Application of ginsenoside Re carbon nanodots in preparation of pharmaceutical preparation for inhibiting kidney cancer and / or kidney cancer A498 cells

Abstract

The invention provides application of ginsenoside Re carbon nanodots in the field of preparation of pharmaceutical preparations for resisting kidney cancer and / or inhibiting kidney cancer A498 cells. The ginsenoside Re carbon nanodots (Re-CDs) prepared by the invention have the characteristics of uniform particle size distribution, good water solubility, low biotoxicity, high cell membrane permeability and the like, also have good time, pH value and salt stability, and particularly have a relatively high inhibition effect on kidney cancer A498 cells and kidney cancer, whether in vitro or in vivo. Through transcriptomics detection, qPCR (quantitative polymerase chain reaction) verification, immunofluorescence detection and Western blot methods, a molecular mechanism of the Re-CDs anti-A498 cell is disclosed on the cellular level. The result shows that the Re-CDs can promote the cycle arrest and apoptosis of the A498 cells through the PI3K / AKT signal channel. The invention provides a new research strategy for anti-kidney cancer treatment based on CDs nano medicine in the future.

Description

Technical Field

[0001] The present invention relates to the technical field of ginsenoside Re carbon nanodots, and in particular to application of ginsenoside Re carbon nanodots in preparing a pharmaceutical preparation for inhibiting renal cancer and / or inhibiting renal cancer A498 cells. Background Art

[0002] With the rapid development of modern medical technology, the survival rate of many cancer patients has improved. However, cancer is still a huge challenge to the health of the world's human beings. Among reproductive system cancers, kidney tumors account for a large proportion, and more than 90% of kidney tumors are renal cell carcinomas. Due to the low sensitivity of renal cancer to chemotherapy drugs, in addition to resection surgery, immunotherapy such as PD-1 antibodies can prevent the proliferation and spread of renal tumors. However, due to the complex interactions in the tumor microenvironment, immunotherapy often causes strong side effects and even diseases such as immune encephalitis. Therefore, the use of immunotherapy drugs is also a major challenge in the treatment of renal cancer. Based on this, there is an urgent need to develop less toxic and efficient renal cancer treatment drugs. Improve patients' clinical treatment experience, compliance and treatment effect, and prolong patients' survival.

[0003] Many natural herbs and their extracts (including various ginsenosides) have high medicinal value due to their high bioactivity and long-term extremely low biotoxicity. However, due to their structure and low water solubility, many natural drugs have low cellular uptake rates. This bioavailability prevents them from fully exerting their medicinal effects, greatly limiting their clinical applications. In the field of nanomedicine technology, a large number of studies have confirmed that nanomedicines can be absorbed by cells in large quantities through endocytosis due to their unique size and changeable surface properties. Therefore, the development and innovation of appropriate low-biotoxicity nanodrug delivery systems will greatly improve the bioavailability of many natural drugs and their extracts and help them exert the best therapeutic effects. Among many nanodrug delivery systems, carbon nanodots (CDs) have high drug delivery potential because they have a variety of precursor types, extremely low biotoxicity, uniform size distribution, good water solubility, and designable bioactivity. In recent years, some studies have found that CDs prepared from precursors with certain bioactivity can have the advantages of both the partial active structure of the original precursor and its own nanostructure. For example, Li et al. used fresh young ginger juice as a precursor. The obtained ginger CDs had low toxicity to normal cells and had a selective inhibitory effect on human liver cancer cells HepG2. The results showed that ginger CDs could upregulate p53 protein and induce the production of intracellular ROS, thereby playing a therapeutic role in promoting apoptosis of tumor cells. Tian et al. prepared CDs under hydrothermal conditions using three pentacyclic triterpenoids (PTs) including glycyrrhetinic acid (GA), ursolic acid (UA) and oleanolic acid (OA) as precursors. The obtained CDs had an anti-human colon cancer cell HCT116 effect through mitochondrial targeting function. Jiang et al. prepared GS-CDs using total ginsenosides as precursors. The results showed that GS-CDs had extremely low toxicity and animal side effects and had a good inhibitory effect on human neuroblastoma cells and human neuroblastoma. More and more natural drug-based CDs nanomedicines are being developed, and these drugs show good application prospects in cancer treatment. Compared with their raw materials, these CDs showed more significant anticancer effects. The mechanisms of inducing cell death (apoptosis, ferroptosis and autophagy) are generally similar to those of the raw materials. However, due to the large number of cancer types in clinical treatment, rapid tumor deterioration and metastasis, and strong drug toxicity and side effects, it is still necessary to continue exploring new carbon dot drugs with good therapeutic effects to meet actual needs.

[0004] Therefore, how to further study the role of ginseng in the above aspects and solve the technical problems existing in the above-mentioned prior arts has become one of the focuses of widespread attention of many forward-looking researchers. Summary of the invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide the application of ginsenoside Re carbon nanodots in the field of pharmaceutical preparations for preventing and / or inhibiting renal cancer A498 cells. The ginsenoside Re carbon nanodots provided by the present invention are active against renal cancer and / or inhibiting renal cancer A498 cells, have the advantages of high biocompatibility, small size, good water solubility, medicinal activity, etc., and have good fluorescence stability over time, pH and salt, and can be used as an effective medicinal agent.

[0006] The present invention provides the use of ginsenoside Re carbon nanodots in the preparation of a pharmaceutical preparation for inhibiting renal cancer and / or inhibiting renal cancer A498 cells.

[0007] Preferably, the diameter of the ginsenoside Re carbon nanodots is 1 to 10 nm;

[0008] The surface of the ginsenoside Re carbon nanodots contains hydroxyl groups and / or carbonyl groups.

[0009] Preferably, the inhibition is specifically inhibition through the PI3K / AKT signaling pathway.

[0010] Preferably, the ginsenoside Re carbon nanodots are stable;

[0011] The ginsenoside Re carbon dots have a specific inhibitory effect on renal cancer and / or renal cancer A498 cells.

[0012] Preferably, the stability includes one or more of fluorescence stability, ultraviolet irradiation stability, sunlight stability, acid-base stability, and stability in NaCl and / or KCl solution;

[0013] The concentration of the NaCl and / or KCl solution is 0.2-2 mol / L.

[0014] Preferably, the method for preparing ginsenoside Re carbon nanodots comprises the following steps:

[0015] 1) mixing ginsenoside Re and water to obtain a mixed solution;

[0016] 2) The mixed solution obtained in the above step is subjected to a hydrothermal reaction to obtain a ginsenoside Re carbon dot aqueous solution.

[0017] Preferably, the concentration of ginsenoside Re in the mixed solution is 0.1 to 10 mg / mL;

[0018] The ginsenoside Re carbon dot aqueous solution is a transparent liquid with a Chinese medicine flavor.

[0019] Preferably, the temperature of the hydrothermal reaction is 90 to 220°C;

[0020] The hydrothermal reaction time is 0.5 to 12 hours;

[0021] The method further comprises a filtering step after the hydrothermal reaction.

[0022] Preferably, the pharmaceutical preparation comprises ginsenoside Re carbon dots and pharmaceutically acceptable excipients;

[0023] The pharmaceutical preparation has a specific inhibitory effect on renal cancer and / or renal cancer A498 cells.

[0024] Preferably, the dosage form of the pharmaceutical preparation includes an oral preparation, an injection, a suppository, an inhalation, or a dosage form that can be directly applied to a tumor;

[0025] In the pharmaceutical preparation, the mass content of the ginsenoside Re carbon nanodots is 1% to 100%.

[0026] The present invention provides the application of ginsenoside Re carbon nanodots in the field of preparing pharmaceutical preparations for resisting renal cancer and / or inhibiting renal cancer A498 cells. Compared with the prior art, the present invention believes that phosphatidylinositol 3-kinase / protein kinase B (PI3K / AKT) is one of the highly conserved signal transduction pathways in eukaryotic cells and one of the most common dysregulated pathways in cancer. The PI3K / AKT signaling pathway has an abnormal regulatory effect in a variety of malignant tumors, thereby promoting tumor cell proliferation and angiogenesis, inhibiting tumor cell apoptosis, and is closely related to tumor invasion and metastasis. Inhibition of the PI3K / AKT signaling pathway triggers and accelerates cell cycle arrest and apoptosis of cancer cells, effectively inhibiting the development of cancer. Therefore, inhibiting the PI3K / AKT signaling pathway is an effective research direction for treating tumors.

[0027] The present invention creatively obtains the application of ginsenoside Re carbon nanodots in the field of preparing pharmaceutical preparations for resisting renal cancer and / or inhibiting renal cancer A498 cells. The surface of the ginsenoside Re carbon dots is rich in a large number of structures such as hydroxyl groups and carbonyl groups, and the surface groups are rich, which is beneficial to its subsequent modification and compounding, and also has good time, pH value and salt stability; and cell activity experiments prove that the ginsenoside Re carbon dots have a specific inhibitory effect on renal cancer and / or inhibiting renal cancer A498 cells.

[0028] The present invention uses ginsenoside (a natural plant active monomer) as the only precursor and adopts a hydrothermal method to synthesize a new Re-carbon nanodot (Re-CDs), which combines the biomedical activity of ginsenoside Re and the advantages of carbon nanodots (C-dots) such as high biocompatibility, small size, good water solubility, and medicinal activity. The Re-CDs prepared by the present invention have the characteristics of uniform particle size distribution, good water solubility, low biological toxicity, and high cell membrane permeability, and have a high inhibitory effect on renal cancer A498 cells and renal cancer, both in vitro and in vivo. The molecular mechanism of Re-CDs against A498 cells was revealed at the cellular level by transcriptomics detection, qPCR verification, immunofluorescence detection, and Western blot (WB) methods. The results showed that Re-CDs promoted the cycle arrest and apoptosis of A498 cells through the PI3K / AKT signaling pathway. The present invention provides a new research strategy for future anti-renal cancer treatment based on CDs nanomedicine.

[0029] The Re carbon nanodots prepared by the present invention using Chinese herbal medicine extracts as raw materials have the advantages of narrow particle size distribution, good water solubility, high cell membrane permeability, etc., and have a high inhibitory effect on renal cancer A498 cells and renal cancer in particular. Re carbon nanodots can stimulate the production of a large amount of ROS, induce mitochondrial dysfunction, and accelerate the release of calcium ions in A498 cells. Transcriptomics detection was performed on A498 cells after administration, and verification and analysis were performed by qPCR, immunofluorescence and WB.

[0030] The experimental results showed that Re carbon nanodots can downregulate the abnormally activated PI3K / AKT signaling pathway, arrest the cell cycle at the S phase, inhibit cell proliferation, and combine with abnormal mitochondrial function to ultimately promote apoptosis of A498 cells. In vivo tumor-bearing mouse experiments further showed that Re carbon nanodots have a strong inhibitory effect on xenografted renal cancer tumors, and the prepared Re carbon nanodots have good anti-renal cancer A498 cells and renal cell carcinoma biological activity, with low toxicity and high safety, and are expected to become a potential drug for the treatment of renal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 A schematic diagram of the synthesis route of Re-CDs provided by the present invention and its biological activity and mechanism against renal cancer A498 cells and renal cell carcinoma;

[0032] Figure 2 The present invention is related to the characterization of Re-CDs;

[0033] Figure 3 The effects of Re-CDs prepared by the present invention on cells in vitro;

[0034] Figure 4Effects of Re-CDs prepared in the present invention on proliferation, migration, cell cycle and apoptosis of A498 cells;

[0035] Figure 5 The Re-CDs prepared in the present invention have an effect on the levels of ROS, MMP and Ca in A498 cells. 2+ Effect of concentration;

[0036] Figure 6 The present invention detected the expression of related genes in A498 cells after Re-CDs administration by transcriptomics and qPCR verification (n=3);

[0037] Figure 7 The present invention uses immunofluorescence detection and WB analysis to evaluate the changes in the expression levels of related proteins in A498 cells after Re-CDs administration;

[0038] Figure 8 The in vivo anti-renal cell carcinoma activity of Re-CDs prepared in the present invention (n=5). DETAILED DESCRIPTION

[0039] In order to further understand the present invention, the preferred embodiments of the present invention are described below in conjunction with examples, but it should be understood that these descriptions are only for further illustrating the features and advantages of the present invention, rather than for limiting the claims of the invention. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all deemed to be included in the present invention. The methods and applications of the present invention have been described by preferred embodiments, and relevant personnel can obviously change or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.

[0040] All raw materials of the present invention have no particular restrictions on their sources, and can be purchased from the market or prepared according to conventional methods known to those skilled in the art. In the present invention, all raw materials are in vitro raw materials.

[0041] There is no particular limitation on the purity of all raw materials in the present invention. The present invention preferably uses analytically pure materials or materials that meet the medical purity standard or the standard in the field of ginseng carbon nanodot preparation.

[0042] The brands and abbreviations of all raw materials of the present invention are conventional brands and abbreviations in the art. Each brand and abbreviation is clear and definite in the field of its related use. Those skilled in the art can purchase them from the market or prepare them by conventional methods according to the brands, abbreviations and corresponding uses.

[0043] The present invention provides the use of ginsenoside Re carbon nanodots in the preparation of a pharmaceutical preparation for inhibiting renal cancer and / or inhibiting renal cancer A498 cells.

[0044] In the present invention, the diameter of the ginsenoside Re carbon nanodots is preferably 1 to 10 nm, more preferably 3 to 8 nm, and more preferably 5 to 6 nm.

[0045] In the present invention, the surface of the ginsenoside Re carbon nanodots preferably contains hydroxyl groups and / or carbonyl groups, more preferably hydroxyl groups and carbonyl groups.

[0046] In the present invention, the inhibition is preferably performed through the PI3K / AKT signaling pathway.

[0047] In the present invention, the ginsenoside Re carbon nanodots preferably have stability.

[0048] In the present invention, the ginsenoside Re carbon dots preferably have a specific inhibitory effect on renal cancer and / or renal cancer A498 cells, and more preferably have a specific inhibitory effect on renal cancer and renal cancer A498 cells.

[0049] In the present invention, the stability preferably includes one or more of fluorescence stability, ultraviolet irradiation stability, sunlight stability, acid-base stability and stability in NaCl and / or KCl solution, and more preferably fluorescence stability, ultraviolet irradiation stability, sunlight stability, acid-base stability and stability in NaCl or KCl solution.

[0050] In the present invention, the concentration of the NaCl and / or KCl solution is preferably 0.2 to 2 mol / L, more preferably 0.6 to 1.6 mol / L, and more preferably 1.0 to 1.2 mol / L.

[0051] In the present invention, the method for preparing ginsenoside Re carbon nanodots preferably comprises the following steps:

[0052] 1) mixing ginsenoside Re and water to obtain a mixed solution;

[0053] 2) The mixed solution obtained in the above step is subjected to a hydrothermal reaction to obtain a ginsenoside Re carbon dot aqueous solution.

[0054] The present invention firstly mixes ginsenoside Re and water to obtain a mixed solution.

[0055] In the present invention, the concentration of ginsenoside Re in the mixed solution is preferably 0.1 to 10 mg / mL, more preferably 2 to 8 mg / mL, and more preferably 4 to 6 mg / mL.

[0056] In the present invention, the ginsenoside Re carbon dot aqueous solution is preferably a transparent liquid with a Chinese medicine flavor.

[0057] In the present invention, the mixed solution obtained in the above steps is subjected to a hydrothermal reaction to obtain a ginsenoside Re carbon dot aqueous solution.

[0058] In the present invention, the temperature of the hydrothermal reaction is preferably 90 to 220°C, more preferably 120 to 190°C, and even more preferably 150 to 160°C.

[0059] In the present invention, the hydrothermal reaction time is preferably 0.5 to 12 h, more preferably 2 to 10 h, and more preferably 4 to 8 h.

[0060] In the present invention, the hydrothermal reaction preferably further includes a filtration step.

[0061] In the present invention, the pharmaceutical preparation preferably includes ginsenoside Re carbon dots and pharmaceutically acceptable excipients.

[0062] In the present invention, the pharmaceutical preparation preferably has a specific inhibitory effect on renal cancer and / or renal cancer A498 cells, and more preferably has a specific inhibitory effect on renal cancer or renal cancer A498 cells.

[0063] In the present invention, the dosage form of the pharmaceutical preparation preferably includes an oral preparation, an injection, a suppository, an inhalation, or a dosage form that can be directly applied to a tumor;

[0064] In the present invention, in the pharmaceutical preparation, the mass content of the ginsenoside Re carbon nanodots is preferably 1% to 100%, more preferably 20% to 80%, and more preferably 40% to 60%.

[0065] See also Figure 1 , Figure 1 The present invention provides a schematic diagram of the synthesis route of Re-CDs and their biological activity and mechanism against renal cancer A498 cells and renal cell carcinoma.

[0066] The above content of the present invention provides the use of ginsenoside Re carbon nanodots in the preparation of a pharmaceutical preparation for inhibiting renal cancer and / or inhibiting renal cancer A498 cells. The surface of the ginsenoside Re carbon dot is rich in a large number of structures such as hydroxyl groups and carbonyl groups, and the surface groups are rich, which is beneficial to its subsequent modification and compounding, and also has good time, pH value and salt stability; and cell activity experiments prove that the ginsenoside Re carbon dot has a specific inhibitory effect on specific cells.

[0067] The present invention uses ginsenoside (a natural plant active monomer) as the only precursor and adopts a hydrothermal method to synthesize a new Re-carbon nanodot (Re-CDs), which combines the biomedical activity of ginsenoside Re and the advantages of carbon nanodots (C-dots) such as high biocompatibility, small size, good water solubility, and medicinal activity. The Re-CDs prepared by the present invention have the characteristics of uniform particle size distribution, good water solubility, low biological toxicity, and high cell membrane permeability, and have a high inhibitory effect on renal cancer A498 cells and renal cancer, both in vitro and in vivo. The molecular mechanism of Re-CDs against A498 cells was revealed at the cellular level by transcriptomics detection, qPCR verification, immunofluorescence detection, and Western blot (WB) methods. The results showed that Re-CDs promoted the cycle arrest and apoptosis of A498 cells through the PI3K / AKT signaling pathway. The present invention provides a new research strategy for future anti-renal cancer treatment based on CDs nanomedicine.

[0068] The Re carbon nanodots prepared by the present invention using Chinese herbal medicine extracts as raw materials have the advantages of narrow particle size distribution, good water solubility, high cell membrane permeability, etc., and have a high inhibitory effect on renal cancer A498 cells and renal cancer in particular. Re carbon nanodots can stimulate the production of a large amount of ROS, induce mitochondrial dysfunction, and accelerate the release of calcium ions in A498 cells. Transcriptomics detection was performed on A498 cells after administration, and verification and analysis were performed by qPCR, immunofluorescence and WB.

[0069] The present invention adopts a hydrothermal method to prepare a new type of high-efficiency and low-toxic Re-CDs. The particle size distribution of Re-CDs is uniform, concentrated in 1-4nm. Re-CDs can use their nanostructure characteristics and rich surface functional groups to enter cells in large quantities through endocytosis. Re-CDs show good cell membrane permeability and significantly inhibit the proliferation and migration ability of renal cancer A498 cells. Re-CDs entering A498 cells can significantly increase the production of intracellular ROS. Excessive ROS can induce mitochondrial dysfunction, Ca 2+Release, as well as downregulation of the abnormally regulated PI3K / AKT signaling pathway in tumor cells. Mitochondrial dysfunction and increased intracellular Ca2+ concentrations further lead to increased intracellular ROS levels and inhibition of the PI3K / AKT signaling pathway. In addition, downregulation of the PI3K / AKT signaling pathway upregulates the expression level of downstream p21 protein, inhibits the formation of the CDK2-CCNA2 complex, causes cell cycle arrest in the S phase, inhibits cell proliferation, and combines with mitochondrial dysfunction to promote A498 cell apoptosis. Under the same conditions, Re-CDs have lower toxicity to normal cells. This is because the excessive proliferation of tumor cells depends on the abnormal regulation of the PI3K / AKT signaling pathway. In normal cells, the PI3K / AKT signaling pathway is not abnormally activated. Therefore, while achieving inhibition of tumor cells, Re-CDs have a lower toxic effect on normal cells.

[0070] The results of in vivo experiments in mice showed that Re carbon nanodots can downregulate the abnormally activated PI3K / AKT signaling pathway, arrest the cell cycle at the S phase, inhibit cell proliferation, and combine with abnormal mitochondrial function to ultimately promote the apoptosis of A498 cells, and can significantly inhibit the proliferation of renal cell carcinoma. The tumor growth trend, tumor volume, and tumor mass of mice in the Re-CDs group were significantly smaller than those in the model group. At the same time, Re-CDs showed low toxicity and low side effects, as well as good biosafety. Re-CDs can be used as a new type of low-toxic, high-efficiency potential nanomedicine for the treatment of renal cancer. It is expected to provide new research strategies for the clinical treatment of renal cancer in the future.

[0071] To further illustrate the present invention, the application of ginsenoside Re carbon nanodots provided by the present invention in the field of preparing pharmaceutical preparations for resisting renal cancer and / or inhibiting renal cancer A498 cells is described in detail below in combination with the examples. However, it should be understood that these examples are implemented on the premise of the technical scheme of the present invention, and detailed implementation methods and specific operating procedures are given only to further illustrate the features and advantages of the present invention, rather than to limit the claims of the present invention, and the protection scope of the present invention is not limited to the following examples.

[0072] Example 1

[0073] Synthesis and related detection experiments of ginsenoside Re carbon nanodots Re-CDs

[0074] Weigh 20.00 mg of ginsenoside Re and place it in a PTFE reactor. Add 10.00 mL of distilled water to the reactor and react at 180°C for 6 hours. After the reaction is completed, filter the solution through a 0.22 μm microporous membrane to remove large insoluble substances. Place the filtered solution in a 3500 MW ultrafiltration tube and centrifuge once at 4°C (5000 rpm, 5 min). Obtain the Re-CDs solution and store it in a refrigerator at 4°C.

[0075] Hemolysis test

[0076] Re-CDs solutions of different concentrations (50, 100, 200, 300, 400 and 500 μg / mL), saline (negative control, NC) and water (positive control, PC) were incubated with mouse erythrocytes at 37°C for 2 h. The supernatant of each solution was taken and the absorbance at 545 nm was measured.

[0077] The hemolysis rate was calculated according to the following formula:

[0078] Hemolysis ratio (%) = (A sample -A NC ) / (A PC -A NC )×100%

[0079] Cellular uptake

[0080] At 37°C, 2 × 10 4 A498 cells / well were cultured in a 24-well plate for 12 hours, and different concentrations of Re-CDs solution were added. A498 cells were co-incubated with Re-CDs solution at 37°C (0, 1, 2, 4, 6, 8, 12, 24, 36 and 48 hours) and 4°C (6 hours). The slides were then fixed with 4% paraformaldehyde for 30 minutes, stained with DAPI for 2 minutes, and then placed under a fluorescent inverted microscope and photographed for observation.

[0081] Cell scratch assay

[0082] 3×10 5 A498 cells at 100 μg / well were cultured in a 6-well plate for 12 h, and scratches were made with a 200 μL tip. The original culture medium was discarded, and the cells were cultured in low serum MEM medium (2% FBS) containing different concentrations (0, 30, 50, 70 and 90 μg / mL) of Re-CDs for 24 h, and photographed under a microscope to record the wound healing of the cells.

[0083] Colony formation assay and cell migration assay

[0084] A498 cells were cultured in 6-well plates for 12 h and then incubated with different concentrations (0, 30, 50, 70, and 90 μg / mL) of Re-CDs for 48 h.

[0085] For cell cloning experiments, A498 cells were re-seeded in 6-well plates at 1 × 10 3 The cells were cultured for 2 weeks per well. Photos were taken using a camera.

[0086] For cell migration experiments, A498 cells were re-plated in the upper layer of transwell chambers at 1×10 5 600 μL of MEM medium containing 15% FBS was added to the lower layer of the transwell chamber and incubated for another 48 hours.

[0087] After the incubation, the cells were fixed with 4% paraformaldehyde for 30 min, stained with 0.1% crystal violet for 20 min, and photographed under a microscope.

[0088] ROS levels, MMP levels and Ca 2+ Concentration detection

[0089] A498 cells were plated in 6-well plates at 1 × 10 5 The cells were then incubated with different concentrations of Re-CDs (0, 30, 50, 70, and 90 μg / mL) for 48 hours. 2+ The samples were stained with the ELISA kit. They were then placed under a fluorescent inverted microscope and photographed. The average optical density was calculated using Image J.

[0090] Flow cytometry to detect cell apoptosis and cell cycle

[0091] A498 cells were plated in 6-well plates at 1 × 10 5 The cells were cultured for 12 hours and then incubated with different concentrations (0, 30, 50, 70 and 90 μg / mL) of Re-CDs for 48 hours.

[0092] For apoptosis experiments, the collected cells were stained with AV / PI using the BD apoptosis detection kit and incubated in the dark for 30 minutes before detection using a flow cytometer.

[0093] For cell cycle experiments, cells were suspended in pre-cooled 70% ethanol. Cells were fixed overnight at 4°C and stained with PI using a cell cycle kit. After incubation in the dark for 30 minutes, flow cytometry was used for detection.

[0094] Transcriptomic analysis

[0095] Untreated A498 cells were used as the control group, and A498 cells given Re-CDs (70 μg / mL) were used as the treated group (n=3). After incubation for 48 hours under the same conditions, the two groups of cells were lysed with Trizol reagent. Total RNA from each group was collected for transcriptome analysis. RNA sequencing and bioinformatics data processing were performed by Shanghai Paisono Biotechnology Co., Ltd.

[0096] qRT-PCR validation

[0097] Untreated A498 cells served as the control group, and A498 cells given Re-CDs (70 μg / mL) served as the treated group. After incubation for 48 h under the same conditions, total RNA of each group was extracted using Trizol reagent. Reverse transcription and quantitative real-time polymerase chain reaction were performed using a high-capacity reverse transcription kit and SYBR Green according to the instructions. All primers used for PCR are listed in Table 1.

[0098] Table 1 realtime-PCR primer sequences

[0099] Primer Species Quantitative RT-PCR primer GAPDH-Forward Human CTGGGCTACACTGAGCACC GAPDH-Reverse Human AAGTGGTCGTTGAGGGCAATG COL6A3-Forward Human CTGTTCCTCTTTGACGGCTCA COL6A3-Reverse Human CCTTGACATCATCGCTGTACTGA ITGA1-Forward Human CTGGACATAGTCATAGTGCTGGA ITGA1-Reverse Human ACCTGTGTCTGTTTAGGACCA ITGB6-Forward Human GAGGACTACCCGGTGGATTTG ITGB6-Reverse Human TCCTTTATTGTGTTGAGGTCGTC PIK3AP1-Forward Human TATTGTCCAATGCCGCGAATC PIK3AP1-Reverse Human CGGTTAGCAGTTTATCAAGGGT AKT3-Forward Human AATGGACAGAAGCTATCCAGGC AKT3-Reverse Human TGATGGGTTGTAGAGGCATCC CDKN1A-Forward Human CGATGGAACTTCGACTTTGTCA CDKN1A-Reverse Human GCACAAGGGTACAAGACAGTG CDK2-Forward Human CCAGGAGTTACTTCTATGCCTGA CDK2-Reverse Human TTCATCCAGGGGAGGTACAAC CCNA2-Forward Human GGATGGTAGTTTTGAGTCACCAC CCNA2-Reverse Human CACGAGGATAGCTCTCATACTGT

[0100] Immunofluorescence analysis

[0101] Re-CDs (90 μg / mL) were added to a 2×10 4 / well A498 cells were placed in a 24-well plate and incubated for 24 hours. The cells were fixed with 4% paraformaldehyde for 30 minutes. After permeabilizing the cell membrane with TritonX-100, 10% goat serum was added for blocking for 30 minutes. After blocking, primary and secondary antibodies were incubated in sequence. The cell nuclei were stained with DAPI and photographed under a fluorescence microscope. The results were obtained by calculating the average optical density using Image J.

[0102] Western Blot Analysis

[0103] Untreated A498 cells served as the control group, and A498 cells given Re-CDs (90 μg / mL) served as the treatment group. After incubation for 48 hours, the total protein of each group of cells was extracted. The protein concentration of each group was determined by the BCA method. Proteins were separated by SDS-PAGE and electrotransfer polyvinylidene fluoride (PVDF) membrane. The corresponding primary and secondary antibodies were incubated in sequence. After color development using the ECL luminescence kit, images of protein bands were obtained.

[0104] Anti-renal cell carcinoma activity of Re-CDs in vivo

[0105] Four-week-old male BALB / c nude mice were housed in a specific pathogen-free laboratory. All mice were randomly divided into 4 groups (n=5): control group, model group, 5-FU group, and Re-CDs group. 100 μL of A498 cells were added at 1×10 8 / mL concentration was inoculated into the right axilla of mice to establish a tumor-bearing mouse model. When the tumor volume of most mice reached 50-70mm 3 (Volume (mm 3 )=(length×width 2 ) / 2), treatment was started and set as day 0 of the experiment. Mice in the 5-FU group were administered 15 mg / kg (intraperitoneal injection) every 3 days. Mice in the Re-CDs group were treated with 10 mg / kg (tail vein injection) every day. Mice in the model group were given an equal volume of normal saline every day (tail vein injection). The body weight of each group of mice was recorded every 3 days. All mice were killed on the 15th day. The hearts, livers, spleens, lungs, and kidneys of mice in each group were collected for H&E staining analysis. Blood from mice was collected for analysis of blood routine and biochemical indicators.

[0106] H&E staining analysis

[0107] The heart, liver, spleen, lung and kidney of mice were fixed with 4% paraformaldehyde. After embedding and sectioning the tissues with paraffin, they were stained with hematoxylin and eosin staining solution. Staining photos were obtained under a microscope.

[0108] Routine blood test

[0109] The blood of each mouse was mixed in an anticoagulant tube, and the blood routine indexes were detected using a blood routine detector.

[0110] Biochemical marker detection

[0111] The serum of mice in the control group and Re-CDs group was collected. Biochemical indicators including alkaline phosphatase (AKP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), urea nitrogen (BUN), creatinine (CRE) and uric acid (UA) were detected according to the standard procedure of Nanjing Jiancheng Biochemical Detection Kit.

[0112] Statistical analysis

[0113] Statistical data are expressed as mean ± standard deviation (SD). Statistical analysis was performed using GraphPad Prism 10.0 software. T-test and one-way analysis of variance were used to analyze the differences between the data. For all experimental data (n ≥ 3), p < 0.05 was considered statistically significant.

[0114] Experimental results verification and analysis examples

[0115] Firstly, the properties and structures of the prepared Re-CDs were characterized and analyzed ( Figure 2 ).

[0116] See also Figure 2 , Figure 2 The relevant characterization of Re-CDs in the present invention. Among them, (A) photos of Re methanol solution (left) and Re-CDs aqueous solution (right) under normal light and ultraviolet light at 365nm. (B) Fluorescence spectrum of Re-CDs. (C) Fluorescence decay curve of Re-CDs. (D) TEM image and particle size distribution of Re-CDs (upper left corner). The scale bar is 20nm. (E) UV spectrum of Re in methanol and Re-CDs aqueous solution. (F) FTIR spectra of Re and Re-CDs. (G) XPS spectrum of Re-CDs, including high-resolution C1s (H) and O1s (I) spectra.

[0117] The solubility of Re monomer in water is poor, while the prepared Re-CDs have good solubility in water. Under normal light, the methanol solution of Re (500 μg / mL) is faintly transparent, and the Re-CDs aqueous solution (500 μg / mL) is transparent and light yellow. Under 365 nm ultraviolet light, the Re solution has almost no fluorescence emission, while the Re-CDs solution exhibits obvious blue-green fluorescence ( Figure 2 A).

[0118] Fluorescence spectra show that Re-CDs have obvious excitation-dependent properties. Their optimal excitation wavelength is ~360nm and their optimal emission wavelength is ~450nm ( Figure 2 B). According to the fluorescence decay curve of Re-CDs, a third-order decay exponential function was fitted and three fluorescence lifetimes (τ) were obtained. The results show that Re-CDs has three fluorescence centers with an average fluorescence lifetime of 1.49ns ( Figure 2 C). The quantum yield of Re-CD is ~3.6%. Transmission electron microscopy photos show that Re-CDs are uniform in size and have good dispersion. The diameter distribution is between 1 and 4 nm, mainly concentrated at ~2.5 nm. Selected area electron diffraction (SAED) shows that Re-CDs do not have obvious diffraction points and lattice structures ( Figure 2 D).

[0119] The UV spectrum shows that there is no obvious absorption peak in the Re solution. Although in the Re-CDs solution, two different absorption peaks appear at ~226nm and ~287nm ( Figure 2 E), due to π-π* and n-π* transitions, respectively. This is believed to be caused by the cross-linking enhanced emission (CEE) effect after the complete synthesis of Re-CDs. It also corresponds to the fluorescence behavior of Re-CDs. For Fourier transform infrared (FTIR) spectroscopy ( Figure 2 F), Re-CDs show many absorption peaks similar to those of Re molecules, including OH (3409 cm -1 )、CH(2942cm -1 )、C=C(1659cm -1 ) and CO(1046cm -1 ) stretching vibration.

[0120] In addition, compared with Re, Re-CDs at 1767 cm -1 A new absorption peak is shown at . This may be caused by the contraction vibration of C=O on the surface of Re-CDs. This indicates that in addition to retaining many active groups of Re, new hydrophilic functional groups also appear during the formation of Re-CDs. X-ray photoelectron spectroscopy (XPS) analysis shows that there are two main absorption peaks of Re-CDs, C and O ( Figure 2 G). The high-resolution C1s spectrum can be deconvoluted into three peaks, namely the C=C bond at 284.3 eV, the CO / COC bond at 285.7 eV, and the C=O band at 287.1 eV ( Figure 2 H). The high-resolution O1s spectrum can be deconvoluted into two peaks, one for the primary CO / COC bond at ~532.4 eV and the other for the C=O bond at ~531.8 eV ( Figure 2 I).

[0121] The results of FTIR and XPS spectra show that the synthesized Re-CDs retain a certain active structure of the raw materials, new hydrophilic groups appear on the surface, and have high water solubility.

[0122] In addition, the present invention also studies the stability of Re-CDs under ultraviolet irradiation, different pH values, different temperatures and different salt ion concentrations (NaCl and KCl). The results show that Re-CDs have good stability under these different conditions. This means that as a potential drug, Re-CDs has a good basis for use and storage applications.

[0123] See also Figure 3 , Figure 3Effects of Re-CDs prepared by the present invention on cells in vitro. Wherein, (A) Statistical graph of A498 cell viability under different concentrations of Re in DMSO. (B) Statistical graph of A498 cell viability under different concentrations of Re-CDs. (C) Statistical graph of LO2 cell viability under different concentrations of Re-CDs. (D) Hemolysis rate and image of mouse red blood cells after incubation with water (positive control, NC) (set to 100%), different concentrations (50, 100, 200, 300, 400 and 500 μg / mL) and normal saline (negative control, PC) at 37°C for 2 hours. (E) Fluorescence images of A498 cells after incubation with Re-CDs (100 μg / mL) for 0, 4, 6, 8, 12 and 48 hours, respectively. Scale bar is 200 μm. ***p<0.001, while 0 μg / mL.

[0124] The in vitro biological activity of Re-CDs was preliminarily studied. Figure 3 ).

[0125] Re dissolved in DMSO solutions of different concentrations (0, 30, 50, 70 and 90 μg / mL) had little inhibitory effect on A498 cells. Figure 3 A). Different concentrations (0, 30, 50, 70 and 90 μg / mL) of Re-CDs showed significant inhibitory activity on the proliferation of A498 cells in a dose-dependent manner ( Figure 3 B) When the highest administration concentration was 90 μg / mL, the viability of A498 cells was only ∼28.6±1.3%.

[0126] Under the same conditions, the inhibitory effect of Re-CDs on normal human hepatocytes (LO2) was much weaker ( Figure 3 C). At a concentration of 90 μg / mL, the viability of LO2 cells was ~85.9±3.5%. The morphological results under the microscope showed that with the increase of Re-CDs concentration, the morphological changes of A498 cells, such as shrinkage and fragmentation, became more obvious. It is similar to Figure 3 The cell inhibition trend in B.

[0127] In the hemolysis experiment, Re-CDs did not cause erythrocyte damage in mice over a wide concentration range (50-500 μg / mL). Figure 3 D). After incubation with 500 μg / mL Re-CDs, the hemolysis rate was only ~3.1%. This indicates that the prepared Re-CDs have good safety and are conducive to clinical application.

[0128] Using the fluorescence characteristics of Re-CDs, the process and pathway of Re-CDs entering A498 cells at different times and temperatures were observed by fluorescence microscopy. Figure 3E). It can be seen that Re-CDs are mainly concentrated in the cytoplasm after entering the cells. At 37°C, the intracellular fluorescence intensity gradually increased over time at the beginning of co-incubation (1-6 hours). The fluorescence intensity reached the highest at ~6h, indicating that A498 cells had absorbed a large amount of Re-CDs at this time. With the further extension of the incubation time (8-36h), the fluorescence intensity in the cells gradually decreased. It may be that after Re-CDs enter the cells, part of them react with cellular substances, causing their structure to be destroyed, and part of them are excreted from the cells through metabolism, resulting in a gradual decrease in the intracellular fluorescence intensity. At 48 hours, the intracellular fluorescence almost disappeared. This should be when the severely damaged A498 cells show almost stagnant physiological activities, such as intracellular material exchange and energy metabolism: extracellular Re-CDs no longer enter, and intracellular Re-CDs have been destroyed or eliminated by metabolism. At 4°C, after 6 hours of co-incubation with Re-CDs, A498 cells emit weak fluorescence. This may be because at low temperatures, physiological activities such as material exchange and energy metabolism in A498 cells are inhibited, resulting in a low uptake rate of fluorescent Re-CDs. In contrast, the physiological activity of A498 cells is normal at 37°C. Its uptake of Re-CDs is large, and the intracellular fluorescence intensity is high. Combined with previous reports on nanomedicine CDs, it further indicates that Re-CDs are mainly absorbed into A498 cells through endocytosis.

[0129] See also Figure 4 , Figure 4 Effects of Re-CDs prepared by the present invention on A498 cell proliferation, migration, cell cycle and apoptosis. Among them, (A) Colony formation image of A498 cells re-cultured for 2 weeks after incubation with different concentrations of Re-CDs for 48 hours. The scale bar is 1 cm. (B) Microscopic image of wound healing after A498 cells were incubated with different concentrations of Re-CDs for 24 hours. The scale bar is 800μm. (C) Microscopic image of cell migration after A498 cells were incubated with different concentrations of Re-CDs for 48 hours. The scale bar is 400μm. (D) Cycle arrest diagram of A498 cells after incubation with different concentrations of Re-CD for 48 hours. (E) Apoptosis diagram of A498 cells after incubation with different concentrations of Re-CD for 48 hours. (F) Corresponding statistical histogram of clone inhibition rate. (G) Corresponding statistical histogram of wound healing rate. (H) Statistical histogram of migration number. (I) Corresponding statistical graph of cell cycle arrest. (J) Corresponding statistical histogram of cell apoptosis. Compared with 0 μg / mL, *p<0.05, ***p<0.001.

[0130] The effects of Re-CDs on the proliferation and migration of A498 cells were investigated by cell colony assay and cell migration assay. Figure 4 ).

[0131] A498 cells were incubated with different concentrations of Re-CD for 48 hours. A498 cells were then cultured for another 2 weeks and their colony formation was observed ( Figure 4 A). Compared with the control group (Re-CDs, 0 μg / mL), the colony formation ability of A498 cells was significantly inhibited (p<0.001). When the administration concentration of Re-CD was 90 μg / mL, the colony formation ability of A498 cells decreased to ~24.9±6.4% ( Figure 4 F).

[0132] Cell scratch assay was performed to investigate the changes in the lateral migration ability of A498 cells after administration of drug ( Figure 4 B). After incubation with Re-CDs for 24 hours, the lateral migration ability of A498 cells was significantly inhibited in a dose-dependent manner ( Figure 4 B and Figure 4 G). Compared with the control group (Re-CDs, 0 μg / mL), the wound healing rate of A498 cells was ∼46.9±7.9% when Re-CDs were administered at a concentration of 90 μg / mL.

[0133] The cell migration assay was used to detect the changes in the longitudinal migration ability of A498 cells after drug administration ( Figure 4 C). Compared with the control group (Re-CDs, 0 μg / mL), the migration rate of A498 cells was only ∼14.7±0.6% when the concentration of Re-CDs was 90 μg / mL ( Figure 4 H). The results showed that after Re-CDs treatment (especially at a concentration of 90 μg / mL), the colony formation and migration abilities of A498 cells were significantly inhibited (p<0.001). The results of the cell cycle test showed that Re-CDs had a significant blocking effect on the cell cycle (S phase) of A498 cells ( Figure 4 D and Figure 4 I).

[0134] As the dosage concentration increased, the proportion of A498 cells in the S phase increased in a dose-dependent manner. Compared with the control group (Re-CDs, 0 μg / mL), the S phase arrest rate of A498 cells in the highest dosage group (Re-CDs, 90 μg / mL) was ~62.6±10.5% (p<0.001). The results of the apoptosis experiment showed that as the dosage concentration of Re-CDs increased, the total apoptosis rate of A498 cells (including early apoptosis and late apoptosis) gradually increased ( Figure 4 E and Figure 4 J). Compared with the control group (Re-CDs, 0 μg / mL), the total apoptosis rate of the highest dose group (Re-CDs, 90 μg / mL) reached ∼41.2±1.2% (p<0.001).

[0135] See also Figure 5 , Figure 5 The Re-CDs prepared in the present invention have an effect on the levels of ROS, MMP and Ca in A498 cells. 2+ Effect of concentration. Among them, (A) Fluorescence images of changes in ROS levels in A498 cells after co-incubation with different concentrations of Re-CDs for 48 hours using DCFH-DA as a fluorescent probe. (B) Fluorescence images of changes in MMP levels in A498 cells after co-incubation with different concentrations of Re-CDS for 48 hours using JC-1 as a fluorescent probe. When the mitochondrial membrane potential of the cell is low, JC-1 disperses as a monomer, exhibits green fluorescence and is labeled as a monomer. When the mitochondrial membrane potential of the cell is high, JC-1 aggregates, exhibits red fluorescence and is labeled as an aggregate. (C) Fluorescence images of changes in Ca2+ concentration in A498 cells after co-incubation with different concentrations of Re-CDs for 48 hours using Fluo-4-AM as a fluorescent probe. (D) Corresponding bar histogram of intracellular fluorescence intensity. (E) Corresponding s indicator histogram of intracellular fluorescence intensity. (F) Corresponding bar histogram of intracellular fluorescence intensity. Scale bar is 400μm. *p<0.05, **p<0.01 and p<0.001 compared with 0 μg / mL.

[0136] The molecular mechanism of cell cycle arrest and apoptosis induced by Re-CDs administration was preliminarily studied, and the reactive oxygen species (ROS), mitochondrial membrane potential (MMP) and Ca2+ expression in A498 cells were detected. 2+ The change of concentration ( Figure 5 ).

[0137] 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA) was used as a fluorescent probe to detect the ROS level in A498 cells after incubation with different concentrations (0, 30, 50, 70 and 90 μg / mL) for 48 h. Compared with the control group (Re-CDs, 0 μg / mL), the administration of Re-CDs led to a significant increase in the ROS level in A498 cells ( Figure 5 A and Figure 5 D). When the concentration of Re-CDs was 90 μg / mL, the intracellular fluorescence intensity increased more than 3 times (p<0.001).

[0138] Studies have shown that Re-CDs can accelerate the production of ROS in A498 cells and promote oxidative damage in cells. When cells are damaged by oxidative damage, it often leads to mitochondrial dysfunction. After incubation with different concentrations of Re-CDS (0, 30, 50, 70 and 90 μg / mL) for 48 hours, the MMP level in A498 cells was detected by MMP probe JC-1 ( Figure 5B). As the drug concentration (30-90 μg / mL) increased, the intensity of green fluorescence in A498 cells gradually increased, which means that MMP gradually decreased. When the concentration of Re-CDs was 90 μg / mL, the intracellular fluorescence intensity increased by 29.6%, and the MMP level decreased significantly (p<0.001) ( Figure 5 E). This means that the administered Re-CDs can promote abnormal mitochondrial function in A498 cells. Mitochondrial damage will further promote the generation of ROS and the occurrence of apoptosis, and excessive ROS will further lead to increased calcium ion release.

[0139] Fluo-4-AM was used to detect the intracellular Ca2+ expression in A498 cells after incubation with different concentrations of Re-CDS (0, 30, 50, 70 and 90 μg / mL) for 48 h. 2+ Compared with the control group (Re-CDs, 0 μg / mL), the green fluorescence intensity and Ca2+ expression in A498 cells increased with the increase of the drug concentration (30-90 μg / mL). 2+ The concentration gradually increased ( Figure 5 C). When the concentration of Re-CDs was 90 μg / mL, the fluorescence intensity in A498 cells increased by ∼90.5% (p<0.001) ( Figure 5 F). At the same time, Hoechst33342 / PI staining showed that the intracellular chromatin of A498 cells was condensed and bright compared with the control group, which further confirmed the occurrence of apoptosis in A498 cells.

[0140] These results indicate that after Re-CDs administration, the increased ROS level in A498 cells leads to mitochondrial dysfunction, which in turn leads to decreased MMP levels and Ca 2+ Elevated concentrations eventually lead to synergistic effects of cell cycle arrest and apoptosis.

[0141] See also Figure 6 , Figure 6 The present invention detects the expression of related genes in A498 cells after Re-CDs administration by transcriptomics and qPCR verification (n=3). Among them, (A) Volcano plot analysis of differential genes between the control group and the treatment group. (B) Cluster heat map analysis of differential genes between the control group and the treatment group. (C) GO enrichment analysis of DEGs in the control group and the treatment group. (D) KEGG enrichment analysis of DEGs in the control group and the treatment group. (E) qPCR verification histogram of differential genes in the PI3K / AKT related pathway. Compared with the control group, *p<0.05, **p<0.01.

[0142] To explore the molecular mechanism of Re-CDs inhibiting the proliferation and promoting apoptosis of renal cancer A498 cells in detail, transcriptomics was used to detect the expression of A498 cells after co-incubation with Re-CDs for 48 h, and qPCR technology was used to verify the expression of related genes in A498 cells ( Figure 6 ).

[0143] A498 cells with 0 μg / mL Re-CDs were designated as the control group, and A498 cells with 70 μg / mL Re-CDs were designated as the treatment group. High-throughput RNA sequencing (RNA-seq) was used to evaluate the differences in relevant expressed genes between the control group and the treatment group under the same conditions ( Figure 6 A~D). The results of principal component analysis (PCA) showed that the two groups of samples were highly separated and significantly different. As shown in the volcano plot of the transcriptome results, the differentially expressed genes (DEGs) between the two groups were determined by the DESeq2 algorithm, with a predicted fold change of ≥2 and an adjusted P value of <0.05 ( Figure 6 A). A total of 2592 DEGs were obtained, including 1141 up-regulated genes and 1451 down-regulated genes.

[0144] The results showed that Re-CDs administration could induce significant changes in gene transcription levels in A498 cells. The heat map showed significant differences in mRNA profiles between the treatment group and the control group ( Figure 6 B). Data are shown in a two-dimensional format, with each value representing a matrix of upregulated (red) and downregulated (blue) genes.

[0145] To determine the main biological functions of DEGs, Gene Ontology (GO) enrichment analysis was used to investigate the biological processes, cellular components, and molecular functions of DEGs. Figure 6 C). These DEGs are mainly concentrated in phylogeny, multicellular organism development, anatomical structure development, cytoplasm, non-membrane-bound organelles, intracellular non-membrane-bound organelles, binding, protein binding, carbohydrate derivative binding, etc. The pathway enrichment study of DEGs was conducted by the Kyoto Encyclopedia of Genes and Genomes (KEGG) ( Figure 6 D). DEGs were mainly enriched in the PI3K / AKT signaling pathway and the MAPK signaling pathway. Specific primers were selected and designed, and the DEGs screened by RNA-seq were verified by qPCR ( Figure 6 E). The regulation trends of the nine genes (COL6A3, ITGA1, ITGB6, PTK2, PI3KAP1, AKT3, CDKN1A, CDK2, and CCNA2) verified by qPCR were consistent with the transcriptome detection data ( Figure 6 A).

[0146] See also Figure 7 , Figure 7The present invention uses immunofluorescence detection and WB analysis to evaluate the changes in the expression levels of related proteins in A498 cells after Re-CDs administration. Wherein, (A) Immunofluorescence image of A498 expressing related proteins in cells after 24 hours of co-incubation with Re-CDs. "-" represents 0μg / mL Re-CDs administration, and "+" represents 90μg / mL Re-CDs administration. The scale bar is 200μm. (B) WB image of the expression levels of the control group and the treatment group. (C) Statistical histogram of the average optical density of the expression of related proteins detected by immunofluorescence. (D) Statistical histogram of the expression levels of related proteins detected by WB. Compared with the control group, *p<0.05, **p<0.01, ***p<0.001.

[0147] Based on the above transcriptomic analysis, immunofluorescence and WB were used to detect the expression levels of related proteins in the PI3K / AKT pathway (PI3K, p-PI3K, AKT, p-AKT, p21, CDK2, and CCNA2). Figure 7 ).

[0148] Compared with A498 cells cultured normally, the expression levels of these key proteins were significantly upregulated or downregulated after Re-CDs administration (90 μg / mL). The results showed that Re-CDs could significantly inhibit the expression level of p-PI3K, and then inhibit the expression level of the downstream protein p-AKT, thereby upregulating the expression level of the cycle regulator p21, and then inhibiting the formation of the CDK2-CCNA2 complex.

[0149] Please note that the CDK2-CCNA2 complex can promote the transition of the cell cycle from S phase to G2 phase. Inhibition of activity will lead to cell cycle arrest in S phase, inhibit cell proliferation and eventually promote cell apoptosis.

[0150] See also Figure 8 , Figure 8 The in vivo anti-renal cell carcinoma activity of Re-CDs prepared by the present invention (n=5). Wherein, (A) Schematic diagram of drug administration to mice during the experimental period. (B) Statistical graph of the body weight of each group of mice during the experimental period. (C) Statistical graph of mouse tumor volume during the experimental period. (D) Photograph of mouse tumor at the end of treatment (day 15). (E) Corresponding statistical histogram of tumor weight. Compared with the model group, ***p<0.001.

[0151] A tumor-bearing mouse model with A498 cells as cancer cells was established to evaluate the inhibitory effect of Re-CDs on renal cell carcinoma in vivo. Figure 8 ).

[0152] All mice were randomly divided into 4 groups (n=5): control group, model group, 5-FU group and Re-CDs group. After the mice in the model group, 5-FU group and Re-CDs group were successfully implanted with heterogeneous tumors, the experimental period was set to 0-15 days. Tumor-bearing mice were treated with 5-fluorouracil (5-FU group) and Re-CDs (Re-CDs group) ( Figure 8 A) treatment. During the experimental period, the body weight of mice in each group showed an upward trend ( Figure 8 B).

[0153] Obviously, the weight gain trend of mice in the model group and 5-FU treatment group was lower than that of the control group and Re-CDs group. The weight gain of mice in the model group was the slowest, indicating that the tumor had a greater impact on the mice. The weight gain of mice in the 5-FU group was slower. This should be because chemotherapy drugs have great toxic side effects on mice while exerting an inhibitory effect. The weight gain of mice in the Re-CDs group was almost the same as that in the control group. This shows that the toxic effect of Re-CDs on mice is very low. When exerting an inhibitory effect, Re-CDs can effectively reduce the burden of tumors on mice. Real-time monitoring of changes in tumor volume of mice in each group during the experiment ( Figure 8 C).

[0154] During the experiment, the tumor volume of mice in the model group increased significantly. In the later stage, the tumor growth rate increased more significantly. The tumors of mice in the 5-FU group and Re-CDs group were significantly inhibited at the beginning of the experiment (0-6 days). On the 9th day, the tumor volume of mice in the 5-FU group increased rapidly and continued until the end of the experiment.

[0155] At the same time, the tumor volume of mice in the Re-CDs group continued to increase slowly. The difference in tumor volume between the model group and the Re-CDs group was statistically significant (p<0.001). Tumor photos after the experiment showed that the tumors of mice treated with 5-FU and Re-CDs were smaller than those of the untreated model group ( Figure 8 D). Similar to the statistical tumor volume, there was a significant difference in tumor weight between the Re-CDs group and the Model group (p<0.001) ( Figure 8 E).

[0156] After the experimental period, the main organs (heart, liver, spleen, lung and kidney) of each group of mice were stained with H&E and analyzed. The results showed that the organ cells and tissues of each group of mice were closely arranged, uniform in texture, and almost no obvious lesions were found. Anticoagulated whole blood was collected from the control group and Re-CDs group mice for further analysis of blood routine indicators, including hemoglobin (HGB), hemoglobin content (MCH), lymphocytes (LYM), lymphocyte ratio (LYM%), intermediate cells (MID), intermediate cell ratio (MID%), total red blood cell count (RBC), mean red blood cell volume (MCV), red blood cell distribution width SD (RDW-SD), red blood cell distribution width CV (RDW-CV), granulocytes (GRAN), granulocyte ratio (GRAN%), total white blood cell count (WBC), total platelet count (PLT), mean platelet volume (MPV), platelet distribution width (PDW), platelet hematocrit (PCT) and platelet-large cell ratio (P-LCP).

[0157] After Re-CDs treatment, the blood indexes of mice in the Re-CDs group did not change significantly compared with those in the control group. The serum of mice in the control group and the Re-CDs group was collected for biochemical index analysis. Including key indicators of liver function (alkaline phosphatase (AKP), alanine aminotransferase (ALT), aspartate aminotransferase (AST)) and key indicators of renal function (urea nitrogen (BUN), creatinine (CRE), uric acid (UA)). There were only significant differences in serum indicators between the two groups.

[0158] The above results indicate that Re-CDs have low biotoxicity and good biosafety.

[0159] The above is a detailed introduction to the application of ginsenoside Re carbon nanodots provided by the present invention in the field of preparing pharmaceutical preparations for anti-renal cancer and / or inhibiting renal cancer A498 cells. Specific examples are used herein to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method and its core ideas of the present invention, including the best mode, and also enables any technician in the field to practice the present invention, including making and using any device or system, and implementing any combined method. It should be pointed out that for ordinary technicians in this technical field, without departing from the principles of the present invention, the present invention can also be improved and modified in several ways, and these improvements and modifications also fall within the scope of protection of the claims of the present invention. The scope of patent protection of the present invention is defined by the claims and may include other embodiments that can be thought of by those skilled in the art. If these other embodiments have structural elements that are not different from the textual expression of the claims, or if they include equivalent structural elements that are not substantially different from the textual expression of the claims, then these other embodiments should also be included in the scope of the claims.

Claims

1. Application of ginsenoside Re carbon nanodots in the preparation of pharmaceutical preparations for inhibiting renal cancer and / or inhibiting renal cancer A498 cells.

2. The use according to claim 1, characterized in that: The diameter of the ginsenoside Re carbon nanodots is 1 to 10 nm; The surface of the ginsenoside Re carbon nanodots contains hydroxyl groups and / or carbonyl groups.

3. The use according to claim 1, characterized in that: The inhibition is specifically inhibition through the PI3K / AKT signaling pathway.

4. The use according to claim 1, characterized in that: The ginsenoside Re carbon nanodots are stable; The ginsenoside Re carbon dots have a specific inhibitory effect on renal cancer and / or renal cancer A498 cells.

5. The use according to claim 4, characterized in that: The stability includes one or more of fluorescence stability, ultraviolet irradiation stability, sunlight stability, acid-base stability, and stability in NaCl and / or KCl solution; The concentration of the NaCl and / or KCl solution is 0.2-2 mol / L.

6. The use according to claim 1, characterized in that: The method for preparing ginsenoside Re carbon nanodots comprises the following steps: 1) mixing ginsenoside Re and water to obtain a mixed solution; 2) The mixed solution obtained in the above step is subjected to a hydrothermal reaction to obtain a ginsenoside Re carbon dot aqueous solution.

7. The use according to claim 4, characterized in that: The concentration of ginsenoside Re in the mixed solution is 0.1 to 10 mg / mL; The ginsenoside Re carbon dot aqueous solution is a transparent liquid with a Chinese medicine flavor.

8. The use according to claim 4, characterized in that: The temperature of the hydrothermal reaction is 90 to 220°C; The hydrothermal reaction time is 0.5 to 12 hours; The method further comprises a filtering step after the hydrothermal reaction.

9. The use according to any one of claims 1 to 7, characterized in that: The pharmaceutical preparation comprises ginsenoside Re carbon dots and pharmaceutically acceptable excipients; The pharmaceutical preparation has a specific inhibitory effect on renal cancer and / or renal cancer A498 cells.

10. The application according to claim 9, characterized in that: The dosage form of the pharmaceutical preparation includes oral preparations, injections, suppositories, inhalants or dosage forms that can be directly applied to tumors; In the pharmaceutical preparation, the mass content of the ginsenoside Re carbon nanodots is 1% to 100%.

Images