Prevotella bruceli B14 capable of improving milk yield and milk-fat percentage of ruminants and application of prevotella bruceli B14

Abstract

The invention relates to the technical field of microorganisms, and in particular relates to a prevotella bruceli B14 capable of improving the milk yield and the milk-fat percentage of ruminants and application of the prevotella bruceli B14. The invention discloses a strain of prevotella bruceli B14, and the Latin name of the prevotella bruceli B14 is prevotella bruceli B14. The preservation number of the strain is CCTCC NO: M 20242730. The prevotella bruceli B14 provided by the invention can increase the milk yield and the milk fat percentage of ruminants by increasing the concentration of total volatile fatty acid, acetic acid, propionic acid and valeric acid in the rumen of the ruminants. In addition, the compound also has the function of synthesizing nicotinic acid, and can activate an mTORC1 signal channel in the mammary gland of the ruminant in a GPR109A-dependent manner and promote the expression of lipid synthesis genes so as to promote milk fat synthesis. In addition, the prevotella buchneri B14 also has the function of reducing the abundance of methanogenic archaea in rumen, so that the prevotella buchneri B14 is expected to improve the energy utilization efficiency by reducing the methane emission of ruminants.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a strain of Prevotella brisebilharzia B14 capable of improving milk production and milk fat rate of ruminants and application thereof. Background Art

[0002] The milk yield and fat content of ruminants are two key indicators for measuring lactation performance. They not only affect the output and nutritional value of dairy products, but also directly determine the market economic benefits of dairy products. However, in actual production, the fluctuation of milk yield and the frequent occurrence of fat inhibition in dairy animals have seriously restricted the stable development of the dairy industry. Rumen microorganisms produce key metabolites such as volatile fatty acids through biological fermentation, providing important carbon sources and precursors for the synthesis of milk, fat and other milk components. For the synthesis of fat and milk in ruminants, the rumen plays an indispensable role as the center of the host-feed metabolic network, which has led to a large number of related works on regulating the lactation performance of ruminants with rumen microorganisms as the target. Existing work mainly focuses on single lactation phenotypes such as milk yield and fat content of ruminants. The milk yield of ruminants is usually inversely proportional to the content of key nutrients in milk such as fat content. Therefore, there is a lack of systematic understanding of the coordinated regulation between milk yield and fat content.

[0003] Prevotella is the largest functional group in the rumen of ruminants. It performs multiple metabolic functions in the rumen ecosystem, especially in the decomposition of carbohydrates, protein metabolism, nitrogen cycle and vitamin synthesis. It can efficiently decompose complex carbohydrates such as cellulose, hemicellulose and starch in the diet, generate metabolic molecules such as volatile fatty acids and vitamins, thereby providing energy for ruminants and regulating their physiological activities. Therefore, it is a key issue that technicians in this field need to solve urgently to explore and isolate functional Prevotella strains in the rumen of ruminants, and use these strains to improve rumen fermentation, feed utilization and lactation performance of ruminants, so as to achieve precise nutritional regulation and improve economic benefits. Summary of the invention

[0004] The object of the present invention is to provide a strain of Prevotella bryantii B14 and its application that can increase the milk production and milk fat rate of ruminants. The Prevotella bryantii B14 provided by the present invention has the function of synthesizing nicotinic acid, and its active form nicotinamide can activate the mTORC1 signaling pathway in a GPR109A-dependent manner in the mammary gland of ruminants, promote the expression of lipid synthesis genes ACCα, SREBP, FASN, SCD1 and PPARγ, so as to promote milk fat synthesis. In addition, Prevotella bryantii B14 can improve rumen fermentation of ruminants, increase the concentration of total volatile fatty acids (VFAs), acetic acid, propionic acid and valeric acid in the rumen, so as to increase milk production and milk fat rate. Further, Prevotella bryantii B14 has the function of reducing the abundance of methanogenic archaea in the rumen, so it is expected to improve the energy utilization efficiency of ruminants by reducing the methane emission of ruminants.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a strain of Prevotella bryantii B14, whose Latin name is Prevotella bryantii and whose preservation number is CCTCC NO: M 20242730.

[0007] The present invention also provides application of the Prevotella brisebiliensis B14 in nicotinic acid production.

[0008] The present invention also provides the use of the Prevotella brisebiliensis B14 in improving rumen fermentation of ruminants and promoting the concentrations of total VFAs, acetic acid, propionic acid and valeric acid in the rumen.

[0009] The present invention also provides the use of the Prevotella brisebiliensis B14 in preparing a feed additive capable of improving the energy utilization efficiency of ruminant feed.

[0010] The present invention also provides the use of the Prevotella brisebiliensis B14 in preparing a feed additive for reducing methane emission of ruminants.

[0011] The present invention also provides the use of the Prevotella brisebilharzia B14 in preparing a feed additive for promoting rumen fermentation of ruminants.

[0012] The present invention also provides the use of the Prevotella brisebiliensis B14 in the preparation of a feed additive for promoting milk fat synthesis and improving milk fat rate.

[0013] The present invention also provides a feed additive, comprising the Prevotella brisebilharzia B14.

[0014] Preferably, the bacterial concentration of Prevotella brunneri B14 in the feed additive is 1×108 ~1×10 11 CFU / mL.

[0015] The present invention also provides a method for producing nicotinic acid, comprising inoculating the Prevotella brisebillis B14 into a culture medium containing a nicotinic acid synthesis precursor for culture.

[0016] Preferably, the culture medium containing niacin synthesis precursors is Medium 159 culture medium.

[0017] The present invention provides Prevotella brisebiliensis B14 which can be applied to be added to conventional feed components of ruminants such as cattle and sheep. For example, it can be added to pharmaceutical compositions, feeds, feed additives, and probiotics, and an appropriate amount of auxiliary materials can also be added, and the auxiliary materials can be excipients, diluents, fillers, absorption promoters, etc.; it can also be prepared into a variety of dosage forms, such as powders, tablets, granules, microcapsules, liquid preparations, etc.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The Prevotella brisebiliensis B14 provided by the invention has the function of reducing the abundance of methanogenic archaea in the rumen of ruminants, so as to improve the energy efficiency of ruminants and reduce feeding costs.

[0020] The Prevotella brisebiliensis B14 provided by the present invention can also increase the concentrations of total VFAs, acetic acid, propionic acid and valeric acid in the rumen of ruminants, thereby improving rumen fermentation.

[0021] The Prevotella brisebilalis B14 provided by the present invention can stimulate the activation of the ruminant mammary gland mTORC1 signaling pathway by synthesizing nicotinic acid and using nicotinamide in its active form, thereby increasing the expression of milk fat synthesis genes ACCα, SREBP, PPARγ, FASN and SCD1 to promote milk fat synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0023] Figure 1The whole genome annotation and in vitro pure culture experiment of Prevotella brisebilae B14 in Example 1 of the present invention confirm that it can synthesize nicotinic acid using aspartic acid as a precursor; A is the morphological information and whole genome annotation results of Prevotella brisebilae B14 under electron microscope, B is the concentration of aspartic acid in the culture medium after culturing Prevotella brisebilae B14 for 0h or 24h, and C is the concentration of nicotinic acid in the culture medium after culturing Prevotella brisebilae B14 for 0h or 24h;

[0024] Figure 2 1 is the effect of Prevotella brisebiliensis B14 on the abundance of methanogenic archaea and methane production in the artificial rumen fermentation system in Example 2 of the present invention; A is a schematic diagram of the artificial rumen fermentation system, and BD are changes in gas production, methane production and the number of copies of methanogenic archaea in the artificial rumen fermentation system before and after the treatment with Prevotella brisebiliensis B14, respectively;

[0025] Figure 3 The nicotinic acid produced by Prevotella brisevos B14 in Example 3 of the present invention can activate the mTORC1 signaling pathway in bovine mammary epithelial cells in a GPR109A-dependent manner with its active form nicotinamide, enhance the expression of lipid synthesis genes ACCα, PPARγ, SREBP, FASN and SCD1, and promote milk fat synthesis; Figure A is the effect of nicotinamide on the levels of mTORC1 downstream target proteins pT389-S6K and p-S6 in bovine mammary epithelial cells; Figure B is the effect of nicotinamide on the mTORC1 downstream lipid synthesis genes ACCα, PPARγ, SREBP, FASN and SCD1 in bovine mammary epithelial cells; Figure C shows the effect of nicotinamide on the levels of mTORC1 downstream target proteins pT389-S6K and p-S6 after specific inhibition of GPR109A expression; Figure D shows the effect of nicotinamide on the expression of mTORC1 downstream and lipid synthesis genes ACCα, PPARγ, SREBP, FASN and SCD1 after specific inhibition of GPR109A expression;

[0026] Figure 4 1 is the effect of Prevotella buccal B14 on milk production and fat content of late lactation goats in Example 4 of the present invention; A is a bar graph showing changes in average milk production during the adaptation period and the treatment period, and B is a line graph showing changes in fat content during the adaptation period and the treatment period;

[0027] Figure 5 It is the effect of Prevotellabryantii B14 in Example 4 of the present invention on the fermentation parameters of the rumen of late-lactation dairy goats; Figures AD respectively show the changes in the concentrations of total VFAs, acetic acid, propionic acid and valeric acid in the rumen of late-lactation dairy goats before and after treatment with Prevotellabryantii B14;

[0028] Figure 6This is the effect of Prevotella bukewa B14 in Example 4 of the present invention on the niacin concentration and the abundance of methanogenic archaea in the rumen of dairy goats at the end of lactation; Figure A shows the change in the copy number of Prevotella bukewa B14 in the rumen of dairy goats before and after treatment with Prevotella bukewa B14, Figure B shows the change in niacin concentration in the rumen of dairy goats before and after treatment with Prevotella bukewa B14, and Figure C shows the change in the abundance of methanogenic archaea in the rumen of dairy goats before and after treatment with Prevotella bukewa B14.

[0029] Biological Deposit Description

[0030] a strain of Prevotella bryantii B14, Latin name Prevotella bryantii;

[0031] This strain was deposited in the China Center for Type Culture Collection CCTCC on December 5, 2024 (address: Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University); the deposit number is CCTCC NO: M 20242730. DETAILED DESCRIPTION

[0032] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0033] The culture medium and reagents required for solution preparation involved in the following examples were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Guanzhong dairy goats in the late lactation period were provided by Shaanxi Bofule Guanzhong Dairy Goat Breeding Co., Ltd. ChamQ Universal SYBR qPCR MasterMix used in the real-time quantitative PCR system was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0034] Example 1 Isolation and culture of Prevotella brisebiliensis B14 in vitro and verification of its nicotinic acid synthesis ability

[0035] 1.1 Isolation of Prevotella brunneri B14 from rumen digesta of high fat (HH) dairy goats

[0036] Suspend 1 mL of high fat content (fat content greater than 3.93%) rumen fluid from dairy goats in phosphate buffer and dilute to 10 -8 80 μL of the diluted sample was spread on Bacteroides mineral salts agar under CO2 flow.

[0037] The formula is as follows (g / L): glucose 15g / L, potassium dihydrogen phosphate 4g / L, sodium dihydrogen phosphate 2g / L, ammonium sulfate 0.5g / L, sodium chloride 9g / L, magnesium chloride 0.15g / L, calcium chloride 0.01g / L, manganese chloride 0.1g / L, cobalt chloride 0.1g / L, cysteine ​​0.8g / L, sodium bicarbonate 1.5g / L, heme 0.01g / L, vitamin B12 0.005 g / L, ferrous sulfate 0.001g / L, nalidixic acid 0.01g / L, vancomycin 0.003g / L, purified agar 20g / L. After 3 days of culture, a white, convex round single colony was picked for strain identification and purified culture to obtain the target strain Prevotella brucei B14. The 16s rRNA gene sequence sequencing results of Prevotella brucei B14 are as follows:

[0038]

[0039] 1.2 Enrichment culture and bacterial culture preparation of Prevotella brunneri B14

[0040] The purified single colony was selected and inoculated into the modified Medium 159 medium. The formula of Medium 159 was as follows: 4.5 g of standard Medium 159 (https: / / www.dsmz.de / microorganisms / medium / pdf / DSMZ_Medium159.pdf) was additionally added with 0.1% cellobiose (w / v), 0.1% maltose (w / v) and 0.1% soluble starch (w / v) dissolved in 700 mL of sterile distilled water to prepare the modified Medium 159 medium for use; thereafter, 300 mL of sterile clarified rumen fluid was additionally added to the modified Medium 159 culture medium, and the medium was sterilized at 121°C and 103 kPa for 20 min. The sterilized culture medium was placed in a CO2 gas flow for 60 min for preliminary deoxygenation.

[0041] After that, the culture solution after preliminary deoxygenation was transferred into an anaerobic incubator and dispensed into Hungate tubes. The tube cap was loosened and placed for more than 48 hours to replace dissolved oxygen. After the culture solution became clear and transparent, it was inoculated with 5% of the B14 bacterial solution of Prevotella brucei preserved in 50% glycerol solution. The culture was statically cultured at 37°C and anaerobic conditions. The B14 bacterial solution of Prevotella brucei enriched for 24 hours was centrifuged at 5000r / min and 4°C for 10 minutes, the supernatant was discarded, and the solution was washed with physiological saline, resuspended, and then graded diluted to adjust the concentration of the bacterial solution and stored for later use.

[0042] 1.3 Prevotella brisevoyii B14 encodes a complete niacin biosynthesis pathway

[0043] The whole genome of Prevotella brisebiliensis B14 was downloaded from the DSMZ official website (https: / / www.ncbi.nlm.nih.gov / nuccore / NZ_FOEM00000000). Prodigal (v2.6.3) was used to predict ORFs and obtain protein sequences. KofamScan (v1.1.0) was used to perform KEGG annotation under a cutoff value of 1e-5 to evaluate the ability of Prevotella brisebiliensis B14 to synthesize niacin at the genome level. Figure 1 A shows the morphological information of Prevotella brisebilae B14 under an electron microscope and confirms that Prevotella brisebilae B14 encodes a complete enzyme gene in the niacin synthesis pathway, preliminarily determining that Prevotella brisebilae B14 can synthesize niacin using aspartic acid as a precursor.

[0044] 1.4 In vitro pure culture to verify the ability of Prevotella brisevoyii B14 to synthesize niacin

[0045] In order to explore the ability of Prevotella brucei B14 to synthesize niacin in vitro, the Prevotella brucei B14 cultured to the logarithmic phase was counted using a hemocytometer, and 1×10 8 CFU / mL of Prevotella brunneri B14 bacterial suspension 500 μL and heat-inactivated (100°C, 10 min) 1×10 8 500 μL of Prevotella brunneri B14 bacterial solution with CFU / mL was cultured statically at 37°C in an anaerobic workstation. The culture solution of PB and DPB groups at 0h and 24h was collected and centrifuged at 4000r / min for 10min, and the supernatant was taken for subsequent determination. Since Medium 159 contains nicotinic acid and its synthetic precursor aspartic acid, the concentrations of aspartic acid and nicotinic acid in the culture supernatant of the PB group and DPB group were determined using enzyme-linked immunosorbent assay kits (ELISA) according to the manufacturer's instructions. Figure 1 BC shows the changes in the concentrations of aspartic acid and nicotinic acid in the culture medium of Prevotella brisebilharzia B14 at 0h and 24h.

[0046] The results showed that after 24 hours of culture, the concentration of aspartic acid, a precursor of niacin synthesis, in the culture medium of the PB group decreased significantly, while the concentration of the target product niacin increased significantly (P<0.05).

[0047] Example 2 Prevotella brisebiliensis B14 reduces methane production by reducing the abundance of methanogenic archaea

[0048] The effect of Prevotella brisevos B14 on methane production was investigated by artificial rumen fermentation system. Fresh rumen fluid of dairy goats (parity: 2, lactation age = 123) was collected by rumen cannulation before morning feeding and poured into anaerobic bags, which were placed in a thermostat preheated to 39°C and brought back to the laboratory. All experimental operations were carried out under CO2 gas flow conditions. For each anaerobic bottle, 0.6 g of crushed and dried total mixed ration (TMR) (purchased from Shaanxi Yangling Fushite Biotechnology Co., Ltd.) was first added, and then the rumen fluid was mixed with preheated artificial saliva (1:4) and 60 mL was drawn and injected into the anaerobic bottle.

[0049] The formula of artificial saliva is as follows: Solution A: CaCl2·2H2O (13.2 g), FeCl3·6H2O (8.0 g), MnCl2·4H2O (10.0 g), CoCl2·6H2O (1.0 g), and deionized water is diluted to 100 mL; Solution B: NH4HCO3 (4.0 g), NaHCO3 (35.0 g), and deionized water is diluted to 1000 mL; Solution C: Na2HPO4 (5.7 g), MgSO4·7H2O (0.6 g), KH2PO4 (6.2 g), and deionized water is diluted to 1000 mL; Resazurin solution: 0.1 g of Resazurin is dissolved in 100 mL of deionized water; Reductant solution: 1 M NaOH (4 mL), Na2S·9H2O (0.625 g), and deionized water were made up to 100 mL; artificial saliva was prepared according to the following steps: 400 mL of distilled water + 0.1 mL of solution A + 200 mL of solution B + 200 mL of solution C + 1 mL of resazurin solution + 40 mL of reducing agent solution.

[0050] 2 mL of culture supernatant of Prevotella brunneri B14 sterilized by centrifugation and filtration with a 0.22 μm filter membrane was added to the anaerobic bottle of the control group (SN).

[0051] 1×10 8 2 mL of Prevotella brunneri B14 bacterial solution with CFU / mL. The tops of all anaerobic bottles were connected to anaerobic gas collection bags connected to three-way valves and placed in a constant temperature shaker preheated to 39.5°C and fermented at 60 rpm for 24 hours. After the fermentation was completed, a syringe connected to a three-way valve was used to measure the gas volume in each gas collection bag. The methane concentration was measured using a gas chromatograph.

[0052] The gas chromatograph was equipped with a TDX-1 column, and the parameters were set as follows: inlet temperature 100°C, detector temperature 100°C, carrier gas (argon) flow rate 30.0 mL / min, detection time 6 min / sample, injection volume 10 mL. Calculate according to total methane production = total gas production × methane concentration. After the fermentation, the anaerobic bottle was placed on ice to terminate the fermentation, and the fermentation precipitate in each anaerobic bottle was collected for quantification of the copy number of methanogenic archaea in the fermentation precipitate. The specific method of quantification is: use real-time quantitative PCR (qRT-PCR) to determine the copy number of methanogenic archaea in the fermentation precipitate.

[0053] Forward: GAGGAAGGAGTGGACGACGGTA, Reverse: ACGGGCGGTGTGTGCAAG (as shown in SEQ ID NO: 2, 3) were used as specific primers, and the feasibility of the primers was verified by Primer-BLAST. Quantitative PCR was performed using ChamQ Universal SYBR qPCR MasterMix on a 96-well real-time PCR system.

[0054] The reaction system was: Forward Premier and Reverse Premier 0.4μL, ChamQ UniversalSYBR qPCR MasterMix 10μL, cDNA 1uL, deionized water 8.2μL. The reaction program was: 95℃30s, 95℃10s, 60℃30s, for a total of 40 cycles.

[0055] Final quantification of methanogenic archaea copy numbers was achieved by inputting the cycle thresholds into a standard curve specific for each microorganism. Results were expressed as copies per gram of fermentation pellet (log 10 )express. Figure 2 A- represents the schematic diagram of the artificial rumen fermentation system; Figure 2 BD represents the gas production, methane production and the copy number of methanogenic archaea in the fermentation sediment of the artificial rumen fermentation system before and after the treatment of Prevotella brisevoyii B14, respectively.

[0056] The results showed that after 24 hours of inoculation and fermentation with Prevotella brisebillis B14, the gas production, methane production and the abundance of methanogenic archaea in the artificial rumen fermentation system were significantly reduced (P<0.05), which confirmed that Prevotella brisebillis B14 can adjust the energy efficiency of ruminants by reducing methane production.

[0057] Example 3 Prevotella brisevoyii B14 promotes milk fat synthesis in an mTORC1-dependent manner by synthesizing nicotinic acid

[0058] 1.1 Prevotella brisebilosa B14 activates the mTORC1 signaling pathway in bovine mammary epithelial cells by synthesizing niacin

[0059] Since nicotinamide is the main active form of nicotinic acid in the goat circulatory system, the nicotinic acid synthesized by Prevotella brunneri B14 should subsequently regulate milk fat synthesis in the mammary gland of ruminants in the form of nicotinamide (Chen, Juncai, Zhenguo Yang, and Guozhong Dong. "Niacin nutrition and rumen-protected niacin supplementation indairy cows: an updated review." British Journal of Nutrition 122.10(2019):1103-1112.). Therefore, in order to reveal the key signaling pathways mediated by nicotinamide in regulating milk fat synthesis, bovine mammary epithelial cells were cultured in DMEM medium supplemented with 10% fetal bovine serum at 37°C and 5% CO2. Bovine mammary epithelial cells were stored in a continuously humidified cell culture incubator under standard culture conditions.

[0060] The bovine mammary epithelial cells were cultured for 24 hours after resuscitation, and the cell density and growth state were observed under a microscope. When the cell density grew to about 90%, the cells were subcultured. Since the half-life of nicotinamide in goats is about 4 hours, the subcultured bovine mammary epithelial cells were incubated with nicotinamide at concentrations of 0.0, 0.1, 0.5, 1.0, 2.5, and 5.0 mM for 4 hours, and then frozen at -80°C for subsequent qRT-PCR and Western blot analysis. The results are shown in Figure 3 A.

[0061] From the results, it can be seen that nicotinamide at a concentration of 0.5mM can significantly increase the expression levels of mTORC1 downstream target proteins pT389-S6K and p-S6 in bovine mammary epithelial cells (P<0.05). It should be emphasized that the concentration of 0.5mM nicotinamide used in this experiment is consistent with the concentration of endogenous nicotinamide in the circulatory system of ruminants.

[0062] 1.2 Prevotella brisebiliensis B14 promotes the expression of lipid synthesis genes by synthesizing nicotinic acid

[0063] Table 1 Primer sequences of lipid synthesis genes

[0064]

[0065] As shown in SEQ ID NOs: 4 to 17.

[0066] Total RNA was extracted from bovine mammary epithelial cells incubated with 0.1 mM and 0.5 mM nicotinamide using the TRIzol method. The concentration and purity of the extracted RNA were determined using a Nanodrop2000 spectrophotometer, and the integrity of the extracted RNA was checked by agarose gel electrophoresis. Afterwards, the extracted total RNA was reverse transcribed using the RevertAid First Strand cDNA Synthesis Kit to obtain cDNA. ChamQ Universal SYBR qPCR MasterMix was used in the Light qRT-PCR was performed on 96 Real-Time PCR System.

[0067] The reaction system was: 0.4 μL each of Forward Premier and Reverse Premier, 10 μL of ChamQ UniversalSYBR qPCR MasterMix, 1 uL of cDNA, and 8.2 μL of deionized water.

[0068] The reaction program was: 95°C for 30 s, 95°C for 10 s, 60°C for 30 s, for a total of 40 cycles. All primers used in the study were designed using Oligo 7 software and preliminarily verified using primer-blast (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The comparative cycle method (2 -ΔΔCt ) to calculate the relative expression of mRNA. The primer sequences of lipid synthesis genes used are shown in Table 1, and the detailed results are shown in Figure 3 B.

[0069] The results showed that incubation with 0.5 mM nicotinamide could significantly upregulate the expression of lipid synthesis genes ACCα, SREBP, FASN, SCD1 and PPARγ in bovine mammary epithelial cells (P<0.05), thus promoting milk fat synthesis.

[0070] 1.3 Nicotinamide depends on GPR109A receptor to activate mTORC1 signaling pathway

[0071] Nonspecific control small interfering RNA (siRNA) and GPR109A-specific siRNA were mixed with Lipofectamine 3000 in a 1:1 ratio. The mixture was diluted with serum-free medium and incubated at room temperature for 30 minutes. Subsequently, the diluted siRNA-Lipofectamine complex was added to a six-well plate containing bovine mammary epithelial cells and transfected for 24 hours. The transfected bovine mammary epithelial cells were inoculated in a 12-well plate and incubated for 4 hours at 0.0, 0.1 and 0.5 mM nicotinamide concentrations. The siRNA sequence used is as follows: 5′-GAACGAGGUUGAUCGAGAAUC-3′. Shown in SEQ ID NO: 18. Detailed results are shown in Figure 3 CD.

[0072] The results showed that after silencing the GPR109A receptor using specific siRNA, 0.5 mM nicotinamide could not regulate the expression of mTORC1 downstream target proteins pT389-S6K and p-S6 and lipid synthesis genes ACCα, SREBP, FASN, SCD1 and PPARγ (P>0.05), proving that nicotinamide depends on the GPR109A receptor to activate the mTORC1 signaling pathway.

[0073] Example 4 Effects of Prevotella brisebiliensis B14 on rumen fermentation and lactation performance of late lactation dairy goats

[0074] 1.1 Effect of Prevotella buccalli B14 on lactation performance of dairy goats at the end of lactation

[0075] Ten Guanzhong dairy goats (parity=1, DIM=215.30±3.03, mean±SD) in the late lactation period were selected and raised in Fuping County, Weinan City, Shaanxi Province. The goats were evenly divided into a control group (CON) and a group (PB) gavaged with P. brucei B14 and raised in two pens respectively. The entire experimental period was 17 days, and the local daily minimum and maximum average temperatures during the experimental period were 20.13℃ and 30.88℃, respectively. The CON and PB groups of dairy goats first experienced a 7-day adaptation period, followed by a 10-day treatment period. During the entire experimental period, the two groups of dairy goats had free access to water, and the milk production of each group of dairy goats was recorded daily. During the adaptation period, the two groups of dairy goats were not treated in any way. For the treatment period, 20 mL of sterile saline was gavaged into the CON group before morning feeding every day; the concentration of 1×10 11 20 mL of Prevotella B14 bacterial solution with CFU / mL. Milk samples were collected from the test goats before milking in the morning and afternoon on the 7th day of the adaptation period, the 5th day of the treatment period, and the 10th day of the treatment period, and then mixed in a ratio of 3:2 for milk component analysis. Figure 4 .

[0076] The results showed that oral administration of Prevotella briseifeld B14 could significantly alleviate the decline in milk production in late lactation goats and significantly increase the fat content in goat milk (P<0.05). The above results showed that Prevotella briseifeld B14 could improve the lactation phenotype of late lactation goats.

[0077] 1.2 Effects of Prevotella brunneri B14 on rumen fermentation in late lactation dairy goats

[0078] See 1.1 for the modeling of dairy goats treated with Prevotella bacilli B14 at the end of lactation. The rumen digesta of dairy goats were collected before morning feeding the day after the treatment period ended. The concentrations of various volatile fatty acids in the rumen digesta samples were determined by gas chromatography. The results are shown in Figure 5 .

[0079] Briefly, rumen digesta were thawed at 4°C and centrifuged at 16000r / min for 10 minutes. Subsequently, 2mL of supernatant was mixed with 400μL of 25% metaphosphoric acid and vortexed thoroughly. The mixture was allowed to stand at 4°C for 4 hours and then centrifuged again at 16000r / min for 10 minutes. 200μL of supernatant was mixed with 200μL of cinnamic acid (10g / L) and vortexed, then filtered through a 0.45μm membrane filter for analysis. The parameters of the gas chromatograph were set as follows: the inlet temperature was maintained at 250°C; the column temperature was initially set to 45°C, then increased to 150°C at a rate of 20°C / min and maintained for 5 minutes.

[0080] The results showed that intragastric administration of Prevotella brisebiliensis B14 could reduce the concentrations of total volatile fatty acids, acetic acid, propionic acid and valeric acid in the rumen of dairy goats (P<0.05), thereby improving rumen fermentation of dairy goats.

[0081] 1.3 Effects of Prevotella brisebiliensis B14 on niacin concentration and abundance of methanogenic archaea in the rumen of late-lactation dairy goats

[0082] The modeling of dairy goats treated with Prevotella brisebiliensis B14 at the end of lactation is shown in 1.1. The rumen digesta of dairy goats were collected in triplicate before morning feeding the next day after the treatment period, and used for the determination of niacin concentration in the rumen of dairy goats (ELISA method), absolute quantification of the copy number of Prevotella brisebiliensis B14 and methanogenic archaea, and the absolute quantification method was consistent with that described in Example 3. The results are shown in Figure 6 .

[0083] The results showed that the abundance of Prevotella brisebiliensis in the rumen of PB dairy goats increased significantly (P<0.05), proving that it can stably colonize in the rumen of dairy goats. In addition, the treatment of Prevotella brisebiliensis B14 can significantly increase the concentration of niacin in the rumen digesta of dairy goats at the end of lactation (P<0.05), and significantly reduce the abundance of methanogenic archaea (P<0.05). The niacin produced by Prevotella brisebiliensis B14 can subsequently promote milk fat synthesis in the mammary gland in the active form of NAM, while the reduction in the abundance of methanogenic archaea can further reduce the loss of energy in the form of methane, thereby improving the energy efficiency of dairy goats.

[0084] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A strain of Prevotella bryantii B14, whose Latin name is Prevotella bryantii and whose deposit number is CCTCC NO: M20242730.

2. Use of the Prevotella brisebiliensis B14 according to claim 1 in improving rumen fermentation of ruminants, increasing the concentrations of total volatile fatty acids, acetic acid, propionic acid and valeric acid in the rumen, and promoting milk production and milk fat rate.

3. Use of the Prevotella brisebiliensis B14 according to claim 1 in the preparation of a feed additive capable of improving the energy utilization efficiency of ruminant feed.

4. Use of the Prevotella brisebiliensis B14 according to claim 1 in the preparation of a feed additive for reducing methane emissions from ruminants.

5. Use of the Prevotella brisebiliensis B14 according to claim 1 in the preparation of a feed additive for promoting rumen fermentation in ruminants.

6. Use of the Prevotella brisebiliensis B14 described in claim 1 in the preparation of a feed additive for promoting milk fat synthesis and increasing milk fat rate.

7. A feed additive comprising the Prevotella brisebilharzia B14 according to claim 1.

8. The feed additive according to claim 7, characterized in that The bacterial concentration of Prevotella brunneri B14 in the feed additive is 1×10 8 ~1×10 11 CFU / mL.

9. The use of Prevotella brisebiliensis B14 according to claim 1 in the production of nicotinic acid, characterized in that: The Prevotella brisebiliensis B14 according to claim 1 is inoculated into a culture medium containing a precursor for nicotinic acid synthesis and cultured.

10. The production method according to claim 9, characterized in that: The culture medium containing nicotinic acid synthesis precursors is Medium 159 culture medium.

Images