditions, the reaction system was as shown in Table 2, the reaction conditions were as shown in Table 3, the obtained product was placed on ice, and then the PCR product was subjected to 1% agarose gel electrophoresis to detect the size. The expected band size should be about 2313 bp. The PCR product with the appropriate band was cut off with a disposable sterile gel cutter and recovered in a centrifuge tube. Then, the target fragment was extracted according to the instructions of the Tiangen Agarose Gel DNA Purification Kit, and sequenced and analyzed. Finally, the 2313 bp StSDD1 ( Figure 1 ).

[0032] Table 1 Primer sequences for cloning potato StSDD1 gene

[0033]

[0034] Table 2 PCR reaction system

[0035]

[0036] Table 3 PCR reaction conditions

[0037]

[0038] 2. Analysis of tissue differences of potato StSDD1 gene

[0039] The potato variety "Atlantic" was collected from roots, stems, top unexpanded leaves, the first expanded leaf at the top, the fourth expanded leaf at the top, the last leaf at the top, and tubers. Each group of sampling was repeated three times. According to the instructions of the Beijing Jinsha TRNzol Universal Total RNA Extraction Kit, potato RNA was isolated from each tissue. According to the instructions of the Wuhan Seville Reverse Transcription Kit, the PCR program was set up for reverse transcription into cDNA. The specific primers for potato StSDD1 gene qRT-PCR were designed using the Primer3plus online website (Table 4).

[0040] Table 4 qRT-PCR specific primers

[0041]

[0042] The sample setting program was added according to the instructions of the Wuhan Sewell Company fluorescence quantitative kit. The potato StEF1α gene (GenBank No. AB061263.1) was used as the internal reference gene, and 2 -ΔΔCt The method uses the expression of StSDD1 gene in potato roots as a benchmark to calculate the expression of StSDD1 gene in different tissues of potato. According to the results of qRT-PCR, StSDD1 gene is expressed in the roots, tubers, stems and leaves of potato, but it is most expressed in young leaves and least expressed in old leaves. The expression of the first leaf from the top is about 50-70 times that of the last leaf from the top ( Figure 2 ).

[0043] 3. Subcellular localization analysis of potato StSDD1 gene

[0044] Based on the information of pCAMBIA1300-35S-EGFP vector and StSDD1 gene, TaKaRa online primer design platform was used to design specific primers to amplify the CDS sequence of StSDD1 gene without stop codon (Table 5).

[0045] Table 5 Amplification primer sequences of potato StSDD1 gene subcellular localization vector

[0046]

[0047] The sample was loaded on ice, and the expected band size was 2313 bp. After electrophoresis detection, it was cut into gel particles, placed in a centrifuge tube, and purified and collected according to the instructions of the Tiangen Agarose Gel DNA Recovery Kit.

[0048] Take out the pCAMBIA1300-35S-EGFP empty vector bacterial solution stored at -80°C and gradually thaw it on ice. Subsequently, draw 1mL of bacterial solution into 50mL LB medium rich in kanamycin under sterile conditions, place it in a shaker at 37°C and 260rpm for incubation for 12h, use the plasmid extraction kit provided by Tiangen Biochemical Technology Co., Ltd. to extract the pCAMBIA1300-35S-EGFP empty vector plasmid from the suspended culture bacterial solution according to the instructions, and double-digest the extracted empty vector plasmid with Kpn I and Sal I restriction endonucleases to produce sticky ends for connection with the target gene fragment. After adding the system, mix it, centrifuge it at low speed for 1min, digest it at 37°C on a PCR instrument for 45min, and use 1% agarose gel electrophoresis to determine the target fragment, and then use a common DNA recovery kit to collect the target fragment.

[0049] The StSDD1 gene DNA purified fragment obtained by gel recovery and the linearized pCAMBIA1300-35S-EGFP empty vector were connected by homologous recombination. The method was referred to the instructions of the Norwegian homologous recombination kit. The reaction system was 10 μL, see Table 6:

[0050] Table 6 Homologous recombination reaction system

[0051]

[0052] Freshly prepared E. coli DH5α competent cells. Take out from the ultra-low temperature refrigerator, thaw in an ice bath and mix well, use a pipette to draw 10μL of homologous recombination products and add them to 100μL competent cells, tap the test tube wall to mix well, let stand in an ice bath for 30min, heat in a 42℃ water bath for 45s, and cool in an ice bath for 2-3min; add 800μL of sterile liquid LB culture medium, shake at 37℃, 260r / min constant temperature for 1-2h, take out and centrifuge at 6000rpm for 4min, discard 800μL of supernatant, and resuspend the bacterial solution; use a sterile smear stick to evenly apply the bacterial solution clockwise on an LB solid culture plate containing Kan (50μg / mL), and incubate inverted at 37℃ for 12-16h.

[0053] Pick a single white colony with smooth and neat edges and place it in 50mL of liquid LB medium containing Kan (50μg / mL) and culture it at 37℃, 260r / min for 7-8h. Take 2μL of bacterial solution for bacterial solution PCR verification. The reaction product is detected by 1% agarose gel electrophoresis. The bacterial solution with appropriate bands is extracted according to the instructions of Tiangen Plasmid Extraction Kit. The extracted plasmid is double-digested with restriction endonucleases KpnⅠ and SalⅠ. The plasmids with appropriate bands detected by agarose gel electrophoresis and double-digestion were sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing, and the recombinant plasmid suitable for sequencing was named EGFP-StSDD1.

[0054] The above sequenced recombinant plasmid EGFP-StSDD1 was transformed into Agrobacterium GV3101 competent cells (the competent cell preparation method is shown in Appendix 7). The specific transformation steps are as follows:

[0055] (1) Take a tube of Agrobacterium competent cells (100 μL) from the ultra-low temperature refrigerator, place it on an ice box and freeze and thaw it until it is in an ice-water mixed state;

[0056] (2) First, add 5 μL of the EGFP-StSDD1 recombinant plasmid to the Agrobacterium competent cells. To ensure sufficient contact between the plasmid and the cells, mix them by gently blowing or tapping the tube wall with a pipette, place them in an ice bath for 5 minutes, briefly treat them in liquid nitrogen for 5 minutes, incubate them in a 28°C water bath for 5 minutes, and finally stabilize them in an ice bath for 5 minutes to improve the transformation efficiency.

[0057] (3) Add 700 μL of LB liquid medium without antibiotics to the bacterial solution and culture in a constant temperature shaker at 28°C and 220 rpm for 2-3 h.

[0058] (4) After the culture is completed, the bacterial solution is centrifuged at 6000 rpm for 7 minutes to precipitate the cells. The supernatant is discarded, and about 100 μL of the bacterial solution is retained and gently pipetted to resuspend the cells.

[0059] (5) Use a sterile spreading rod to evenly spread the bacterial solution on LB solid medium supplemented with kanamycin (50 μg / mL) and rifampicin (20 μg / mL), and incubate the culture inverted in a constant temperature incubator at 28°C for 2-3 days.

[0060] (6) When white colonies grow on the culture medium, select single colonies with smooth edges and uniform size, transfer them to a 10 mL centrifuge tube containing 6 mL of LB liquid culture medium supplemented with Kan and Rif, and culture them overnight at 28°C and 220 rpm. The bacterial solution with a bright band at 2313 bp was identified as the target bacterial solution through PCR verification and then stored in a -80°C refrigerator for future use.

[0061] The EGFP-StSDD1 Agrobacterium liquid constructed in the previous stage was used as the infectant, and the pCAMBIA1300-35S-EGFP Agrobacterium liquid was used as the blank control to infect tobacco leaves. The specific steps are as follows:

[0062] (1) To infect tobacco leaves, first take out the Agrobacterium culture containing the EGFP-StSDD1 recombinant plasmid and the pCAMBIA1300-35S-EGFP empty vector from the -80°C refrigerator and thaw it on ice. Add 10uL of the culture to 5mL of LB medium containing kanamycin and rifampicin, and culture overnight at 28°C and 220rpm to promote the proliferation of the culture.

[0063] (2) Transfer 2 mL of bacterial solution to 25 mL of LB liquid medium supplemented with Kan, Rif, MES and ACE, and continue to culture at 28°C and 220 rpm for 4-6 h until the OD600 value of the bacterial solution reaches 0.5. Subsequently, the bacterial solution is centrifuged at 4°C and 4000 rpm for 15 min to precipitate the bacteria, discard the supernatant, and collect the bacteria for subsequent experiments.

[0064] (3) The bacteria were then resuspended in MS liquid medium containing MES, ACE, MgCl2 and 1% sucrose until OD600 = 0.5 and placed on ice for 2-3 h to allow subsequent infection of tobacco leaves.

[0065] (4) Select healthy tobacco plants about four weeks old, avoid leaf veins, and gently pierce holes on the back of the leaves with a sterile syringe needle. Use a 5mL disposable sterile syringe to slowly inject the bacterial solution containing the target gene and empty vector into the leaves, and observe the infection solution spreading around the holes. Use a marker to mark the diffusion area for subsequent observation. Place the injected Nicotiana benthamiana plants in an opaque cardboard box and culture at 25℃ for 1 day, then transfer to light culture and observe after 2 days.

[0066] Soak the coverslips and slides to be used in alcohol for sterilization in advance, and cut 5mm×5mm leaves with sharp scissors, taking care to avoid the veins. Use tweezers to lay the leaves flat on the slide, with the back facing up, drop a drop of 20% sterile glycerol on the leaves, press gently, blow off the liquid on the leaves, and then use a piece of absorbent paper to absorb excess water, then cover and flip. Using laser confocal technology, the distribution of EGFP green light signals in tobacco was detected at 488nm to clarify its protein localization in tobacco. Through tobacco leaves infected with Agrobacterium, the pCAMBIA1300-35S-EGFP empty vector was used as a blank control, and the EGFP-StSDD1 fusion protein was transiently expressed in tobacco leaf cells, and the expression was observed using a laser confocal scanning microscope. The results showed that the green fluorescence signal of the EGFP-StSDD1 recombinant fusion protein EGFP was mainly expressed on the cell membrane, indicating that the StSDD1 protein was mainly expressed on the membrane ( Figure 3 ).

[0067] 4. Construction of potato StSDD1 gene suppression expression vector

[0068] The online website WMD3 was used to design the amiRNA sequence (TAATAGAGTTAGGGTTCGCCA) that specifically inhibits the potato StSDD1 gene, and then the website Oligo was used to design the precursor primers. The primer sequences are shown in Table 7.

[0069] Table 7 Amplification primer sequences for constructing potato StSDD1 gene suppression expression vector

[0070]

[0071] Plasmid vector pRS300 was used as a template to amplify the precursor fragments a (5' arm), b (central loop), and c (3' arm). The sizes of a, b, and c were 272 bp, 171 bp, and 298 bp, respectively, according to electrophoresis. Figure 4 A), and then the mixed sample of fragments a, b, and c was used as a template to perform PCR reaction using universal primers A and B to amplify the 701 bp fragment d ( Figure 4 B), the reaction system for PCR amplification of fragments a, b, c and d is shown in Table 8.

[0072] Table 8 PCR system of amiRNA precursor fragments

[0073]

[0074] According to the instructions, the d fragment was connected to the cloning vector pMD18-T. The reaction system is shown in Table 9. The PCR instrument reaction conditions were set to 16°C for 30 minutes, and then immediately placed on ice. A newly prepared E. coli DH5α competent cell (method reference Appendix 7) was taken out of the ultra-low temperature refrigerator and quickly placed on ice to thaw until it was mixed with ice and water. Pipette 10μL of the above recombinant vector into the competent cells, flick the tube wall by hand to mix, then ice bath for 30 minutes, heat shock at 42°C for 45 seconds, and ice bath for 1-3 minutes. Add 900μL (without antibiotics) liquid LB culture medium, and then shake the bacteria in a constant temperature shaker at 37°C and 250r / min for 1-1.5h. Then centrifuge at 5000 rpm for 5 min, discard 900 μL of supernatant, resuspend the bacterial solution, and use a sterile spreading stick to gently spread the bacterial solution on an LB solid culture medium plate containing Amp (50 μg / mL), IPTG (2 mg / mL) and X-gal (200 μg / mL) under light-proof conditions. Incubate the plate upside down in a light-proof incubator at 37°C for 12 h.

[0075] Table 9 pMD18-T ligation system

[0076]

[0077]

[0078] Pick a white positive single colony with smooth and round edges and place it in 30mL of liquid LB medium containing Amp (50μg / mL), place it in a constant temperature shaker at 37℃, 260r / min for 5-7h, take 2μL of bacterial solution for bacterial solution PCR verification, detect the reaction product by gel electrophoresis, and extract the plasmid from the bacterial solution that meets the expected target. Use restriction endonucleases KpnⅠ and XbaⅠ to verify the extracted plasmid. The reaction system is shown in Table 10 below. Digest at 37℃ for 45min, and send the plasmid with suitable bands detected by agarose gel electrophoresis to Sangon Biotechnology Co., Ltd. for sequencing. The recombinant vector suitable for sequencing is named pMD18-amiR-StSDD1.

[0079] Table 10 Enzyme digestion reaction system

[0080]

[0081] The pCAMBIA1300-35S-EGFP empty plasmid and pMD18-amiR-StSDD1 vector were digested with restriction endonucleases KpnⅠ and XbaⅠ; the reaction products were detected by 1% agarose gel electrophoresis, and the linearized vector large fragment and the target precursor small fragment with sticky ends were recovered. Then, the precursor small fragment and the linearized vector large fragment were connected using T4 DNA ligase. The reaction system is shown in Table 11. After adding the sample on ice, centrifuge briefly to mix, place in a PCR instrument at 16℃ for 3.5h, and then transform the recombinant product into Escherichia coli DH5α competent cells and expand the culture. 2μL of bacterial solution was taken as a template for bacterial solution PCR, and then the plasmid was extracted and identified by double restriction endonuclease KpnⅠ and XbaⅠ. The double restriction reaction was carried out at 37℃ for 45min. The bacterial solution with suitable bands was sent for sequencing, and the plasmid suitable for sequencing was named pCAMBIA1300-amiR-StSDD1.

[0082] Table 11pCAMBIA1300-amiR-StSDD1 ligation system

[0083]

[0084]

[0085] 5. Genetic transformation of potato

[0086] The recombinant plasmid pCAMBIA1300-amiR-StSDD1 was transferred into GV3101. Transgenic research was conducted using potato test tube chips through Agrobacterium-mediated method. The specific operation process is as follows:

[0087] (1) Take 500 μL of Agrobacterium bacterial suspension containing pCAMBIA1300-StSDD1 and pCAMBIA1300-amiR-StSDD1, add them into LB liquid medium containing Rif (20 μg / mL) and Kan (50 μg / mL), respectively, and activate the culture at 28°C and 230 r / min overnight;

[0088] (2) Take 1-2 mL of the activated bacterial solution and add it to 50 mL of liquid LB medium containing Rif and Kan. Incubate at 28°C and 230 rpm until OD reaches 0. 600 = about 0.5;

[0089] (3) Transfer the culture medium to a 50 mL centrifuge tube, centrifuge at 4°C and 5000 rpm for 7 min, and discard the supernatant; resuspend the culture medium in an equal volume of MS medium containing 1% sucrose, and transfer the culture medium to a new conical flask for later use;

[0090] (5) In a clean bench, use a sterile sharp blade to remove the skin and eyes of the mini-tuber, and then cut into slices with a thickness of 1-2 mm (for easy infection). Place the slices of the mini-tuber in a conical flask containing the infection solution and infect for 7-10 minutes, shaking the conical flask slowly during the infection.

[0091] (6) After infection, use sterile paper to absorb all the remaining bacterial solution on the potato slices, and then transfer them to MS culture medium containing 3% sucrose and co-culture at 28°C in the dark for 2 days;

[0092] (7) After 2 days, the infected mini potato slices were transferred from the co-culture medium to 3% MS differentiation medium. During the transfer process, the microorganisms on the surface of the potato slices were wiped clean with sterile filter paper. Then, the slices were further cultured in an incubator at 25°C, 2500 Lx light, 16 h light / 8 h dark. The differentiation medium was changed every 6-8 days.

[0093] (10) When the shoots differentiated from potato chip callus grow to 1-2 cm, they are cut and transferred to rooting medium containing Hyg (50 mg / L) and Cef (100 mg / L) for two rooting screenings. The lines that can normally root twice in about 7-8 days can be preliminarily determined as transgenic plants, which are then preserved and propagated.

[0094] Specific primers were designed according to the selection marker gene on the plant expression vector pCAMBIA1300-35S-EGFP. The primer sequences are shown in Table 12. The DNA of the transgenic plants and wild-type plants that were able to root normally after two screenings was extracted using the CTAB method. The wild-type plants were used as negative controls, and the pCAMBIA1300-35S-EGFP empty vector was used as a positive control. The specific primers HYG-F and HYG-R were used to amplify the 589 bp long hygromycin B phosphotransferase (HYG) gene fragment. The reaction system is shown in Table 12. The obtained PCR products were detected by 1% agarose gel electrophoresis. The plants that successfully amplified the target bands were initially regarded as transgenic plants and named OE-n and KD-n ( Figure 5 ).

[0095] Total RNA from transgenic plants and wild-type plants was extracted and reverse transcribed into cDNA. Using wild-type plants as controls, qRT-PCR was used to detect the relative expression of the StSDD1 gene in transgenic potato plants, and the potato plants were further identified. The successfully identified transgenic plants with overexpression and suppressed expression of StSDD1 were preserved and propagated for subsequent experiments.

[0096] Table 12 Amplification primer sequences of marker genes

[0097]

[0098] 6. Determination of Stomatal Density of Transgenic Plants

[0099] The second or third leaf from the top of the 28-day-old test tube seedlings from the wild-type plants and transgenic plants was collected, marked with a marker (1 mm × 1 mm) on the side to be observed, cut with a sharp blade, and immediately fixed with fixative (Servicebio) at room temperature for 2 h, and then stored at 4 ° C. After that, the cut leaf pieces were washed with 0.1 MPB (pH 7.4) 3 times for 15 min each time, and then transferred to 1% OsO4 and washed in 0.1 MPB (pH 7.4) at room temperature for 1-2 h, and the tissue blocks were washed in 0.1 MPB (pH 7.4) 3 times for 15 min each time. The tissue blocks were then dehydrated with different concentrations of ethanol. Subsequently, the specimens were attached to metal short columns using carbon stickers and sputter-coated with gold for 30 s. Finally, the stomatal density was observed and photographed using a scanning electron microscope (HITACHI, SU8100). Stomatal density was observed according to the method of Yang et al. There were 3 biological replicates for each process. The results showed that compared with the wild type, the stomatal density of the overexpression plants was significantly reduced, while the stomatal density of the expression-inhibited plants was significantly increased ( Figure 6 A) According to statistics, compared with the stomatal density of wild-type potato leaves, the stomatal density of overexpressed potato leaves decreased by about 25%, while the stomatal density of potato leaves with suppressed StSDD1 gene expression increased by about 28% ( Figure 6 B). In the overexpression plants, the expression of TMM gene related to stomatal development signaling pathway increased by 6.3 times compared with the wild type, and the expression of MAPK3 and MAPK6 genes increased by 4.2 times and 3.5 times compared with the wild type, respectively. However, in the suppression expression plants, the expression of TMM gene decreased by 0.15 times, while the expression of MAPK3 and MAPK6 genes decreased by 0.36 times and 0.22 times, respectively ( Figure 6 C, D, E).

[0100] 7. Determination of drought resistance related indicators of transgenic plants

[0101] The wild-type plants and transgenic plants of potato variety "Atlantic" were inoculated in MS solid medium with 3% sucrose content and cultured for 28 days in an incubator at (23±1)℃, 2500Lx, 16h light / 8h dark cycle. After one week of hardening, the seedlings were transplanted into 10cm×10cm pots with a nutrient soil and vermiculite ratio of 3:1 and placed in the greenhouse of Gansu Agricultural University. They were cultured for 35±5 days at 24℃ and 16h light / 8h dark cycle. After the growth condition stabilized, healthy plants with consistent growth status were selected, watering was stopped, and drought stress treatment was carried out. The results showed that there was no significant difference in the growth status of OE-n strains, KD-n strains and WT plants before drought treatment. However, after drought stress treatment, the growth condition of OE-n strains was significantly better than that of WT and KD-n strains, while the leaves of KD-n strains were obviously wilted ( Figure 7 A). Water loss rate and RWC can reflect drought resistance to a certain extent. The water loss rate of detached leaves was measured and it was found that compared with WT, the water loss rate of detached potato leaves of overexpression plants was significantly reduced, while compared with WT, the water loss rate of detached potato leaves of inhibition expression plants was slightly increased ( Figure 7 B), indicating that the StSDD1 transgenic plants reduced the water loss rate of leaves due to the reduction of stomatal density. Before drought stress, the leaf RWC of WT, OE and KD plants were 84%, 85.4% and 84.6%, respectively, with no significant difference; but after drought treatment, the RWC of OE plants was higher than that of WT plants, and the RWC of KD plants was lower than that of WT plants ( Figure 7 C) These results indicate that StSDD1 leaf transfection can increase the relative water content of leaves, thereby improving the drought tolerance of plants.

[0102] (1) Photosynthesis, transpiration, and stomatal conductance were measured using a portable photosynthesis system CI-340 (CID Bio-Science, FLORIDA, USA) according to the manufacturer's instructions. The second fully expanded leaf from the top was selected for measurement. The measurements were performed at 11:00 a.m. on two consecutive sunny days with suitable light and temperature. The carbon dioxide concentration was controlled at 360 μmol·mol by a buffer bottle. -1 -400μmol·mol -1 Water use efficiency is defined as the ratio of photosynthesis rate to transpiration rate. The results show that there is no significant difference in photosynthesis rate between transgenic plants and wild-type plants under normal conditions ( Figure 8 A).

[0103] (2) In the control group and drought treatment group, the 3rd to 4th whole leaves of each group of plants (three biological replicates) were collected and their fresh weight (FW) was quickly measured. Then the leaves were immersed in UP water and weighed as saturated fresh weight (SW) after standing for 6-8 hours. The leaves were then placed in a 70℃ oven and dried for 48 hours until constant, and then weighed as dry weight (DW). Leaf relative water content (RWC) = ([FW]-DW) / (TW-DW)×100. The results show that there is no significant difference in water use efficiency between transgenic plants and wild-type plants under normal conditions ( Figure 8 B).

[0104] (3) Water loss rate experiment: Leaves (about 1.0 g) of 4-week-old plants were picked from transgenic potato plants and wild-type potato plants and placed on dry filter paper. The leaf water content was measured every hour within 6 hours to determine the water loss rate, and 3 biological replicates were performed. The results showed that the stomatal conductance and transpiration rate of the overexpression potato plants were significantly lower than those of the wild-type plants. Under water-cut-off conditions, the photosynthetic rate (Pn), transpiration rate (Tr) and stomatal conductance (Gs) of the transgenic strains were reduced, while the photosynthetic rate (Pn) and water use efficiency (WUE) of the overexpression plants were significantly increased ( Figure 8 C,D).

[0105] (4) The control group and drought treatment group were measured and calculated according to the instructions of the MDA (malondialdehyde), SOD (superoxide dismutase), POD (peroxidase) and Pro (proline) content detection kit (Suzhou Jieruisi Biotechnology Co., Ltd.), and the 3rd to 5th leaves from the top were selected for detection, and each test was repeated 3 times. The results showed that SOD ( Figure 8 E) and POD( Figure 8 F) activity, MDA ( Figure 8 G) and Pro( Figure 8 There was no significant difference in the content of H) between transgenic plants and wild-type plants before water-cut treatment. However, after water-cut treatment, the SOD, POD activities and MDA and Pro contents of transgenic plants and wild-type plants increased, but the SOD, POD activities and PRO of plants overexpressing StSDD1 increased more, exceeding those of wild-type plants, but the MDA content was significantly lower than that of wild-type plants. The results of plants inhibiting expression were the opposite. These results all indicate that overexpression of StSDD1 can significantly improve plant drought tolerance.

[0106] The above is only a specific implementation of the present application. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present application. These improvements and modifications should also be regarded as the scope of protection of the present application.

Claims

1. Potato StSDD1 gene, characterized in that The potato StSDD1 gene transcript is shown in the sequence listing as SEQ No.

1.

2. Potato StSDD1 functional verification method, characterized in that The method specifically includes: (1) cloning of potato StSDD1 gene, (2) tissue difference analysis of potato StSDD1 gene, (3) subcellular localization analysis of potato StSDD1 gene, (4) construction of potato StSDD1 gene inhibition expression vector, (5) genetic transformation of potato, (6) determination of stomatal density of transgenic plants, and (7) determination of drought resistance-related indicators of transgenic plants.

3. The method for verifying the function of potato StSDD1 according to claim 2, characterized in that The potato StSDD1 gene inhibition expression vector is constructed by using amiR-SDD1; the amiR-SDD1 sequence is shown in SEQ No. 2 in the sequence table.

4. Application of overexpressing StSDD1 gene to reduce stomatal density in potato, characterized in that The StSDD1 gene transcript is shown in the sequence table SEQ No.

1.

5. Application of overexpressing StSDD1 gene to induce increased expression of TMM, MAPK3 and MAPK6 genes, characterized in that The StSDD1 gene transcript is shown in the sequence table SEQ No.

1.

6. Application of overexpressing StSDD1 gene to enhance drought resistance of potato, characterized in that The StSDD1 gene transcript is shown in the sequence list SEQ No. 1; the enhancement of potato drought resistance is achieved by reducing the water loss rate of detached leaves and increasing the relative water content of leaves.

7. Overexpression of the StSDD1 gene improves photosynthetic rate and water use efficiency under water-cut conditions, characterized in that The StSDD1 gene transcript is shown in the sequence table SEQ No.

1.

8. Application of overexpressing StSDD1 gene to enhance antioxidant capacity of potato under water shortage treatment conditions, characterized in that The StSDD1 gene transcript is shown in the sequence table SEQ No. 1; the enhanced antioxidant capacity is achieved by enhancing the activities of SOD, POD and PRO and reducing the accumulation of MDA.

Images