Schizochytrium limacinum engineering strain for producing EPA (Eicosapentaenoic Acid) by prolonging desaturation path, construction method and application

Abstract

The invention belongs to the technical field of biochemical engineering and the technical field of bioengineering, and discloses a schizochytrium limacinum engineering strain for producing EPA (eicosapentaenoic acid) by prolonging a desaturation path. Part or all of the extended desaturase genes from thraustochytrium sp. And fusarium sp. And saprolegnia are expressed. According to the invention, extended desaturase genes from various sources are integrated into a schizochytrium limacinum genome, so that a schizochytrium limacinum gene engineering strain efficiently expresses the extended desaturase genes, and a heterologous EPA synthesis path with high synthesis efficiency, short culture period, simple purification method and low cost is provided; a basis is provided for producing grease rich in EPA from schizochytrium limacinum, and the problems of non-sustainability, high cost and the like caused by obtaining EPA from fishes are solved.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemical engineering and bioengineering, and in particular to an engineering strain of Schizochytrium for producing EPA through an extended desaturation pathway, a construction method and an application thereof. Background Art

[0002] EPA is a long-chain ω-3 polyunsaturated fatty acid with important physiological functions. EPA contains twenty carbon atoms and five unsaturated double bonds, and its molecular formula is C 20 H 30 O 2 , with a relative molecular weight of 302.6. EPA, as a common dietary omega-3 polyunsaturated fatty acid (ω-3 PUFA) supplement, is not only considered to be used to maintain the normal function and development of the brain and retina, but also has multiple benefits for human health by reducing oxidative stress, inflammation, cancer, hyperlipidemia, neurodegenerative diseases and other diseases. Currently, EPA is mainly obtained from fish and algae, but it has problems such as unstable product quality, high price, damage to the marine environment and unsustainability.

[0003] Therefore, how to safely and stably obtain EPA-rich fish oil is an urgent problem to be solved. Microbial fermentation has the advantages of stable yield and reliable quality, which can break through the bottleneck of functional oil development and utilization. Among them, the selection of suitable chassis cells is the key to the industrial preparation of functional oils.

[0004] Schizochytrium sp. is a heterotrophic oil-producing fungus with the advantages of efficient fatty acid synthesis pathway, high oil content, easy cultivation, etc., and has passed the safety certification of the US FDA and the Ministry of Health of my country. Therefore, Schizochytrium sp. is a potential chassis cell for producing functional oils, but the EPA content naturally synthesized by Schizochytrium sp. is extremely low.

[0005] Currently, there are two metabolic pathways for producing polyunsaturated fatty acids, one is the traditional fatty acid elongation desaturation pathway (EL / DE), and the other is the polyketide synthase (PKS) pathway. Since the content of EPA synthesized by the PKS pathway in Schizochytrium is very low, it is more efficient to produce EPA in Schizochytrium through the fatty acid elongation desaturation pathway through genetic engineering methods.

[0006] The thraustochytrium fungus (Parietichytrium sp) contains all the genes for the fatty acid elongase (ELO) and desaturase (DES) required for the synthesis of EPA and DHA, and can naturally produce a large amount of EPA and DHA using this pathway as the main pathway. In addition, some fungi can also produce polyunsaturated fatty acids, and the elongation desaturase they contain has good activity, such as Fusarium musae and Saprolegnia diclina. Summary of the invention

[0007] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an engineered Schizochytrium strain for producing EPA through an extended desaturation pathway, a construction method and an application.

[0008] The technical solution adopted by the present invention to solve its technical problem is:

[0009] The invention discloses an engineered Schizochytrium strain which produces EPA through an elongated desaturation pathway. The engineered strain is obtained by taking Schizochytrium as a chassis strain and expressing part or all of the elongated desaturase genes from Thraustochytrium, Fusarium and Saprolegnia.

[0010] Furthermore, the Schizochytrium sp. is Schizochytrium sp. HX-308, and its deposit number is CCTCC No. M209059. The strain has been deposited in the China Center for Type Culture Collection (CCTCC) and has been published in the Chinese invention patent No. 201510417269.4;

[0011] Alternatively, the thraustochytrium is Parietichytrium sp, the fusarium is Fusarium musae, and the water mold is Saprolegnia diclina.

[0012] Furthermore, the elongation desaturase genes include carbon 16 elongase (C16EL), Δ9 desaturase (Δ9DE), Δ12 desaturase (Δ12DE), Δ6 desaturase (Δ6DE), C18 elongase (C18EL), Δ5 desaturase (Δ5DE), and Δ17 desaturase (Δ17DE).

[0013] Furthermore, among the elongated desaturases, the carbon-16 elongase (PaC16EL), Δ9 desaturase (PaΔ9DE), Δ6 desaturase (PaΔ6DE), C18 elongase (PaC18EL), and Δ5 desaturase (PaΔ5DE) are all from thraustochytrid, and the Δ12 desaturase and Δ17 desaturase are from multiple bacteria, among which the Δ12 desaturase includes two types from thraustochytrid (PaΔ12DE) and Fusarium (FmΔ12DE), respectively, and the Δ17 desaturase includes two types from thraustochytrid (PaΔ17DE) and Saprolegnia (SdΔ12DE), respectively.

[0014] Furthermore, the carbon-16 elongase is from a thraustochytrium, and its gene sequence is shown in SEQ ID NO.1; the Δ9 desaturase is from a thraustochytrium, and its gene sequence is shown in SEQ ID NO.2; the Δ12 desaturase is from a thraustochytrium, and its gene sequence is shown in SEQ ID NO.3; the Δ12 desaturase is from a fusarium, and its gene sequence is shown in SEQ ID NO.4; the Δ6 desaturase is from a thraustochytrium, and its gene sequence is shown in SEQ ID NO.5; the C18 elongase is from a thraustochytrium, and its gene sequence is shown in SEQ ID NO.6; the C18 elongase is from a thraustochytrium, and its gene sequence is shown in SEQ ID NO.7; the Δ5 desaturase is from a thraustochytrium, and its gene sequence is shown in SEQ ID NO.8; the Δ17 desaturase is from a thraustochytrium, and its gene sequence is shown in SEQ ID NO.9; the Δ17 desaturase is from a Saprolegnia, and its gene sequence is shown in SEQ ID NO.10.

[0015] The use of the engineered Schizochytrium strain as described above in the production of EPA.

[0016] The method for constructing the Schizochytrium engineering strain as described above comprises the following steps:

[0017] Construction of S1 recombinant plasmid pZPK-PaC16EL-F2A-PaΔ9DE-2520

[0018] The plasmid pZPK-NeoR-2520 was used as a backbone, and the C16EL and Δ9DE genes were inserted into the backbone, and F2A was used as a connecting peptide in the middle to obtain the recombinant plasmid pZPK-PaC16EL-F2A-PaΔ9DE-2520;

[0019] Construction of S2 recombinant plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520

[0020] The plasmid pZPK-NrsR-2520 was used as a backbone, and the PaΔ12DE / FmΔ12DE and PaΔ6DE genes were inserted into the backbone, and P2A was used as a connecting peptide in the middle to connect them, thereby obtaining the recombinant plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ5DE-2520;

[0021] Construction of S3 recombinant plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL

[0022] The plasmid pZPK-BleoR-2520 is used as a backbone, and the PaΔ5DE and PaΔ17DE / SdΔ17DE genes are inserted into the backbone, and P2A is used as a connecting peptide in the middle to connect them. At the same time, the PaC18EL gene is inserted between another promoter and terminator, and the recombinant plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL can be obtained;

[0023] Construction of an engineered Schizochytrium strain S4 expressing the gene for elongation supersaturase

[0024] The recombinant plasmid pZPK-PaC16EL-F2A-PaΔ9DE-2520 was introduced into Schizochytrium sp.HX-308 to obtain recombinant bacteria 1; the recombinant plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520 was introduced into recombinant bacteria 1 to obtain recombinant bacteria 2; the recombinant plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL was introduced into recombinant strain 2 to obtain the Schizochytrium expressing the extended desaturase gene.

[0025] Furthermore, during the strain construction, the promoter of each elongation desaturase gene expression cassette was P 2520 The promoter and terminator are T CYC1t terminator;

[0026] Alternatively, in step S4, the introduction is achieved by an electroporation transformation method.

[0027] The method for producing EPA by fermentation using the Schizochytrium engineered strain as described above comprises the following steps:

[0028] During the fermentation process of producing EPA by the engineered Schizochytrium strain, shaking culture is adopted, the temperature is 24-30°C, the fermentation time is 72-120h, the shaking speed is 150-200rpm, and the glucose concentration in the fermentation medium is 80-100g / L.

[0029] Further, the steps are as follows:

[0030] S1 activated Schizochytrium engineered strain

[0031] The engineered strain of Schizochytrium was inoculated into a seed culture medium, and cultured in a shaking incubator at 28°C and 180 r / min for 24 hours to obtain a first-level seed culture solution; the first-level seed culture solution was inoculated into a new seed culture medium at a ratio of 5%, and cultured in a shaking incubator at 28°C and 180 r / min for 24 hours to obtain a second-level seed culture solution; the second-level seed culture solution was inoculated into a new seed culture medium at a ratio of 5%, and cultured in a shaking incubator at 28°C and 180 r / min for 24 hours to obtain a third-level seed culture solution;

[0032] Fermentation culture of S2 recombinant bacteria 3

[0033] Each time 10 mL of the third-level seed culture solution was taken, it was inoculated into 90 mL of the fermentation medium, and cultured in a shaking incubator at 28°C and 180 r / min for 120 h to obtain the fermentation solution;

[0034] Analysis of S3 fermentation products

[0035] After the fermentation is finished, NaOH is added to the fermentation liquid to adjust the pH to 10-13, a wall-breaking enzyme with a final mass concentration of 0.01-0.2% (w / v) is added, and the mixture is shaken at 50° C. and 150 r / min for 10-15 hours; after the shaking is finished, the mixture is cooled to room temperature, anhydrous ethanol with a volume equal to that of the fermentation liquid is added to inactivate the enzyme and precipitate the protein; then n-hexane with a volume equal to that of the fermentation liquid is added for extraction, and the upper organic phase is collected; the extraction is repeated until the organic phase becomes colorless; the organic phase is volatilized by rotary evaporation to finally obtain the total oil;

[0036] Among them, the plate culture medium: pH value is 6.5, the ingredients include: agar 15g / L, glucose 60g / L, yeast extract powder 10g / L, sodium sulfate 10g / L, magnesium sulfate 4g / L, ammonium sulfate 8g / L, potassium chloride 2g / L, calcium chloride 0.1g / L, potassium sulfate 0.5g / L, potassium dihydrogen phosphate 2g / L, sodium glutamate 8g / L, zinc sulfate heptahydrate 4mg / L, cobalt dichloride hexahydrate 0.01mg / L, copper sulfate pentahydrate 2mg / L, nickel sulfate hexahydrate 2mg / L, ferrous sulfate heptahydrate 10mg / L, calcium pantothenate 4mg / L, manganese chloride tetrahydrate 5mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B6 6mg / L, vitamin B12 1.3mg / L, the solvent is water;

[0037] Seed culture medium: pH is 6.6. The ingredients include: glucose 50g / L, yeast extract powder 5g / L, sodium sulfate 5g / L, magnesium sulfate 2g / L, ammonium sulfate 6g / L, potassium chloride 1g / L, calcium chloride 0.1g / L, potassium sulfate 0.6g / L, potassium dihydrogen phosphate 1g / L, monosodium glutamate 10g / L, 0.1% trace minerals, vitamin B65mg / L and vitamin B12 0.5mg / L. The solvent is water.

[0038] Fermentation medium: pH to 7.0, ingredients include: glucose 80g / L, yeast extract 10g / L, sodium sulfate 10g / L, magnesium sulfate 2g / L, ammonium sulfate 6g / L, potassium chloride 1g / L, calcium chloride 0.1g / L, potassium sulfate 0.6g / L, potassium dihydrogen phosphate 1g / L, sodium glutamate 20g / L, zinc sulfate heptahydrate 3mg / L, cobalt dichloride hexahydrate 0.05mg / L, copper sulfate pentahydrate 4mg / L, nickel sulfate hexahydrate 1.5mg / L, ferrous sulfate heptahydrate 10mg / L, calcium pantothenate 3mg / L, manganese chloride tetrahydrate 4mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B6 5mg / L and vitamin B 12 0.5mg / L, the solvent is water.

[0039] The advantages and positive effects achieved by the present invention are:

[0040] 1. The present invention integrates elongation desaturase genes from multiple sources into the genome of Schizochytrium, so that the genetically engineered strain of Schizochytrium efficiently expresses the elongation desaturase gene, providing a heterologous EPA synthesis pathway with high synthesis efficiency, short culture cycle, simple purification method and low cost, providing a basis for Schizochytrium to produce EPA-rich oils, thereby solving the problems of unsustainability and high cost of obtaining EPA from fish.

[0041] 2. The present invention constructs three recombinant plasmids, pZPK-PaC16EL-F2A-PaΔ9DE-2520, pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520, and pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL, and introduces them into Schizochytrium HX-308, thereby significantly improving the EPA production of the Schizochytrium genetically engineered strain, and the strain has good stability.

[0042] 3. The present invention heterologously expresses multiple elongation desaturase genes in Schizochytrium species. Compared with the strain that does not express the elongation desaturase gene, the EPA content in the fermentation product of the modified Schizochytrium genetically engineered strain is increased by 10.30 times, and a large amount of DHA can also be produced.

[0043] 4. The present invention provides a genetically engineered strain of Schizochytrium that heterologously expresses an elongation desaturase gene, and a construction method and application thereof. Elongation desaturase genes from multiple sources are expressed in Schizochytrium HX-308, and an engineered strain with good stability, short culture cycle, high oil content, and high EPA yield is constructed, which significantly reduces the production cost of EPA and significantly improves the efficiency.

[0044] 5. The present invention is suitable for constructing a genetically engineered Schizochytrium strain expressing an extended desaturase gene. The constructed genetically engineered Schizochytrium strain can be used for fermentation production of EPA and DHA, and is simple to operate, and is suitable for industrial fermentation production of EPA and DHA. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is the skeleton diagram of the recombinant plasmid pZPK-PaC16EL-F2A-PaΔ9DE-2520 in Example 1 of the present invention;

[0046] Figure 2 The skeleton diagram of the recombinant plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520 in Example 2 of the present invention;

[0047] Figure 3 The skeleton diagram of the recombinant plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL in Example 3 of the present invention;

[0048] Figure 4 This is a comparison chart of the oil content of HX-308 and Schizochytrium engineered strain 3 in the present invention;

[0049] Figure 5 This is a comparison chart of the fatty acid composition of HX-308 and Schizochytrium engineered strain 3 in the present invention. DETAILED DESCRIPTION

[0050] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0051] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0052] An engineered strain of Schizochytrium that produces EPA via an extended desaturation pathway, wherein the engineered strain is obtained by heterologously expressing genes of the extended desaturation pathway in Schizochytrium HX-308;

[0053] Wherein, the elongation desaturase genes include carbon 16 elongase (C16EL), Δ9 desaturase (Δ9DE), Δ12 desaturase (Δ12DE), Δ6 desaturase (Δ6DE), C18 elongase (C18EL), Δ5 desaturase (Δ5DE), Δ17 desaturase (Δ17DE);

[0054] Among them, the carbon 16 elongase (PaC16EL), Δ9 desaturase (PaΔ9DE), Δ6 desaturase (PaΔ6DE), C18 elongase (PaC18EL), and Δ5 desaturase (PaΔ5DE) of the elongated desaturase are all from thraustochytrid, and the Δ12 desaturase and Δ17 desaturase are from multiple bacteria, wherein the Δ12 desaturase includes two types from thraustochytrid (PaΔ12DE) and Fusarium (FmΔ12DE), and wherein the Δ17 desaturase includes two types from thraustochytrid (PaΔ17DE) and Saprolegnia (SdΔ12DE);

[0055] Among them, the carbon 16 elongase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.1; the Δ9 desaturase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.2; the Δ12 desaturase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.3; the Δ12 desaturase is from Fusarium, and its gene sequence is shown in SEQ ID NO.4; the Δ6 desaturase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.5; the C18 elongase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.6; the C18 elongase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.7; the Δ5 desaturase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.8; the Δ17 desaturase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.9; the Δ17 desaturase is from Saprolegnia, and its gene sequence is shown in SEQ ID NO.10.

[0056] The method for constructing the Schizochytrium genetically engineered strain that efficiently produces EPA as described above comprises the following steps:

[0057] Construction of S1 recombinant plasmid pzpk-PaC16EL-F2A-PaΔ9DE-2520

[0058] The plasmid pzpk-NeoR was used as a backbone, and the C16EL and Δ9DE genes were inserted into the backbone, and F2A was used as a connecting peptide to connect them, and the recombinant plasmid pzpk-PaC16EL-F2A-PaΔ9DE-2520 (see Figure 1 );

[0059] Construction of S11 pzpk-NeoR

[0060] Using the NeoR gene fragment synthesized by the company as a template, primers were used to amplify the NeoR gene fragment containing the homology arms for connection. Using the plasmid pzpk as a template (mentioned in the patent with publication number CN 114480148 A), the pzpk skeleton was obtained after enzyme digestion. Primers were designed to amplify the promoter 2845 and terminator T2845 genes from the Schizochytrium genome. The skeleton after enzyme digestion was connected to the promoter 2845, NeoR gene, and terminator T2845 gene. The connection product was transformed into Escherichia coli DH5α competent cells, positive transformants were selected, plasmids were extracted, and sequencing was successful to obtain the overexpression vector pzpk-NeoR.

[0061] S12 pzpk-NeoR-2520 build

[0062] Primers were designed to amplify promoter 2520 from the Schizochytrium genome. Primers were designed to amplify terminator TCYC1t from the Yarrowia lipolytica genome. The pzpk-NeoR plasmid was digested with HindⅢ to obtain the skeleton. The digested skeleton was connected with promoter 2520 and terminator TCYC1t to obtain the recombinant expression vector pzpk-NeoR-2520. The ligation product was transformed into Escherichia coli DH5α competent cells, positive transformants were selected, plasmids were extracted, and sequencing was successful to obtain the overexpression vector pzpk-NeoR-2520.

[0063] S13 pzpk-PaC16EL-F2A-PaΔ9DE-2520 construction

[0064] Primers were designed to amplify the C16EL and Δ9DE gene fragments from the thraustochytrid genome, and the F2A peptide was connected to the two gene fragments while designing the primers. The pzpk-NeoR-2520 backbone was digested with BamHI, and the backbone after digestion was connected with PaC16EL-F2A-PaΔ9DE to obtain the recombinant expression vector pzpk-PaC16EL-F2A-PaΔ9DE-2520. The ligation product was transformed into Escherichia coli DH5α competent cells, positive transformants were selected, plasmids were extracted, and sequencing was successful to obtain the overexpression vector pzpk-PaC16EL-F2A-PaΔ9DE-2520.

[0065] S2 recombinant plasmid pzpk-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520 (see Figure 2 )

[0066] The plasmid pzpk-NrsR was used as a backbone, and the PaΔ12DE / FmΔ12DE and PaΔ6DE genes were inserted into the backbone, and P2A was used as a connecting peptide in the middle to connect them, and the recombinant plasmid pzpk-PaΔ12DE / FmΔ12DE-P2A-PaΔ5DE-2520 was obtained;

[0067] Construction of S21pzpk-NrsR

[0068] Using the NrsR gene fragment synthesized by the company as a template, primers were used to amplify the NrsR gene fragment containing the homologous arms for connection. Using the plasmid pzpk as a template, the pzpk skeleton was obtained after enzyme digestion. Primers were designed to amplify the promoter 2845 and terminator 2845 genes from the Schizochytrium genome. The skeleton after enzyme digestion was connected to the promoter 2845, the NrsR gene fragment, and the terminator T2845 gene. The connection product was transformed into Escherichia coli DH5α competent cells, positive transformants were selected, plasmids were extracted, and sequencing was successful to obtain the overexpression vector pzpk-NrsR.

[0069] Construction of S22 pzpk-NrsR-2520

[0070] Primers were designed to amplify promoter 2520 from the Schizochytrium genome. Primers were designed to amplify terminator TCYC1t from the Yarrowia lipolytica genome. The pzpk-NrsR plasmid was digested with HindⅢ to obtain the skeleton. The digested skeleton was connected with promoter 2520 and terminator TCYC1t to obtain the recombinant expression vector pzpk-NrsR-2520. The ligation product was transformed into Escherichia coli DH5α competent cells, positive transformants were selected, plasmids were extracted, and sequencing was successful to obtain the overexpression vector pzpk-NrsR-2520.

[0071] Construction of S23 pzpk-PaΔ12DE / FmΔ12DE-P2A-PaΔ5DE-2520

[0072] Primers were designed to amplify PaΔ12DE / FmΔ12DE and PaΔ6DE gene fragments from the thraustochytrid and saprolegnia genomes, and the F2A peptide was connected to the two gene fragments while designing primers. The pzpk-NrsR-2520 backbone was digested with BamHI, and the backbone after digestion was connected with PaΔ12DE / FmΔ12DE-P2A-PaΔ5DE to obtain the recombinant expression vector pzpk-PaΔ12DE / FmΔ12DE-P2A-PaΔ5DE-2520. The ligation product was transformed into Escherichia coli DH5α competent cells, positive transformants were selected, plasmids were extracted, and sequencing was successful to obtain the overexpression vector pzpk-PaΔ12DE / FmΔ12DE-P2A-PaΔ5DE-2520.

[0073] Construction of S3 recombinant plasmid pzpk-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL

[0074] The plasmid pzpk-BleoR was used as a backbone, and the PaΔ5DE and PaΔ17DE / SdΔ17DE genes were inserted into the pzpk backbone, connected with P2A as a connecting peptide in the middle, and the PaC18EL gene was inserted between another promoter and terminator to obtain the recombinant plasmid pzpk-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL (see Figure 3 );

[0075] Construction of S31 pzpk-BleoR

[0076] Using the synthesized BleoR gene fragment of the company as a template, primers were used to amplify the BleoR gene fragment containing the homology arms for connection. Using the plasmid pzpk as a template, the pzpk skeleton was obtained after enzyme digestion. Primers were designed to amplify the promoter 2845 and terminator 2845 genes from the Schizochytrium genome. The skeleton after enzyme digestion was connected to the promoter 2845, the BleoR gene fragment, and the terminator T2845 gene. The connection product was transformed into Escherichia coli DH5α competent cells, positive transformants were selected, plasmids were extracted, and sequencing was successful to obtain the overexpression vector pzpk-BleoR.

[0077] Build of S32 pzpk-bleoR-2520

[0078] Primers were designed to amplify promoter 2520 from the Schizochytrium genome. Primers were designed to amplify terminator TCYC1t from the Yarrowia lipolytica genome. The pzpk-BleoR plasmid was digested with HindⅢ to obtain the skeleton. The digested skeleton was connected with promoter 2520 and terminator TCYC1t to obtain the recombinant expression vector pzpk-BleoR-2520. The ligation product was transformed into Escherichia coli DH5α competent cells, positive transformants were selected, plasmids were extracted, and sequencing was successful to obtain the overexpression vector pzpk-BleoR-2520.

[0079] S33 pzpk-bleoR-2520-2520 build

[0080] The pzpk-BleoR-2520 plasmid was digested with AscI endonuclease to obtain the skeleton. The digested skeleton was connected with the promoter 2520 and the terminator TCYC1t to obtain the recombinant expression vector pzpk-BleoR-2520-2520. The ligation product was transformed into Escherichia coli DH5α competent cells, positive transformants were selected, plasmids were extracted, and sequencing was successful to obtain the overexpression vector pzpk-BleoR-2520-2520.

[0081] Construction of S34 pzpk-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL

[0082] Primers were designed to amplify PaΔ5DE, PaΔ17DE / SdΔ17DE, and PaC18EL gene fragments from the thraustochytrid and Fusarium fungal genomes, and the P2A peptide was connected to the PaΔ5DE and PaΔ17DE / SdΔ17DE gene fragments while designing primers. The pzpk-BleoR-2520-2520 backbone was digested with BamHI, and the backbone after digestion was connected to the PaC18EL gene fragment to obtain the recombinant expression vector pzpk-2520-PaC18EL.

[0083] pzpk-2520-PaC18EL was digested with PacI to obtain the backbone. The digested backbone PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE gene fragments were connected to obtain the recombinant expression vector pzpk-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL. The ligation product was transformed into Escherichia coli DH5α competent cells to select positive transformants, extract the plasmid, and sequence the verification to obtain the overexpression vector pzpk-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL.

[0084] Construction of an engineered Schizochytrium strain S4 expressing the gene for elongation supersaturase

[0085] The recombinant plasmid pzpk-PaC16EL-F2A-PaΔ9DE-2520 was introduced into Schizochytrium sp.HX-308 to obtain recombinant bacteria 1; the recombinant plasmid pzpk-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520 was introduced into recombinant bacteria 1 to obtain recombinant bacteria 2; the recombinant plasmid pzpk-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL was introduced into recombinant strain 2 to obtain the Schizochytrium expressing the extended desaturase gene.

[0086] S41 Preparation of Schizochytrium competent cells;

[0087] The introduction in S42 is achieved by an electroporation transformation method.

[0088] After S43 screening, the stable inherited strains were the Schizochytrium genetically engineered strains that recombinantly overexpressed the vectors pzpk-PaC16EL-F2A-PaΔ9DE-2520, pzpk-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520, and pzpk-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL genes.

[0089] S5 is a method for producing EPA by fermentation using the engineered Schizochytrium strain as described above, wherein the engineered Schizochytrium strain is cultured in a shaking table during the fermentation process of producing EPA, the temperature is 24-30° C., the fermentation time is 72-120 h, the shaking speed is 150-200 rpm, and the glucose concentration in the fermentation medium is 80-100 g / L. The bacterial cells are collected and lipids are extracted to obtain EPA.

[0090] S51 activated Schizochytrium engineered strain for fermentation:

[0091] The genetically engineered strain of Schizochytrium is inoculated on a plate culture medium. After plate culture, a single colony is picked out and inoculated on a seed culture medium for activation.

[0092] The engineered strain of Schizochytrium was inoculated into a seed culture medium, and cultured in a shaking incubator at 28°C and 180 r / min for 24 hours to obtain a first-level seed culture solution; the first-level seed culture solution was inoculated into a new seed culture medium at a ratio of 5% to obtain a second-level seed culture solution; the second-level seed culture solution was inoculated into a new seed culture medium at a ratio of 5% to obtain a third-level seed culture solution;

[0093] Fermentation culture of S52 recombinant bacteria 3

[0094] Take 10 mL of the third-level seed culture solution and inoculate it into 90 mL of the fermentation medium. Incubate it in a shaking incubator at 28°C and 180 rpm for 120 h.

[0095] S53 The method for collecting bacterial cells and extracting lipids comprises:

[0096] After the fermentation is completed, NaOH is added to the fermentation broth to adjust the pH to 10-13, a final mass concentration of 0.01-0.2% (w / v) wall-breaking enzyme is added, and the mixture is oscillated at 50°C and 150 r / min for 10 to 15 hours; after the oscillation is completed, the mixture is cooled to room temperature, and anhydrous ethanol in an amount equal to the volume of the fermentation broth is added to inactivate the enzyme and precipitate the protein; then n-hexane in an amount equal to the volume of the fermentation broth is added for extraction, and the upper organic phase is collected; the extraction is repeated until the organic phase becomes colorless; the organic phase is volatilized by rotary evaporation to finally obtain the total oil, and the volume is measured and the oil content in the recombinant bacteria 3 is calculated.

[0097] Gas phase detection and analysis of the fatty acid composition in oils and fats. Take 20 μL of oil and fat and add it to a 2 mL centrifuge tube, add 600 μL of 1M sodium hydroxide-methanol solution, shake at room temperature and 1000 r / min for 4 hours, add 40 μL of concentrated sulfuric acid to terminate the reaction, add 1 mL of n-hexane containing internal standard, shake at room temperature and 1000 r / min for 30 minutes to obtain the extract phase. Add the extract phase to the gas phase vial for detection.

[0098] The chromatographic column used in the experiment was DB-23 (60.0m×0.25mm×0.25μm); detection conditions: injection port temperature 250℃, injection volume 1.0μL, split ratio 69.8:1; chromatographic conditions: initial temperature 100℃, 25℃ / min heating to 196℃. Then, 2℃ / min heating to 220℃ and keep warm for 21min.

[0099] After the gas phase detection, different fatty acids were identified by comparison with relevant external standards (Sigma, USA). In this gas phase detection, non-endogenous fatty acids (C11:0) were used as internal standards, and the content of individual fatty acids was estimated from the peak area on the chromatogram.

[0100] The plate culture medium has a pH value of 6.5, and the ingredients include: 15 g / L agar, 60 g / L glucose, 10 g / L yeast extract, 10 g / L sodium sulfate, 4 g / L magnesium sulfate, 8 g / L ammonium sulfate, 2 g / L potassium chloride, 0.1 g / L calcium chloride, 0.5 g / L potassium sulfate, 2 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 4 mg / L zinc sulfate heptahydrate, 0.01 mg / L cobalt dichloride hexahydrate, 2 mg / L copper sulfate pentahydrate, 2 mg / L nickel sulfate hexahydrate, 10 mg / L ferrous sulfate heptahydrate, 4 mg / L calcium pantothenate, 5 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 6 mg / L vitamin B6, 1.3 mg / L vitamin B12, and the solvent is water.

[0101] The seed culture medium has a pH of 6.6, and its ingredients include: 50 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 10 g / L sodium glutamate, 0.1% trace minerals, 5 mg / L vitamin B6 and 0.5 mg / L vitamin B12, and the solvent is water.

[0102] The fermentation medium has a pH value of 7.0, and includes the following ingredients: 80 g / L glucose, 10 g / L yeast extract, 10 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 20 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.05 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1.5 mg / L nickel sulfate hexahydrate, 10 mg / L ferrous sulfate heptahydrate, 3 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 5 mg / L vitamin B6 and 0.5 mg / L vitamin B12; the solvent is water.

[0103] The use of the genetically engineered Schizochytrium strain described above in EPA production.

[0104] Specifically, the relevant preparation and detection are as follows:

[0105] The culture medium used in the following examples is as follows:

[0106] Plate culture medium: pH value is 6.5, ingredients include: agar 15g / L, glucose 60g / L, yeast extract powder 10g / L, sodium sulfate 10g / L, magnesium sulfate 4g / L, ammonium sulfate 8g / L, potassium chloride 2g / L, calcium chloride 0.1g / L, potassium sulfate 0.5g / L, potassium dihydrogen phosphate 2g / L, sodium glutamate 8g / L, zinc sulfate heptahydrate 4mg / L, cobalt dichloride hexahydrate 0.01mg / L, copper sulfate pentahydrate 2mg / L, nickel sulfate hexahydrate 2mg / L, ferrous sulfate heptahydrate 10mg / L, calcium pantothenate 4mg / L, manganese chloride tetrahydrate 5mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B6 6mg / L, vitamin B12 1.3mg / L, solvent is water;

[0107] Seed culture medium: pH is 6.6. The ingredients include: glucose 50g / L, yeast extract powder 5g / L, sodium sulfate 5g / L, magnesium sulfate 2g / L, ammonium sulfate 6g / L, potassium chloride 1g / L, calcium chloride 0.1g / L, potassium sulfate 0.6g / L, potassium dihydrogen phosphate 1g / L, monosodium glutamate 10g / L, 0.1% trace minerals, vitamin B65mg / L and vitamin B12 0.5mg / L. The solvent is water.

[0108] Fermentation medium: pH to 7.0, ingredients include: glucose 80g / L, yeast extract 10g / L, sodium sulfate 10g / L, magnesium sulfate 2g / L, ammonium sulfate 6g / L, potassium chloride 1g / L, calcium chloride 0.1g / L, potassium sulfate 0.6g / L, potassium dihydrogen phosphate 1g / L, sodium glutamate 20g / L, zinc sulfate heptahydrate 3mg / L, cobalt dichloride hexahydrate 0.05mg / L, copper sulfate pentahydrate 4mg / L, nickel sulfate hexahydrate 1.5mg / L, ferrous sulfate heptahydrate 10mg / L, calcium pantothenate 3mg / L, manganese chloride tetrahydrate 4mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B6 5mg / L and vitamin B 12 0.5mg / L, the solvent is water.

[0109] Example 1 Construction of recombinant plasmid pzpk-PaC16EL-F2A-PaΔ9DE-2520

[0110] This example is a method for constructing the recombinant plasmid pzpk-PaC16EL-F2A-PaΔ9DE-2520, comprising the following steps performed in sequence:

[0111] S1. Construction of recombinant plasmid pzpk-NeoR

[0112] Cloning of neomycin resistance gene (NeoR gene), promoter P2520, promoter P2845, terminator TCYC1t, terminator T2845 genes in S11 recombinant plasmid pzpk-NeoR-2520

[0113] The primer sequences were designed as shown in SEQ ID NO.11 / SEQ ID NO.12, SEQ ID NO.13 / SEQ ID NO.14, SEQ ID NO.15 / SEQ ID NO.16, SEQ ID NO.17 / SEQ ID NO.18, and SEQ ID NO.19 / SEQ ID NO.20, respectively, and the NeoR gene synthesized by the company and the Schizochytrium sp.HX-308 genome were used as templates. The primers P1 / P2, P3 / P4, P5 / P6, P7 / P8, P9 / P10 and PrimerStar high-fidelity polymerase (Nanjing, Novozymes) were used to obtain the neomycin resistance gene (NeoR gene), promoter P2520, promoter P2845, terminator TCYC1t and terminator T2845 by PCR (according to the product instructions). The PCR program was: 98°C for 30s, 56°C for 30s, 70°C for 1min, 32 cycles, and the PCR product was purified using a gel recovery kit produced by Nanjing Novozyme according to the instructions, and the purified product was verified by agarose gel electrophoresis. The gene sequences of the neomycin resistance gene (NeoR gene), promoter P2520, promoter P2845, terminator TCYC1t, and terminator T2845 were SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, and SEQ ID NO.25, respectively.

[0114] S12 ligation reaction

[0115] The pzpk plasmid (disclosed in the patent with publication number CN 114480148 A) was digested with EcoRI (Nanjing, Bio-Engineering), and the plasmid backbone after digestion and the amplified NeoR gene, promoter P2845, and terminator T2845 were cloned in one step using ClonExpress MultiS One Step Cloning Kit (Nanjing, Novizan). The experiment was carried out according to the product instructions to construct the pzpk-NeoR plasmid. Ligation system (20 μL): 2 μL of each gene fragment, 1 μL of vector digestion fragment, 10 μL of ligase buffer, 3 μL of ddH 2 O, 50℃ connection for 50min. Enzyme digestion system (50μL): plasmid vector 4μg, EcoRI enzyme 2μL, 10X SpeedyOne Buffer 5μL, ddH 2 Add 50 μL of 4% dHO to a volume of 50 μL and perform the enzyme digestion experiment according to the instructions.

[0116] S13 transforms E. coli DH5α competent cells. The method for transforming E. coli is as follows:

[0117] (1) Aseptically take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 min.

[0118] (2) Heat shock at 42°C for 90 seconds and immediately place on ice for 3 minutes.

[0119] (3) Add 1000 μL LB medium and incubate at 37°C, 220 rpm for 40 min.

[0120] (4) Take 200 μL and spread it on an LB plate containing 50 μg / mL Kan resistance. Invert and culture at 37°C overnight.

[0121] Positive transformants were selected, plasmids were extracted, and sequencing verification results showed that the connection was successful, and finally the pzpk-NeoR plasmid was successfully constructed.

[0122] Construction of S2 recombinant plasmid pzpk-NeoR-2520

[0123] S21 used the constructed pzpk-NeoR plasmid as a template, digested with HindⅢ enzyme (Nanjing, Bio-Science), and the plasmid backbone after digestion was subjected to the same ligation reaction as S12 with the promoter P2520 and terminator TCYC1t amplified above, and one-step cloning was performed using ClonExpress MultiS One Step Cloning Kit (Nanjing, Novizan), and the experiment was performed according to the product instructions to construct the pZPK-NeoR-2520 plasmid. The ligation system and enzyme digestion system were the same as S12.

[0124] S22 was transformed into E. coli DH5α competent cells, and colony PCR and sequencing were performed for verification. Finally, the pZPK-NeoR-2520 plasmid was successfully constructed, and the operation was the same as S13.

[0125] Construction of S3 recombinant plasmid pZPK-PaC16EL-F2A-PaΔ9DE-2520

[0126] S31 designed primer sequences as shown in SEQ ID NO.26 / SEQ ID NO.27, SEQ ID NO.28 / SEQ ID NO.29, respectively, primers P11 / P12, P13 / P14, using the thraustochytrid genome as a template, primers P11 / P12, P13 / P14, PrimerStar high-fidelity polymerase, to obtain PaC16EL gene and PaΔ9DE gene fragments by PCR amplification. The amplification procedure is the same as S11.

[0127] S32 Ligation Reaction

[0128] The pZPK-NeoR-2520 plasmid constructed above was used as a template, and BamHI enzyme (Nanjing, Bio-Science) was used for enzyme digestion, and the enzyme digestion backbone was cloned and connected with the amplified PaC16EL gene and PaΔ9DE gene fragments in one step, and ClonExpress MultiS One Step Cloning Kit (Nanjing, Novizan) was used for one-step cloning. The experiment was carried out according to the product instructions to construct plasmid pZPK-PaC16EL-F2A-PaΔ9DE-2520. The connection system and enzyme digestion system are the same as S12. Among them, F2A is used as a connecting peptide, and F2A is used as a connecting part to connect the PaC16EL gene and PaΔ9DE gene fragments while amplifying the PaC16EL gene and PaΔ9DE gene fragments, which are displayed in lowercase letters in P12 and P13.

[0129] S33 was transformed into Escherichia coli DH5α competent cells, and colony PCR and sequencing verification were performed. Finally, the pZPK-PaC16EL-F2A-PaΔ9DE-2520 plasmid was successfully constructed, and the operation was the same as S13.

[0130] The relevant gene sequences mentioned in Example 1 are as follows, and the black bold part is the connection part:

[0131] SEQ ID NO.11P1: GTAAAAGCTCGCGTGCGACTTTTCAGAAGAACTCGTCAAGAAGGC

[0132] SEQ ID NO.12P2: CAGCGAGAGGCGAGAGAAAAGATGATTGAACAAGATGGATTGCACG

[0133] SEQ ID NO.13P3: CAATCTGATCCAAGCTCAAGCTGCCAGCAACCAAAGCAACCAGAGCAAC

[0134] SEQ ID NO.14P4: GTGACATAACTAATTACATGAGGATCCTGTTCCTGCTGCTGCTGCTG

[0135] SEQ ID NO.15P5: GTAAAAGCTCGCGTGCGACTTTAAGCTTCTTTTCTCTCGCCTCTCGCTG

[0136] SEQ ID NO.16 P6: GAATTAACGCCGAATTGAATTTTTCTCGACACTTGTCTCCGG

[0137] SEQ ID NO.17 P7: CAGCAGCAGGAACAGGATCCTCATGTAATTAGTTATGTCACGCTTA

[0138] SEQ ID NO.18 P8: GTCTAGAGTCGACCTGCAGCATGCAGCAAATTAAAGCCTTCGAGCGTC

[0139] SEQ ID NO.19 P9: CATGCTGCAGGTCGACTCTAGACGATAAGGCTACCCTAGAGCAG

[0140] SEQ ID NO.20 P10: CGAGAGGCGAGAGAAAAGAAGCTTAAAGTCGCACGCGAGCTTTTTAC

[0141] SEQ ID NO.26 P11: CAGCAGCAGCAGCAGGAACAATGTCTACCCGGGCGCCAAAG

[0142] SEQ ID NO.27 P12: accagggttagattcaacgcaaccagcaagcttaagcaagtcaaagttcaacgtttgcttaacCTCGGCCTTTGCCTTGGTG

[0143] SEQ ID NO.28 P13: gttaagcaaacgttgaactttgacttgcttaagcttgctggttgcgttgaatctaaccctggtATGGCAGCTGCCAACTTGCA

[0144] SEQ ID NO.29 P14: AAGCGTGACATAACTAATTACATGATTAGCTGACCACGCGTTGGC

[0145] SEQ ID NO.21 NeoR gene:

[0146] TCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCAT

[0147] Promoter P2520 of SEQ ID NO.22:

[0148]

[0149] SEQ ID NO.23 Promoter P2845:

[0150]

[0151] Terminator TCYC1t of SEQ ID NO.24:

[0152] TCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGC

[0153] Terminator T2845 of SEQ ID NO.25:

[0154] CGATAAGGCTACCCTAGAGCAGTATGCTGAATTTGCAGCACAATTTGGCTCTGATTCGCGTGACTTTGCATTCGAAGACGACGACATGGATATTGAAGAAGAGGACTGGGAAAGGGAAGAGGAAGAGGCAGAACGCGAGAAGGACCTGGAAGCGAGAAACAAACAAAGGGAGCAAGTCCAGGCAAAACGTGGCACGGAAGCGGCAAGAGCGACAGAGGCCCCGGCGCCAGCAAGAGTTGCCATGCTTTCATGAGCATGGATCAGTCAGCCAGTCAGCCAGCCAGCCATGGCGTCCGGGGTCGATTCCGCGGCTCGAACATGTGTTGCTCGCAAAGATATGCCCTCGACTTCTGTATTCCACCTGGCGTTCCGTTCTCATCCATAGTATCTTTCCTGTGGTCACGCTGTCAAGCTCCCGTGTTTCTGCGTTGTTTTCTGGTGCAACAAGAGGGATCGGAGGAAGAAAAAAAATAATAATAGGAAAAGTAAAAAGCTCGCGTGCGACTTT

[0155] Construction of Recombinant Plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520 in Example 2

[0156] This example is a method for constructing the recombinant plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520, comprising the following steps performed in sequence:

[0157] S1. Construction of recombinant plasmid pZPK-NrsR

[0158] S11PCR amplification of the fragment of the nourseoinhibin resistance gene (NrsR)

[0159] Primers P15 / P16 with gene sequences as shown in SEQ ID NO.30 / SEQ ID NO.31 were designed. The NrsR gene synthesized by the company was used as a template, and primers P15 / P16 and PrimerStar high-fidelity polymerase were used to amplify the NrsR gene fragment by PCR. The amplification procedure was the same as S11. The sequence of the NrsR gene fragment is shown in SEQ ID NO.38.

[0160] S12 ligation reaction

[0161] The pzpk plasmid was digested with EcoRI (Nanjing, Biotech), and the plasmid backbone after digestion and the amplified NrsR gene, promoter P2845, and terminator T2845 were cloned in one step using ClonExpress MultiS One Step Cloning Kit (Nanjing, Novizan), and the experiment was carried out according to the product instructions to construct the pZPK-NrsR plasmid. The ligation system and the digestion system were the same as those in Example 1.

[0162] S13 was transformed into E. coli DH5α competent cells, and the operation was the same as S13 in Example 1, and finally the pZPK-NrsR plasmid was successfully constructed.

[0163] S2. Construction of recombinant plasmid pZPK-NrsR-2520

[0164] S21 used the constructed pzpk-NrsR plasmid as a template, digested with HindⅢ enzyme (Nanjing, Bio-Science), and the plasmid backbone after digestion was subjected to the same ligation reaction as S12 with the promoter P2520 and terminator TCYC1t amplified above, and one-step cloning was performed using ClonExpress MultiS One Step Cloning Kit (Nanjing, Novizan), and the experiment was performed according to the product instructions to construct the pZPK-NrsR-2520 plasmid. The ligation system and enzyme digestion system were the same as S12.

[0165] S22 was transformed into Escherichia coli DH5α competent cells, and colony PCR and sequencing verification were performed, and finally the pZPK-NrsR-2520 plasmid was successfully constructed. The operation was the same as S13.

[0166] Construction of S3 recombinant plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520

[0167] S31 designed primer sequences as shown in SEQ ID NO.32 / SEQ ID NO.33, SEQ ID NO.34 / SEQ ID NO.35 and SEQ ID NO.36 / SEQ ID NO.37, respectively, and primers P17 / P18, P19 / P20, P21 / P22 were used as templates to obtain PaΔ12DE, PaΔ6DE, and FmΔ12DE gene fragments by PCR amplification using primers P17 / P18, P19 / P20, P21 / P22 and PrimerStar high-fidelity polymerase (Nanjing, Novizan). The amplification procedure was the same as S11 in Example 1.

[0168] S32 Ligation Reaction

[0169] The pZPK-NrsR-2520 plasmid constructed above was used as a template, and BamHI enzyme (Nanjing, Biotech) was used for restriction digestion. The restriction digestion backbone was cloned and connected with the amplified PaΔ12DE / FmΔ12DE gene and PaΔ6DE gene fragments in one step to construct the plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2502. The connection system and restriction digestion system are the same as S12. Among them, P2A is used as a connecting peptide. When the PaΔ12DE / FmΔ12DE gene and PaΔ6DE gene fragments are amplified, F2A is used as a connecting part to connect with the PaΔ12DE / FmΔ12DE gene and PaΔ6DE gene fragments, which are displayed in lowercase letters in P18 / P22 and P19.

[0170] S33 was transformed into Escherichia coli DH5α competent cells, and colony PCR and sequencing verification were performed, and finally the pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520 plasmid was successfully constructed. The experimental operation was the same as S13 in Example 1.

[0171] The relevant gene sequences mentioned in Example 2 are as follows, and the black bold part is the connection part:

[0172] SEQ ID NO.30P15: GTAAAAGCTCGCGTGCGACTTTTTAGGGGCAGGGCATGCTCA

[0173] SEQ ID NO.31 P16: CCAGCGAGAGGCGAGAGAAAAGATGGGTACCACTCTTGACGAC

[0174] SEQ ID NO.32 P17: GCAGCAGCAGCAGCAGGAACAATGTGCCAGAGCGAGGTTAAG

[0175] SEQ ID NO.33 P18: cgggccggggttctcctcgacgtcgcccgcctgcttgaggaggctaaagttggtggcgcccgaaccTTAAAGCTTCTTGGCAGTGCGGC

[0176] SEQ ID NO.34 P19: ggttcgggcgccaccaactttagcctcctcaagcaggcgggcgacgtcgaggagaaccccggcccgATGGGCCGCGGCGGCGAGAAG

[0177] SEQ ID NO.35 P20: AAGCGTGACATAACTAATTACATGACTACTGGGCCTTGGCCTTCTTG

[0178] SEQ ID NO.36 P21: GCAGCAGCAGCAGCAGGAACAATGGCTAGCACCTCTGCCCTC

[0179] SEQ ID NO.37 P22: cgggccggggttctcctcgacgtcgcccgcctgcttgaggaggctaaagttggtggcgcccgaaccTTAGGCAACCGGCTTAATAACG

[0180] SEQ ID NO.38 NrsR gene:

[0181] TTAGGGGCAGGGCATGCTCATGTAGAGCGCCTGCTCGCCGTCCGAGGCGGTGCCGTCGTACAGGGCGGTGTCCAGGCCGCAGAGGGTGAACCCCATCCGCCGGTACGCGTGGATCGCCGGTGCGTTGACGTTGGTGACCTCCA GCCAGAGGTGCCCGGCGCCCCGCTCGCGGGCGAACTCCGTCGCGAGCCCCATCAACGCGCGCCCGACCCCGTGCCCCCGGTGCTCCGGGGCGACCTCGATGTCCTCGACGGTCAGCCGGCGGTTCCAGCCGGAGTACGAGACG ACCACGAAGCCCGCCAGGTCGCCGTCGTCCCCGTACGCGACGAACGTCCGGGAGTCCGGGTCGCCGTCCTCCCCGTCGTCCGATTCGTCGTCCGATTCGTCGTCGGGGAACACCTTGGTCAGGGGCGGGTCCACCGGCACCTC CCGCAGGGTGAAGCCGTCCCCGGTGGCGGTGACGCGGAAGACGGTGTCGGTGGTGAAGGACCCATCCAGTGCCTCGATGGCCTCGGCGTCCCCCGGGACACTGGTGCGGTACCGGTAAGCCGTGTCGTCAAGAGTGGTACCCAT

[0182] Example 3 Construction of recombinant plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL

[0183] This example is a method for constructing the recombinant plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL, comprising the following steps performed in sequence:

[0184] S1. Construction of recombinant plasmid pZPK-BleoR

[0185] S11 PCR amplification of the bleomycin resistance gene fragment (BleoR)

[0186] Primers P23 / P24 with gene sequences as shown in SEQ ID NO.39 / SEQ ID NO.40 were designed. The BleoR gene fragment was obtained by PCR amplification using primers P23 / P24 and PrimerStar high-fidelity polymerase (Nanjing, Novizan). The amplification procedure was the same as S11. The sequence of the BleoR gene fragment is shown in SEQ ID NO.53.

[0187] S12 ligation reaction

[0188] The pzpk plasmid was digested with EcoRI, and the plasmid backbone after digestion and the amplified BleoR gene, promoter P2845, and terminator T2845 were cloned in one step using ClonExpress MultiS One Step Cloning Kit (Nanjing, Novezan), and the experiment was carried out according to the instruction manual to construct the pZPK-BleoR plasmid. The ligation system and the digestion system were the same as those in Example 1.

[0189] S13 was transformed into E. coli DH5α competent cells, and the experimental operation was the same as S13 in Example 1, and finally the pZPK-BleoR plasmid was successfully constructed.

[0190] S2. Construction of recombinant plasmid pZPK-BleoR-2520-2520

[0191] The construction of S21 recombinant plasmid pZPK-BleoR-2520 was the same as S2 in Example 1.

[0192] S22 designed the sequence as shown in SEQ ID NO.41 / SEQ ID NO.42, SEQ ID NO.43 / SEQ ID NO.44, primers P25 / P26, P27 / P28, using the Schizochytrium genome as a template, using primers P25 / P26, P27 / P28, PrimerStar high-fidelity polymerase (Nanjing, Novizan), and obtained the promoter P2520 and terminator TCYC1t gene fragments by PCR amplification. The amplification procedure is the same as S11. The sequences of the promoter P2520 and terminator TCYC1t gene fragments are the same as the promoter P2520 and terminator TCYC1t gene fragments in Example 1, but the restriction site between the two is changed from BamHI to PacI, which is specifically embodied in that the primers designed to amplify the promoter P2520 and terminator TCYC1t gene fragments are different, and the added restriction site is not.

[0193] S23: Use AscI endonuclease (Nanjing, Biotechnology) to digest the pZPK-BleoR-2520 plasmid, and connect the plasmid backbone after digestion with the above-mentioned expanded promoter P2520 and terminator TCYC1t gene fragments. The subsequent operations are the same as S2 in Example 1 to construct the recombinant plasmid pZPK-BleoR-2520-2520.

[0194] Construction of S3 recombinant plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL

[0195] S31 designed primer sequences as shown in SEQ ID NO.45 / SEQ ID NO.46, SEQ ID NO.47 / SEQ IDNO.48 and SEQ ID NO.49 / SEQ ID NO.50, SEQ ID NO.51 / SEQ ID NO.52, respectively, including primers P29 / P30, P31 / P32, P33 / P35, and P36 / P37. The thraustochytrid genome and the Saprolegnia genome were used as templates, and primers P29 / P30, P31 / P32, P33 / P34, P35 / P36, and PrimerStar high-fidelity polymerase (Nanjing, Novezan) were used to amplify the PaΔ5DE, PaΔ17DE, PaC18EL, and SdΔ17DE gene fragments by PCR (same as before). The amplification procedure was the same as S11 in Example 1. While amplifying the PaΔ17DE / SdΔ17DE gene and PaΔ5DE gene fragments, P2A was connected to the PaΔ17DE / SdΔ17DE gene and PaΔ5DE gene fragments as a connecting part, and is shown in lowercase letters in P31 / P36 and P30.

[0196] S32 Ligation Reaction

[0197] The pZPK-BleoR-2520-2520 plasmid constructed above was used as a template, and BamHI enzyme (Nanjing Biotechnology Co., Ltd.) was used for restriction digestion, and the restriction digestion backbone and the amplified PaC18EL gene fragment were cloned and connected in one step to construct the plasmid pZPK-2520-PaC18EL. The connection system and restriction digestion system were the same as S12.

[0198] S33 was transformed into Escherichia coli DH5α competent cells, and colony PCR and sequencing verification were performed, and finally the pZPK-2520-PaC18EL plasmid was successfully constructed.

[0199] S34 used the above-constructed pZPK-2520-PaC18EL plasmid as a template, and used PacI enzyme (Nanjing, Biotech) for restriction digestion, and cloned and connected the restriction backbone with the amplified PaΔ5DE and PaΔ17DE / SdΔ17DE gene fragments in one step to construct the plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL. The connection system and restriction digestion system were the same as S12.

[0200] S35 was transformed into Escherichia coli DH5α competent cells, and colony PCR and sequencing verification were performed, and finally the pZPK-2520-PaC18EL plasmid was successfully constructed.

[0201] The relevant gene sequences mentioned in Example 3 are as follows, and the black bold part is the connection part:

[0202] SEQ ID NO.39P23: AAGTAAAAAGCTCGCGTGCGACTTTTCAGTCCTGCTCCTCGGCCA

[0203] SEQ ID NO.40P24: GGGCCAGCGAGAGGCGAGAGAAAAGATGGCCAAGTTGACCAGTGC

[0204] SEQ ID NO.41P25: GATCCAAGCTCAAGCTGCCAGCAACCAAAGCAACCAGAGC

[0205] SEQ ID NO.42P26: GTGACATAACTAATTACATGATTAATTAATGTTCCTGCTGCTGCTGCTG

[0206] SEQ ID NO.43P27: CAGCAGCAGCAGCAGGAACATTAATTAATCATGTAATTAGTTATGTCAC

[0207] SEQ ID NO.44P28: CTTTAATTTGCGTCGACCTGCAGCATGCAGCAAATTAAAGCCTTCGAGCG

[0208] SEQ ID NO.45P29: CAGCAGCAGCAGCAGGAACAATGGGTCGCGGAGCACAGGG

[0209] SEQ ID NO.46P30:cgggccggggttctcctcgacgtcgcccgcctgcttgaggaggctaaagttggtggcgcccgaaccCTCGCTCTTGGCAGCTTGGC

[0210] SEQ ID NO.47P31:ggttcgggcgccaccaactttagcctcctcaagcaggcgggcgacgtcgaggagaaccccggcccgATGACCGAGGACAAGACGAAG

[0211] SEQ ID NO.48P32:GTAAGCGTGACATAACTAATTACATGATTAGTCGGACTTGGCCTTGG

[0212] SEQ ID NO.49P33:GCGTGACATAACTAATTACATGAATGTCTAACTTTGGAGTTGGGAAAG

[0213] SEQ ID NO.50P34:GAGCAGCAGCAGCAGCAGCAGCAGCAGGAACATTAGTTGGTCTTGCTCTTTTTTGGC

[0214] SEQ ID NO.51P35:ggttcgggcgccaccaactttagcctcctcaagcaggcgggcgacgtcgaggagaaccccggcccgATGACCGAGGACAAGACGAAG

[0215] SEQ ID NO.52P36:GCGTGACATAACTAATTACATGATTAGTCGGACTTGGCCTTGG

[0216] SEQ ID NO.53BleoR:

[0217] TCAGTCCCTGCTCCTCGGCCACGAAGTGCACGCAGTTGCCGGCCGGGTCGCGCAGGGCGAACTCCCGCCCCCACGGCTGCTCGCCGATCTCGGTCATGGCCGGCCCGGAGGCGTCCCGGAAGTTCGTGGACACGACCTCCGACCACTCGGCGTACAGCTCGTCCAGGCCGCGCACCCACACCCAGGCC AGGGGTTGTCCGGCACCACCTGGTCCTGGACCGCGCTGATGAACAGGGTCACGTCGTCCCGGACCACACCGGCGAAGTCGTCCTCCACGAAGTCCCGGGAGAACCCGAGCCGGTCGGTCCAGAACTCGACCGCTCCGGCGACGTCGCGCCGGTGAGCACCGGAACGGCACTGGTCAACTTGGCCAT

[0218] Example 4 Method for constructing a genetically engineered strain of Schizochytrium expressing an extended desaturase gene

[0219] This example is a method for constructing a genetically engineered strain of Schizochytrium that expresses an elongated desaturase gene, which mainly includes the following steps in sequence:

[0220] Construction of S1 Schizochytrium genetically engineered strain 1

[0221] Preparation of S11 Schizochytrium competent cells

[0222] The Schizochytrium HX-308 was activated by streaking on a plate. After a single colony grew out, the single colony was inoculated into 50 mL of seed culture medium and cultured in a shaking incubator at 28°C and 170 r / min for 24 h.

[0223] The first-grade seed liquid was inoculated into a new 50 mL seed culture medium at a 5% inoculation rate and cultured in a shaking incubator at 28° C. and 170 rpm for 24 h.

[0224] The secondary seed solution was inoculated into a new 50 mL seed culture medium at a 5% inoculation rate, and cultured in a shaking incubator at 28° C. and 170 r / min for 24 h to obtain the tertiary seed solution.

[0225] Take 25 mL of the third-grade seed solution and centrifuge at 4000 rpm for 5 min at room temperature. Then take the precipitate and add the same volume of pretreatment agent (20 mM DTT and 0.1 M CaCl 2The cells were dissolved in Tris-HCl buffer (pH 6.5) and gently shaken to loosen the cell walls.

[0226] The treated bacterial solution was centrifuged, and then centrifuged twice using pre-cooled PBS with the same volume as the fermentation solution to wash the bacteria (4000 rpm, 4°C for 5 min).

[0227] Finally, sterile precooled sorbitol solution (1 M containing 0.1 M CaCl 2 ) Wash the cells twice, centrifugation conditions are the same as above. Use 200 mL of 1M sterile pre-cooled sorbitol solution (containing 0.1M CaCl 2 ) and then dispense 100 μL into 1.5 mL centrifuge tubes and keep on ice for later use.

[0228] Electrotransformation of Schizochytrium S12

[0229] Add 10 μL of linearized recombinant plasmid pZPK-PaC16EL-F2A-PaΔ9DE-2520 to the competent cells of Schizochytrium, mix gently and transfer to a pre-cooled and dried electroporation cup, then place on ice for 30 minutes. After the static period, perform an electric shock, 2KV, one pulse.

[0230] After the electric shock is completed, immediately add 500-1000 μL of pre-cooled seed solution (containing 1M sterile pre-cooled sorbitol solution) into the electroporation cup, mix well and add to the seed culture medium containing 1M sorbitol, and culture in a shaking incubator at 28°C and 180 r / min for 2-4 hours.

[0231] After the culture is completed, a certain amount (300-500 μL) of the bacterial solution is spread on the plate culture medium and cultured in a 28°C incubator for 2-4 days.

[0232] Screening and identification of genetically engineered strain 1 of Schizochytrium S13

[0233] A single colony was picked from the plate and placed in a seed culture medium containing G418 resistance (500 mg / L) and cultured in a shaking incubator at 28°C and 180 r / min for 24 h.

[0234] The overexpression vector was subcultured three times to ensure stability, and the previous step was repeated in each generation.

[0235] 1 mL of the bacterial solution of the stably expressed Schizochytrium genetically engineered strain 1 was taken, 1 mL of 40% glycerol was added, and the solution was stored in a -80°C refrigerator.

[0236] Construction of genetically engineered strain 2 of Schizochytrium S2

[0237] The construction process of Schizochytrium genetically engineered strain 2 is basically the same as that of strain 1. The main differences are: when constructing Schizochytrium genetically engineered strain 2, the strain used to make Schizochytrium competent is strain 1; when performing electrotransformation, the transformed plasmid is pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520; when screening engineered strains, the resistance of the seed culture medium is nourseoin (75 mg / L).

[0238] Construction of genetically engineered strain 3 of Schizochytrium S3

[0239] The construction process of Schizochytrium genetically engineered strain 3 is basically the same as that of strain 1. The main differences are: when constructing Schizochytrium genetically engineered strain 3, the strain used to make Schizochytrium competent is strain 2; when performing electrotransformation, the transformed plasmid is pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL; when screening engineered strains, the resistance of the seed culture medium is bleomycin (100 mg / L).

[0240] Example 5 Application of the Schizochytrium genetically engineered strain expressing the elongated desaturase gene for producing EPA

[0241] This example mainly uses the Schizochytrium genetically engineered recombinant bacteria 3 constructed in Example 4 to produce EPA. The method mainly includes the following steps:

[0242] S1 activated recombinant bacteria 3

[0243] The recombinant bacteria 3 was inoculated into 50 mL of seed culture medium, and cultured in a shaking incubator at 28° C. and 180 r / min for 24 h to obtain a first-level seed culture solution; the first-level seed culture solution was inoculated into a new seed culture medium at a ratio of 5%, and cultured in a shaking incubator at 28° C. and 180 r / min for 24 h to obtain a second-level seed culture solution; the second-level seed culture solution was inoculated into a new seed culture medium at a ratio of 5%, and cultured in a shaking incubator at 28° C. and 180 r / min for 24 h to obtain a third-level seed culture solution.

[0244] Fermentation culture of S2 recombinant bacteria 3

[0245] 10 mL of the third-level seed culture solution was taken and inoculated into a 500 mL conical flask (containing 90 mL of fermentation medium), and cultured in a shaking incubator at 28°C and 180 r / min for 120 h, with samples taken every 24 h.

[0246] Analysis of S3 fermentation products

[0247] After the fermentation is completed, NaOH is added to the fermentation broth to adjust the pH to 10-13, a final mass concentration of 0.01-0.2% (w / v) wall-breaking enzyme is added, and the broth is shaken at 50°C and 150r / min for 10 to 15 hours; after the shaking is completed, the broth is cooled to room temperature, and anhydrous ethanol with the same volume as the fermentation broth is added to inactivate the enzyme and precipitate the protein; then n-hexane with the same volume as the fermentation broth is added for extraction, and the upper organic phase is collected; the extraction is repeated until the organic phase becomes colorless; the organic phase is volatilized by rotary evaporation to finally obtain total oil, and the volume is measured and the oil content in the recombinant bacteria 3 is calculated.

[0248] Gas phase detection and analysis of the fatty acid composition in oils and fats. Take 20 μL of oil and fat and add it to a 2 mL centrifuge tube, add 600 μL of 1M sodium hydroxide-methanol solution, shake at room temperature and 1000 r / min for 4 hours, add 40 μL of concentrated sulfuric acid to terminate the reaction, add 1 mL of n-hexane containing internal standard, shake at room temperature and 1000 r / min for 30 minutes to obtain the extract phase. Add the extract phase to the gas phase vial for detection.

[0249] The chromatographic column used in the experiment was DB-23 (60.0m×0.25mm×0.25μm); detection conditions: injection port temperature 250℃, injection volume 1.0μL, split ratio 69.8:1; chromatographic conditions: initial temperature 100℃, 25℃ / min heating to 196℃. Then, 2℃ / min heating to 220℃ and keep warm for 21min.

[0250] After the gas phase detection, different fatty acids were identified by comparison with relevant external standards (Sigma, USA). In this gas phase detection, non-endogenous fatty acids (C11:0) were used as internal standards, and the content of individual fatty acids was estimated from the peak area on the chromatogram. Figure 4 shown.

[0251] from Figure 4 , Figure 5 It can be seen that the Schizochytrium engineered strain expressing the extended desaturase gene constructed by the construction method of the present invention can successfully and efficiently produce EPA. The oil content of the engineered strain reaches 74.25 g / L, and the EPA content of the Schizochytrium genetically engineered strain (10.51%) is increased by 10.30 times compared with the wild type (1.02%). The genetically engineered strain constructed by this method and the construction method have laid a strong foundation for subsequent theoretical research and industrial production.

[0252] In addition, in the patent with publication number CN 116179584A, a Schizochytrium genetically engineered bacterium that efficiently produces EPA is obtained by overexpressing the genes AT, KS or AT-KS in the MetE-like domain in the wild type of Schizochytrium. Compared with the disclosed patent, the present invention constructs a new EPA synthesis pathway in Schizochytrium, rather than simply overexpressing some of the original genes of Schizochytrium, which significantly improves the ability of Schizochytrium to produce EPA and provides new ideas and research strategies for the subsequent industrial production of EPA by Schizochytrium.

[0253] Compared with the patents that have been published, the present invention constructs a fatty acid elongation desaturation pathway in Schizochytrium, so that the content of EPA produced by Schizochytrium fermentation increases from 1.02% to 10.51%, which is higher than the reference document.

[0254] The gene sequence of the elongated desaturase is as follows:

[0255] 1) The gene sequence of the carbon 16 elongase (from thraustochytrid) is shown in SEQ ID NO.1, specifically:

[0256]

[0257] 2) The Δ9 desaturase gene sequence (from Thraustochytrid) is shown in SEQ ID NO. 2, specifically:

[0258]

[0259] 3) The Δ12 desaturase gene sequence (from Thraustochytrid) is shown in SEQ ID NO.3, specifically:

[0260]

[0261] 4) Δ12 desaturase (from Fusarium sphaeroides) gene sequence as shown in SEQ ID NO.4, specifically:

[0262]

[0263] 5) Δ6 desaturase (from Thraustochytrid) gene sequence as shown in SEQ ID NO.5, specifically:

[0264]

[0265] 6) C18 elongase (from Thraustochytrid) gene sequence as shown in SEQ ID NO.6, specifically:

[0266] ATGTCTAACTTTGGAGTTGGGAAAGCAAATCAGATTGCAGACCCGAAACTCCAGGTTAGCACAGGCGACTTTCTGTCGAATTTGTTGCAGGCACAGCAAGGAAGGATGGCAAACAGCAGCGTGTGGGATGATGTGGTGGGCCGCGTGGAGACCGGCGTGGACCAGTGGATGGATGGCGCCAAGCCGTACGCACTCACCGATGGGCTCCCGATGATGGATGTGTCGACCATGCTGGCATTCGAGGTGGGATACATGGCCATGCTGCTCTTCGGCATCCCGATCATGAAGCAGATGGAGAAGCCTTTTGAGCTCAAGACCATCAAGCTCTTGCACAACTTGTTTCTCTTCGGACTTTCCTTGTACATGTGCGTGGAGACCATCCGCCAGGCTATCCTCGGAGGCTACAAAGTGTTTGGAAACGACATGGAGAAGGGCACCGAGTCTCATGCTCAGGGCATGTCTCGCATCGTGTACGTGTTCTACGTGTCCAAGGCATACGAGTTCTTGGATACCGCCATCATGATCCTTTGCAAGAAGTTCAACCAGGTTTCCTTCTTGCACGTGTACCACCATGCCACCATTTTTGCCATCTGGTGGGCTATCGCCAAGTACGCTCCAGGAGGTGATGCGTACTTTTCAGTGATCCTCAACTCTTTCGTGCACACCGTCATGTACGCATACTACTTCTTCTCCTCCCAAGGGTTCGGATTCGTGAAGCCAATCAAGCCGTACATCACCACCCTTCAGATGACCCAGTTCATGGCAATGCTTGTGCAGTCCTTGTACGACTACCTCTTCCCATGCGACTACCCACAGGCTCTTGTGCAGCTTCTCGGAGTGTACATGATCACCTTGCTTGCCCTCTTCGGCAACTTTTTTGTGCAGAGCTATCTTAAAAAGCCAAAAAAGAGCAAGACCAACTAA

[0267] 7) The gene sequence of the C18 elongase (from Thraustochytrium) is shown in SEQ ID NO.7, specifically:

[0268] ATGTCTAACTTTGGAGTTGGGAAAGCAAATCAGATTGCAGACCCGAAACTCCAGGTTAGCACAGGCGACTTTCTGTCGAATTTGTTGCAGGCACAGCAAGGAAGGATGGCAAACAGCAGCGTGTGGGATGATGTGGTGGGCCGCGTGGAGACCGGCGTGGACCAGTGGATGGATGGCGCCAAGCCGTACGCACTCACCGATGGGCTCCCGATGATGGATGTGTCGACCATGCTGGCATTCGAGGTGGGATACATGGCCATGCTGCTCTTCGGCATCCCGATCATGAAGCAGATGGAGAAGCCTTTTGAGCTCAAGACCATCAAGCTCTTGCACAACTTGTTTCTCTTCGGACTTTCCTTGTACATGTGCGTGGAGACCATCCGCCAGGCTATCCTCGGAGGCTACAAAGTGTTTGGAAACGACATGGAGAAGGGCACCGAGTCTCATGCTCAGGGCATGTCTCGCATCGTGTACGTGTTCTACGTGTCCAAGGCATACGAGTTCTTGGATACCGCCATCATGATCCTTTGCAAGAAGTTCAACCAGGTTTCCTTCTTGCACGTGTACCACCATGCCACCATTTTTGCCATCTGGTGGGCTATCGCCAAGTACGCTCCAGGAGGTGATGCGTACTTTTCAGTGATCCTCAACTCTTTCGTGCACACCGTCATGTACGCATACTACTTCTTCTCCTCCCAAGGGTTCGGATTCGTGAAGCCAATCAAGCCGTACATCACCACCCTTCAGATGACCCAGTTCATGGCAATGCTTGTGCAGTCCTTGTACGACTACCTCTTCCCATGCGACTACCCACAGGCTCTTGTGCAGCTTCTCGGAGTGTACATGATCACCTTGCTTGCCCTCTTCGGCAACTTTTTTGTGCAGAGCTATCTTAAAAAGCCAAAAAAGAGCAAGACCAACTAA

[0269] 8) The gene sequence of Δ5 desaturase (from Thraustochytrium) is shown in SEQ ID NO.8, specifically as follows:

[0270]

[0271] 9) The Δ17 desaturase gene sequence (from Thraustochytrid) is shown in SEQ ID NO.9, specifically:

[0272]

[0273] 10) The gene sequence of Δ17 desaturase (from Saprolegnia sp.) is shown in SEQ ID NO. 10, specifically:

[0274]

[0275] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. An engineered strain of Schizochytrium that produces EPA via an extended desaturation pathway, characterized in that: The engineered strain is obtained by using Schizochytrium as a chassis strain and expressing part or all of the elongation desaturase genes from Thraustochytrium, Fusarium and Saprolegnia.

2. The engineered strain of Schizochytrium according to claim 1, characterized in that: The Schizochytrium sp. is HX-308, and its deposit number is CCTCC No. M209059; Alternatively, the thraustochytrium is Parietichytrium sp, the fusarium is Fusarium musae, and the water mold is Saprolegnia diclina.

3. The engineered strain of Schizochytrium according to claim 1, characterized in that: The elongation desaturase genes include carbon 16 elongase (C16EL), Δ9 desaturase (Δ9DE), Δ12 desaturase (Δ12DE), Δ6 desaturase (Δ6DE), C18 elongase (C18EL), Δ5 desaturase (Δ5DE), and Δ17 desaturase (Δ17DE).

4. The engineered strain of Schizochytrium according to claim 3, characterized in that: Among the elongated desaturases, the carbon 16 elongase (PaC16EL), Δ9 desaturase (PaΔ9DE), Δ6 desaturase (PaΔ6DE), C18 elongase (PaC18EL), and Δ5 desaturase (PaΔ5DE) are all from thraustochytrid, and the Δ12 desaturase and Δ17 desaturase are from multiple bacteria, among which the Δ12 desaturase includes two types from thraustochytrid (PaΔ12DE) and Fusarium (FmΔ12DE), respectively, and the Δ17 desaturase includes two types from thraustochytrid (PaΔ17DE) and Saprolegnia (SdΔ12DE), respectively.

5. The engineered strain of Schizochytrium according to claim 3 or 4, characterized in that: The carbon 16 elongase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.1; the Δ9 desaturase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.2; the Δ12 desaturase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.3; the Δ12 desaturase is from Fusarium, and its gene sequence is shown in SEQ ID NO.4; the Δ6 desaturase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.5; the C18 elongase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.6; the C18 elongase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.7; the Δ5 desaturase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.8; the Δ17 desaturase is from Thraustochytrium, and its gene sequence is shown in SEQ ID NO.9; the Δ17 desaturase is from Saprolegnia, and its gene sequence is shown in SEQ ID NO.

10.

6. Use of the engineered Schizochytrium strain according to any one of claims 1 to 5 in producing EPA.

7. The method for constructing an engineered strain of Schizochytrium according to any one of claims 1 to 5, characterized in that: The steps include: Construction of S1 recombinant plasmid pZPK-PaC16EL-F2A-PaΔ9DE-2520 The plasmid pZPK-NeoR-2520 was used as a backbone, and the C16EL and Δ9DE genes were inserted into the backbone, and F2A was used as a connecting peptide in the middle to obtain the recombinant plasmid pZPK-PaC16EL-F2A-PaΔ9DE-2520; Construction of S2 recombinant plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520 The plasmid pZPK-NrsR-2520 was used as the backbone, and the PaΔ12DE / FmΔ12DE and PaΔ6DE genes were inserted into the backbone, and P2A was used as the connecting peptide in the middle to obtain the recombinant plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ5DE-2520; Construction of S3 recombinant plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL The plasmid pZPK-BleoR-2520 is used as a backbone, and the PaΔ5DE and PaΔ17DE / SdΔ17DE genes are inserted into the backbone, and P2A is used as a connecting peptide in the middle to connect them. At the same time, the PaC18EL gene is inserted between another promoter and terminator, and the recombinant plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL can be obtained; Construction of an engineered Schizochytrium strain S4 expressing the gene for elongation supersaturase The recombinant plasmid pZPK-PaC16EL-F2A-PaΔ9DE-2520 was introduced into Schizochytrium sp.HX-308 to obtain recombinant bacteria 1; the recombinant plasmid pZPK-PaΔ12DE / FmΔ12DE-P2A-PaΔ6DE-2520 was introduced into recombinant bacteria 1 to obtain recombinant bacteria 2; the recombinant plasmid pZPK-PaΔ5DE-P2A-PaΔ17DE / SdΔ17DE-2520-PaC18EL was introduced into recombinant strain 2 to obtain the Schizochytrium expressing the extended desaturase gene.

8. The construction method according to claim 7, characterized in that: During the strain construction, the promoter of each elongation desaturase gene expression cassette was P 2520 The promoter and terminator are T CYC1t terminator; Alternatively, in step S4, the introduction is achieved by an electroporation transformation method.

9. A method for producing EPA by fermentation using the engineered Schizochytrium strain according to any one of claims 1 to 5, characterized in that: The steps include: During the fermentation process of producing EPA by the engineered Schizochytrium strain, shaking culture is adopted, the temperature is 24-30°C, the fermentation time is 72-120h, the shaking speed is 150-200rpm, and the glucose concentration in the fermentation medium is 80-100g / L.

10. The method according to claim 9, characterized in that: Here are the steps: S1 activated Schizochytrium engineered strain The engineered strain of Schizochytrium was inoculated into the seed culture medium, and cultured in a shaking incubator at 28°C and 180 r / min for 24 hours to obtain a first-level seed culture solution; the first-level seed culture solution was inoculated into a new seed culture medium at a ratio of 5%, and cultured in a shaking incubator at 28°C and 180 r / min for 24 hours to obtain a second-level seed culture solution; The secondary seed culture solution was inoculated into the new seed culture medium at a ratio of 5%, and cultured in a shaking incubator at 28°C and 180 rpm for 24 hours to obtain the tertiary seed culture solution; Fermentation culture of S2 recombinant bacteria 3 Each time 10 mL of the third-level seed culture solution was taken, it was inoculated into 90 mL of the fermentation medium, and cultured in a shaking incubator at 28°C and 180 r / min for 120 h to obtain the fermentation solution; Analysis of S3 fermentation products After the fermentation is finished, NaOH is added to the fermentation broth to adjust the pH to 10-13, a wall-breaking enzyme with a final mass concentration of 0.01-0.2% is added, and the mixture is shaken at 50° C. and 150 r / min for 10-15 hours; after the shaking is finished, the mixture is cooled to room temperature, and anhydrous ethanol with an equal volume to the fermentation broth is added to inactivate the enzyme and precipitate the protein; then n-hexane with an equal volume to the fermentation broth is added for extraction, and the upper organic phase is collected; the extraction is repeated until the organic phase becomes colorless; The organic phase is evaporated by rotary evaporation to obtain the total oil; Among them, the plate culture medium: pH value is 6.5, the ingredients include: agar 15g / L, glucose 60g / L, yeast extract powder 10g / L, sodium sulfate 10g / L, magnesium sulfate 4g / L, ammonium sulfate 8g / L, potassium chloride 2g / L, calcium chloride 0.1g / L, potassium sulfate 0.5g / L, potassium dihydrogen phosphate 2g / L, sodium glutamate 8g / L, zinc sulfate heptahydrate 4mg / L, cobalt dichloride hexahydrate 0.01mg / L, copper sulfate pentahydrate 2mg / L, nickel sulfate hexahydrate 2mg / L, ferrous sulfate heptahydrate 10mg / L, calcium pantothenate 4mg / L, manganese chloride tetrahydrate 5mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B6 6mg / L, vitamin B12 1.3mg / L, the solvent is water; Seed culture medium: pH is 6.

6. The ingredients include: glucose 50g / L, yeast extract powder 5g / L, sodium sulfate 5g / L, magnesium sulfate 2g / L, ammonium sulfate 6g / L, potassium chloride 1g / L, calcium chloride 0.1g / L, potassium sulfate 0.6g / L, potassium dihydrogen phosphate 1g / L, monosodium glutamate 10g / L, 0.1% trace minerals, vitamin B65mg / L and vitamin B12 0.5mg / L. The solvent is water. Fermentation medium: pH to 7.0, ingredients include: glucose 80g / L, yeast extract 10g / L, sodium sulfate 10g / L, magnesium sulfate 2g / L, ammonium sulfate 6g / L, potassium chloride 1g / L, calcium chloride 0.1g / L, potassium sulfate 0.6g / L, potassium dihydrogen phosphate 1g / L, sodium glutamate 20g / L, zinc sulfate heptahydrate 3mg / L, cobalt dichloride hexahydrate 0.05mg / L, copper sulfate pentahydrate 4mg / L, nickel sulfate hexahydrate 1.5mg / L, ferrous sulfate heptahydrate 10mg / L, calcium pantothenate 3mg / L, manganese chloride tetrahydrate 4mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B6 5mg / L and vitamin B 12 0.5mg / L, the solvent is water.

Images