Nucleic acid aptamer combined with Tth DNA polymerase and application thereof

Abstract

The invention relates to the technical field of biology, and discloses a nucleic acid aptamer combined with Tth DNA polymerase and application of the nucleic acid aptamer. The nucleic acid aptamer provided by the invention has relatively high Tth enzyme affinity, can specifically recognize and bind to Tth enzyme, and can protect active sites of the Tth enzyme, so that the nucleic acid aptamer can be used as a hot start molecule of the Tth enzyme, the reaction activity of the Tth enzyme can be improved, and the storage time of the Tth enzyme can be prolonged.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a nucleic acid aptamer combined with Tth DNA polymerase and application thereof. Background Art

[0002] Tth DNA polymerase was originally isolated from thermophilic bacteria and is a thermophilic DNA polymerase. Studies have found that the enzyme has 5'-3' polymerase activity, 3'-5' exonuclease activity, and is active in Mn 2+ In the presence of , it also has additional reverse transcriptase activity. Tth polymerase is active at 74°C and can tolerate up to 95°C. It has good high temperature resistance, and thus has broad application prospects in polymerase chain reaction (PCR) and related in vitro nucleic acid amplification technologies (such as RT-PCR, reverse transcription, cDNA synthesis, etc.).

[0003] However, in practical applications, non-specific primers and extensions may occur before thermal cycling during the PCR reaction, which reduces the purity of the amplified product. In addition, high-temperature activation of enzyme activity increases the time consumption of the reaction process, making it difficult to achieve rapid detection. Summary of the invention

[0004] The purpose of the present invention is to overcome the above-mentioned problems existing in the prior art and provide a nucleic acid aptamer binding to Tth DNA polymerase and its application. The nucleic acid aptamer provided by the present invention has a high affinity for Tth DNA polymerase, can specifically recognize and bind to Tth DNA polymerase, and can serve as a hot start molecule for Tth DNA polymerase.

[0005] In order to achieve the above object, the present invention provides a nucleic acid aptamer that binds to Tth DNA polymerase.

[0006] The nucleotide sequence of the nucleic acid aptamer has at least 30% homology with the following sequences (1) and / or (2):

[0007] (1) the DNA sequence shown in SEQ ID NO: 1;

[0008] (2) The DNA sequence shown in SEQ ID NO:2.

[0009] The second aspect of the present invention provides an application of the nucleic acid aptamer described in the first aspect, wherein the application comprises at least one of the following:

[0010] (a) Application in detecting Tth DNA polymerase;

[0011] (b) Application in purification of Tth DNA polymerase;

[0012] (c) Application in prolonging the storage time of Tth DNA polymerase;

[0013] (d) Use as a hot start molecule for Tth DNA polymerase;

[0014] (e) Use in the preparation of drugs targeting Tth DNA polymerase.

[0015] The third aspect of the present invention provides a Tth DNA polymerase preparation, which comprises a nucleic acid aptamer and Tth DNA polymerase, wherein the nucleic acid aptamer is the nucleic acid aptamer described in the first aspect.

[0016] The fourth aspect of the present invention provides the use of the nucleic acid aptamer described in the first aspect, or the preparation described in the third aspect in polymerase chain reaction and related reactions.

[0017] The fifth aspect of the present invention provides a method for in vitro synthesis and / or amplification of nucleic acids, the method comprising using the preparation described in the third aspect as an RNA reverse transcriptase and / or DNA polymerase to perform in vitro synthesis and / or amplification of nucleic acids.

[0018] Through the above technical solution, the present invention can at least achieve the following beneficial effects:

[0019] (1) The nucleic acid aptamer provided by the present invention can recognize and bind to the Tth enzyme with high specificity and has a high affinity for the Tth enzyme.

[0020] (2) The nucleic acid aptamer provided by the present invention has a small molecular weight, stable chemical properties, and is easy to store and label. It can be used for the detection, purification, imaging, etc. of Tth enzyme, and can also be used to prepare drugs or reagents targeting Tth enzyme, and has good and broad application prospects.

[0021] (3) After specifically binding to the Tth enzyme, the nucleic acid aptamer provided by the present invention can improve the stability of the Tth enzyme and prolong its storage time, especially prolong the storage time of the Tth enzyme at room temperature and non-refrigerated low temperature.

[0022] (4) The nucleic acid aptamer provided by the present invention can reversibly bind to the Tth enzyme. At room temperature, the two combine, thereby the Tth enzyme loses its activity. At high temperature (i.e., reaching the melting temperature of the nucleic acid aptamer), the secondary structure of the nucleic acid aptamer opens and the enzyme activity is restored. Therefore, the nucleic acid aptamer provided by the present invention can control the release of the activity of the Tth enzyme by temperature, avoiding the occurrence of non-specific amplification before thermal cycling in in vitro nucleic acid amplification technologies such as PCR.

[0023] (5) The nucleic acid aptamers provided by the present invention can be mass-produced in a short period of time through artificial synthesis, and have a single component, and the quality inspection and use costs are low. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a graph showing the detection results of the recognition and binding ability of each round of screening products with the Tth enzyme by SPR during the aptamer screening process in Example 1.

[0025] Figure 2 This is a graph showing the affinity test results between aptamer XY01 and Tth enzyme in Example 2.

[0026] Figure 3 This is a graph showing the affinity test results between the aptamer XY02 and the Tth enzyme in Example 2.

[0027] Figure 4 This is a comparison chart of the detection results of qPCR performed on the conjugate of aptamer XY01 and Tth enzyme and Tth enzyme as a DNA amplification enzyme in Example 3.

[0028] Figure 5 This is a graph showing the detection results of qPCR in Example 4, in which the conjugate of aptamer XY01 and Tth enzyme placed at 4° C. for 7 days was used as a DNA amplification enzyme.

[0029] Figure 6 This is a graph showing the detection results of qPCR in Example 4 using Tth enzyme placed at 4°C for 7 days as a DNA amplification enzyme. DETAILED DESCRIPTION

[0030] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0031] In the present invention, unless otherwise specified, "Tth DNA polymerase", "Tth polymerase" and "Tth enzyme" have the same meaning and can be used interchangeably.

[0032] In the present invention, "KD value" is a characterization parameter used to describe the affinity between the nucleic acid aptamer and the Tth enzyme. The smaller the value, the higher the affinity between the nucleic acid aptamer and the Tth enzyme. The calculation formula of the KD value is as follows:

[0033] KD = Kd / Ka; Kd is the dissociation constant; Ka is the binding constant.

[0034] Usually, the KD value can be detected by methods such as surface plasmon resonance (usually the KD value test result can be directly read through the supporting software of the detection instrument).

[0035] In the present invention, unless otherwise specified, "non-freezing low temperature" refers to a temperature that does not reach the freezing condition but is lower than the normal room temperature, for example, it can be a conventional refrigeration temperature (for example, 1-10°C); "normal temperature" refers to a temperature lower than the melting temperature of the nucleic acid aptamer, usually room temperature, i.e., below 30°C (for example, 20-30°C); "high temperature" refers to a temperature that reaches or exceeds the temperature at which the secondary structure of the nucleic acid aptamer is opened so that the activity of the Tth enzyme bound thereto is restored (this process can also be called the "melting" of the nucleic acid aptamer), usually above 55°C, preferably 55-60°C.

[0036] The inventors of the present invention screened and obtained nucleic acid aptamers that can bind to Tth enzyme and have high affinity during the research process. After further research, the inventors also found that the nucleic acid aptamer can bind to the active site of Tth enzyme, so that when the two are combined, the Tth enzyme activity is lost; when the temperature rises to above the melting temperature of the nucleic acid aptamer, the aptamer melts and the Tth enzyme activity is restored. Therefore, when the nucleic acid aptamer is combined with the Tth enzyme for in vitro nucleic acid synthesis and amplification such as PCR, RT-PCR, cDNA synthesis, etc., non-specific amplification during temperature cycling can be effectively avoided, and the purity of the reaction product can be improved. Usually, enzymes and enzyme preparations need to be stored under freezing (such as -20°C) or ultra-low temperature freezing (such as -80°C) conditions to extend the storage time, but this makes it often that the enzyme solution will cause unstable activity or even loss of activity due to repeated freezing and thawing during use. Although the enzyme solution is stored at a refrigerated temperature to avoid the effect of repeated freezing and thawing on the enzyme activity, the enzyme activity decreases rapidly due to the relatively high storage temperature, so conventional enzyme solutions or enzyme preparations cannot be stored for a long time at non-frozen low temperatures (such as refrigeration temperatures). When the nucleic acid aptamer of the present invention is combined with the Tth enzyme, it can better protect the enzyme active site, so that it can be stored for a long time at room temperature or non-freezing low temperature.

[0037] Based on this, the first aspect of the present invention provides a nucleic acid aptamer that binds to Tth DNA polymerase, wherein the nucleotide sequence of the nucleic acid aptamer has at least 30% homology with the following sequence (1) and / or (2):

[0038] (1) the DNA sequence shown in SEQ ID NO: 1;

[0039] (2) The DNA sequence shown in SEQ ID NO:2.

[0040] ATTGGCACTCCACGCATAGGGGAGGACGCGAAACGTATAGGCTC TGGGGTACGTGTCCTATGCGTGCTACCGTGAA(SEQ ID NO:1)

[0041] ATTGGCACTCCACGCATAGGCTGCGTCGCAATGGGTGAGGTAGG TAGGTAGTGTTACCTATGCGTGCTACCGTGAA(SEQ ID NO:2)

[0042] In the present invention, "having at least x% homology" means that the nucleotide sequence of the nucleic acid aptamer is identical to the specified sequence, i.e., at least x% of the above sequence (1) and / or (2). For example, the nucleotide sequence of the nucleic acid aptamer may contain additional nucleotides at the 3' end and / or the 5' end on the basis of the specified sequence, or the nucleotide sequence of the nucleic acid aptamer may be a nucleotide sequence lacking some nucleotides at one or some sites on the basis of the specified sequence (for example, in some cases, it may be a partial continuous sequence intercepted on the basis of the specified sequence, preferably, the partial continuous sequence intercepted on the basis of the specified sequence includes at least 15 continuous nucleotides in the specified sequence, for example, it may be 15-20 continuous nucleotides), or the nucleotide sequence of the nucleic acid aptamer may be a nucleotide sequence substitution at one or some sites on the basis of the specified sequence, or the nucleotide sequence of the nucleic acid aptamer may also have a combination of the above-mentioned situations.

[0043] The nucleotide sequence of the nucleic acid aptamer provided by the present invention can be a sequence having at least 30% homology with any one of the sequences in (1) and (2), or a combination of sequences having at least 30% homology with both sequences in (1) and (2).

[0044] According to a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer has at least 50% homology with the sequence of (1) and / or (2), preferably at least 80% homology.

[0045] For example, there can be 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 100% homology.

[0046] Preferably, the nucleotide sequence of the nucleic acid aptamer includes the sequence of (1) and / or (2). For example, the nucleotide sequence of the nucleic acid aptamer may be a sequence that contains several nucleotides additionally on the basis of the sequence of (1) and / or (2), and has the homology therewith as described above.

[0047] Preferably, the KD value between the nucleic acid aptamer and Tth DNA polymerase is no more than 10 nM, preferably 0.5 nM-7 nM.

[0048] For example, the KD value of the nucleic acid aptamer and Tth DNA polymerase can be 0.5nM, 1nM, 1.5nM, 2nM, 2.5nM, 3nM, 3.5nM, 4nM, 4.5nM, 5nM, 5.5nM, 6nM, 6.5nM, 7nM, or a range consisting of any two of the above values, or any intermediate value in the range.

[0049] According to a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO:1.

[0050] According to a preferred embodiment of the present invention, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO:2.

[0051] According to a preferred embodiment of the present invention, the nucleic acid aptamer may be modified or remodeled. In the present invention, the modification or remodeling may be conventional modification or remodeling of nucleic acid sequences, especially nucleic acid aptamers, in the art.

[0052] Preferably, the modification or transformation comprises: performing backbone transformation on the basis of nucleic acid aptamers.

[0053] For example, the backbone modification may include modifying the backbone of the nucleic acid aptamer by at least one of phosphorylation, methylation, amination, sulfhydrylation, replacing oxygen with sulfur, replacing oxygen with selenium, and isotopization.

[0054] For another example, the backbone modification may be to modify the nucleotide sequence backbone of the nucleic acid aptamer into a phosphorothioate backbone or a peptide nucleic acid.

[0055] Preferably, the modification or transformation includes: connecting a chemical modification group on the basis of the nucleic acid aptamer. Any chemical group commonly used for nucleic acid modification in the art can be used to modify the nucleic acid aptamer of the present invention.

[0056] It should be understood that in the aptamers provided by the present invention, the above-mentioned modification or transformation methods may exist in only one manner or in multiple manners. For example, in the aptamer, only a chemical modification group may be connected, or only a skeleton modification may be performed; for another example, in the aptamer, a skeleton modification and a modification group may be simultaneously performed.

[0057] The term "phosphorothioate backbone" used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA nucleic acid aptamers can be replaced by one or two sulfur atoms to produce a phosphorothioate backbone with phosphorothioate or phosphorodithioate bonds, respectively.

[0058] The term "peptide nucleic acid" used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to an artificially synthesized DNA molecule analog, first reported by Nielsen et al. in 1991. As shown in the following formula (I) and formula (II), N-2-(aminoethyl)-glycine units are used to replace the sugar-phosphate backbone as a repeating structural unit, and oligonucleotide mimics connected by peptide bonds are synthesized, which are called peptide nucleic acids.

[0059]

[0060] Preferably, after modification and / or transformation, the nucleic acid aptamer is still able to bind to the Tth enzyme, and its affinity is not less than 85% of the affinity of the nucleic acid aptamer to the Tth enzyme before modification and / or transformation.

[0061] Preferably, after modification and / or transformation, the stability of the nucleic acid aptamer is not less than 90% of the stability of the nucleic acid aptamer before modification and / or transformation.

[0062] Preferably, after modification and / or transformation, the resistance of the nucleic acid aptamer to nuclease degradation is not less than 90% of the resistance of the nucleic acid aptamer before modification and / or transformation.

[0063] According to a preferred embodiment of the present invention, the nucleic acid aptamer is further connected to a marker. In the present invention, the "marker" can be a substance commonly used in the art to label nucleic acids for the purpose of treatment, detection, research, etc.

[0064] Preferably, the marker comprises at least one of a fluorescent marker, a radioactive marker, siRNA, a nanoluminescent marker, a chemiluminescent marker, an enzyme marker and a drug.

[0065] For example, the marker can be a fluorescent group (such as FAM, ROX, VIC, etc.), a radioactive isotope, a drug (such as biotin, digoxin), a nanomaterial (such as upconversion particles, MOF, nanogold, etc.), a small peptide (such as Tis-tag, etc.), siRNA or an enzyme marker, etc.

[0066] Preferably, after being linked to the marker, the nucleic acid aptamer is still able to bind to the Tth enzyme, and its affinity is not less than 85% of the affinity of the nucleic acid aptamer to the Tth enzyme before being linked to the marker, preferably not less than 90%.

[0067] Preferably, after the label is linked, the stability of the nucleic acid aptamer is not less than 90% of the stability of the nucleic acid aptamer before the label is linked.

[0068] Preferably, after the label is attached, the resistance of the nucleic acid aptamer to nuclease degradation is not less than 90% of the resistance of the nucleic acid aptamer before the label is attached.

[0069] The second aspect of the present invention provides an application of the nucleic acid aptamer described in the first aspect, wherein the application comprises at least one of the following:

[0070] (a) Application in detecting Tth DNA polymerase;

[0071] (b) Application in purification of Tth DNA polymerase;

[0072] (c) Application in prolonging the storage time of Tth DNA polymerase (especially application in prolonging the storage time of Tth DNA polymerase at room temperature or non-refrigerated low temperature);

[0073] (d) Use as a hot start molecule for Tth DNA polymerase;

[0074] (e) Use in the preparation of drugs targeting Tth DNA polymerase.

[0075] According to a preferred embodiment of the present invention, application (a) can be to use the nucleic acid aptamer provided by the present invention to detect the sample to be tested, and to perform quantitative or qualitative detection of the Tth enzyme in the sample.

[0076] According to a preferred embodiment of the present invention, application (b) can be to mix the nucleic acid aptamer provided by the present invention with a sample containing Tth enzyme, and purify the Tth enzyme by utilizing the property that the nucleic acid aptamer can specifically bind to the Tth enzyme.

[0077] According to a preferred embodiment of the present invention, application (c) may include adding the nucleic acid aptamer provided by the present invention to a solution sample containing the Tth enzyme. Through the specific binding of the nucleic acid aptamer to the active site of the Tth enzyme and the protective effect on the active site of the enzyme, the Tth enzyme after adding the nucleic acid aptamer can be stored for a long time at room temperature or at a non-frozen low temperature. For example, after adding the nucleic acid aptamer of the present invention, the storage time of the Tth enzyme (solution) at 25°C or 4°C can reach more than twice the storage time before addition, preferably 3-5 times. The storage time refers to the time taken for the enzyme activity of the solution sample containing the Tth enzyme to decrease to 90% of the enzyme activity when freshly prepared.

[0078] According to a preferred embodiment of the present invention, application (c) may also include mixing the nucleic acid aptamer provided by the present invention with the Tth enzyme in a solution and drying (e.g., freeze drying) after specifically binding to the mixture. The Tth enzyme in the obtained freeze-dried preparation is similar to the solution sample and can also be stored for a long time at room temperature or non-frozen low temperature. For example, after binding with the nucleic acid aptamer of the present invention, the storage time of the Tth enzyme (lyophilized agent) at 25°C or 4°C can reach more than twice the storage time of the Tth enzyme not bound to the nucleic acid aptamer, preferably 3-5 times. The storage time refers to the time taken for the enzyme activity in the solution obtained when the Tth enzyme lyophilized agent or the lyophilized agent of the combination of the Tth enzyme and the nucleic acid aptamer is re-dissolved in the same amount to be reduced to 90% of the enzyme activity of the freshly prepared lyophilized agent when it is re-dissolved in the same amount.

[0079] According to a preferred embodiment of the present invention, application (d) may include combining the nucleic acid aptamer provided by the present invention with the Tth enzyme, controlling the structural change of the nucleic acid aptamer by temperature, and thereby controlling the release and shutdown of the Tth enzyme activity.

[0080] According to a preferred embodiment of the present invention, application (e) may include connecting the nucleic acid aptamer provided by the present invention to a drug molecule, and using the nucleic acid aptamer's ability to specifically recognize and bind to the Tth enzyme to target the drug molecule to the Tth enzyme. For example, it can be used in research work to explore the effects of certain drug molecules on the Tth enzyme, or drugs known to have specific transformation or modification functions for the Tth enzyme can be targeted to the Tth enzyme.

[0081] The third aspect of the present invention provides a Tth DNA polymerase preparation, which comprises a nucleic acid aptamer and Tth DNA polymerase, wherein the nucleic acid aptamer is the nucleic acid aptamer described in the first aspect.

[0082] According to a preferred embodiment of the present invention, in the preparation, the content of the nucleic acid aptamer is 1-20 nM relative to 1 U of Tth DNA polymerase.

[0083] For example, relative to 1U of Tth DNA polymerase, the content of nucleic acid aptamer can be 1nM, 2nM, 3nM, 4nM, 5nM, 6nM, 7nM, 8nM, 9nM, 10nM, 11nM, 12nM, 13nM, 14nM, 15nM, 16nM, 17nM, 18nM, 19nM, 20nM, or it can be a range consisting of any two of the above values, or any intermediate value in the range.

[0084] Preferably, in the preparation, the content of nucleic acid aptamer is 5-15 nM relative to 1 U of Tth DNA polymerase.

[0085] According to a preferred embodiment of the present invention, the preparation may be a liquid preparation or a solid preparation.

[0086] Preferably, the liquid preparation comprises water and / or TE buffer. That is, the liquid preparation is prepared with water or TE buffer. The water used to prepare the liquid preparation in the present invention can be any water commonly used in the preparation of nucleic acid liquid preparations in the art, for example, ultrapure water, deionized water, sterile water, etc. In order to avoid degradation of nucleic acid aptamers in the liquid preparation, it is preferred that the water and TE buffer used to prepare the liquid preparation do not contain nuclease. TE buffer is a buffer solution prepared with Tris and EDTA, which can be used to stably store nucleic acids. The present invention has no particular restrictions on the specific source of the TE buffer used in the liquid preparation, which can be a commercial product directly purchased through commercial channels, or it can be prepared by itself according to the prior art.

[0087] According to a preferred embodiment of the present invention, the Tth enzyme and the nucleic acid aptamer in the preparation can be mixed and packaged, or can be packaged separately.

[0088] For example, the preparation can be a liquid preparation in which a conjugate of Tth enzyme and nucleic acid aptamer is dissolved in water / buffer; it can be a buffer solution kit in which Tth enzyme and nucleic acid aptamer are dissolved in water / buffer respectively and stored separately; it can also be a reagent kit in which powdered Tth enzyme and water / buffer solution containing nucleic acid aptamer are stored separately; it can also be a solid preparation (lyophilized powder) obtained by freeze-drying a liquid preparation in which a conjugate of Tth enzyme and nucleic acid aptamer is dissolved in water / buffer; it can also be a solid reagent kit in which powdered Tth enzyme and nucleic acid aptamer are separately stored after freeze-drying; it can also be a mixed solid (powder) reagent in which powdered Tth enzyme and nucleic acid aptamer are mixed and packaged after freeze-drying.

[0089] In order to simplify the operation during use and reduce the packaging cost, according to some preferred embodiments of the present invention, the nucleic acid aptamer and Tth DNA polymerase in the preparation are mixed and packaged, and the nucleic acid aptamer and Tth DNA polymerase are combined in the preparation.

[0090] The above-mentioned preparation provided by the present invention can replace Tth enzyme as an amplification enzyme / reverse transcriptase in common in vitro nucleic acid amplification / synthesis reactions such as PCR, cDNA synthesis (i.e., RT-PCR). When the preparation is used, since the nucleic acid aptamer in the preparation binds to the Tth enzyme and can achieve the closure and release of the Tth enzyme activity under the influence of temperature, compared with using Tth enzyme alone, non-specific amplification during the reaction process, especially before the start of temperature cycling, can be effectively avoided, thereby improving the purity of the reaction product.

[0091] The fourth aspect of the present invention provides the use of the nucleic acid aptamer described in the first aspect, or the preparation described in the third aspect in polymerase chain reaction (PCR) and related reactions.

[0092] According to a preferred embodiment of the present invention, the (PCR)-related reaction may include at least one of RT-PCR and / or cDNA synthesis. RT-PCR refers to the process of reverse transcribing an RNA sample to form cDNA, and then further amplifying the cDNA by PCR, and cDNA synthesis refers to the process of reverse transcribing an RNA sample to form cDNA.

[0093] The present invention further provides the use of the nucleic acid aptamer described in the first aspect, or the preparation described in the third aspect, in improving the purity of reaction products of polymerase chain reaction and related reactions.

[0094] After the nucleic acid aptamer provided by the present invention is combined with the Tth enzyme, when the temperature reaches the melting temperature of the aptamer, the Tth enzyme can exert its activity as an amplification enzyme / reverse transcriptase. Compared with the Tth enzyme modified with other hot start molecules (such as antibodies, etc.), the combination of the nucleic acid aptamer and Tth enzyme of the present invention has a shorter thermal activation time when used, thereby shortening the overall reaction time.

[0095] The present invention further provides the use of the nucleic acid aptamer described in the first aspect, or the preparation described in the third aspect, in shortening the reaction time of polymerase chain reaction and related reactions.

[0096] The fifth aspect of the present invention provides a method for in vitro synthesis and / or amplification of nucleic acids, the method comprising using the preparation described in the third aspect as an RNA reverse transcriptase and / or DNA polymerase to perform in vitro synthesis and / or amplification of nucleic acids.

[0097] According to a preferred embodiment of the present invention, the in vitro nucleic acid synthesis and / or amplification may include at least one of PCR, RT-PCR and cDNA synthesis.

[0098] For example, the preparation provided by the present invention can be used as a DNA polymerase for PCR reaction; for example, the preparation provided by the present invention can be used as an RNA reverse transcriptase for cDNA synthesis; for another example, the preparation provided by the present invention can also be used as both an RNA reverse transcriptase and a DNA for RT-PCR reaction.

[0099] According to a preferred embodiment of the present invention, when nucleic acid is synthesized and / or amplified in vitro, the activation temperature of the Tth enzyme in the preparation is 55-60°C.

[0100] For example, the activation temperature of the Tth enzyme in the preparation can be 55°C, 55.5°C, 56°C, 56.5°C, 57°C, 57.5°C, 58°C, 58.5°C, 59°C, 59.5°C, 60°C, or a range consisting of any two of the above values, or any intermediate value in the range.

[0101] Most preferably, the activation temperature of the Tth enzyme in the formulation is 57°C.

[0102] Preferably, the temperature at which the preparation performs in vitro nucleic acid synthesis and / or amplification as an RNA reverse transcriptase is 50-55° C. That is, the temperature at which the preparation exerts reverse transcriptase activity is 50-55° C.

[0103] For example, the temperature at which the preparation acts as an RNA reverse transcriptase for in vitro nucleic acid synthesis and / or amplification can be 50°C, 50.5°C, 51°C, 51.5°C, 52°C, 52.5°C, 53°C, 53.5°C, 54°C, 54.5°C, or 55°C, or a range consisting of any two of the above values, or any intermediate value in the range.

[0104] Preferably, the temperature at which the preparation performs in vitro nucleic acid amplification as a DNA polymerase is 70-74° C. That is, the temperature at which the preparation exerts DNA polymerase activity is 70-74° C.

[0105] For example, the temperature at which the preparation acts as a DNA polymerase for in vitro amplification of nucleic acids can be 70°C, 70.5°C, 71°C, 71.5°C, 72°C, 72.5°C, 73°C, 73.5°C, or 74°C, or a range consisting of any two of the above values, or any intermediate value in the range.

[0106] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0107] In the following examples, unless otherwise specified, the reagents and materials used are all commercial products purchased from regular chemical or biological reagent / material suppliers, and the reagent purity is analytically pure. The Tth polymerase used in the following examples was purchased from Baoriyi Biotechnology (Beijing) Co., Ltd., with the item number R510A; the DPBS buffer formula is as follows: calcium chloride 0.1g / L, potassium chloride 0.2g / L, potassium dihydrogen phosphate 0.2g / L, magnesium chloride hexahydrate 0.1g / L, sodium chloride 8g / L, disodium hydrogen phosphate dodecahydrate 2.8915g / L; pH 7.4 (25°C).

[0108] Example 1

[0109] This example is used to illustrate the screening of nucleic acid aptamers provided by the present invention.

[0110] The method for screening a ssDNA nucleic acid aptamer that binds to Tth polymerase in this embodiment comprises the following steps:

[0111] 1. Synthesize random single-stranded DNA library and primers:

[0112] The DNA library was synthesized by Shanghai Sangon Biotechnology Co., Ltd., and the primers were synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0113] Random single-stranded DNA library: composed of the nucleotide sequence shown in SEQ ID NO: 3, the 36N sequence and the nucleotide sequence shown in SEQ ID NO: 4 connected in sequence from the 5' end to the 3' end, wherein the 36N sequence refers to a sequence formed by connecting 36 arbitrary nucleotide bases.

[0114] ATTGGCACTCCACGCATAGG(SEQ ID NO:3)

[0115] CCTATGCGTGCTACCGTGAA(SEQ ID NO:4)

[0116] The primer sequences are specifically shown in Table 1. Among them, S in the primer name represents the forward primer, and A in the primer name represents the reverse primer.

[0117] Table 1 Primers and their sequences

[0118]

[0119] The primers were prepared into 100 μM stock solutions with DPBS buffer and stored at -20°C for future use.

[0120] 2. Magnetic bead screening

[0121] The magnetic bead method was used to screen the aptamers in the above library for a total of 6 rounds.

[0122] Each round of screening process includes reverse screening and positive screening. The reverse screening uses carboxyl magnetic beads (MB-His) coupled with His small peptide (a small peptide with 6 His in series, commissioned by Nanjing GenScript Biotechnology Co., Ltd. for chemical synthesis) for screening; the positive screening uses carboxyl magnetic beads (MB-TTH) coupled with Tth enzyme for screening. The specific screening process is as follows:

[0123] First round of screening: Take 1OD from the synthesized DNA library, centrifuge at 14000rpm for 10min, remove the supernatant, add DPBS buffer to prepare a 10μM library solution. The library solution is dispensed into PCR tubes, placed in a PCR instrument, and maintained at 95℃ for 10min to open the secondary structure of the aptamer (i.e., the aptamer melts), then maintained at 4℃ for 5min and equilibrated to room temperature.

[0124] The library solution after treatment was added to 50 μL of MB-His and incubated at room temperature on a vertical mixer. After incubation, it was placed on a magnetic stand, the supernatant was collected, and then the collected supernatant was mixed with 50 μL of MB-TTH and incubated at room temperature on a vertical mixer. After incubation, it was placed on a magnetic stand, the supernatant was removed, and the magnetic beads were washed 4 times with 200 μL of DPBS buffer. After washing, the magnetic beads were suspended with 200 μL of DPBS buffer and boiled in a water bath for 10 minutes. The obtained supernatant was named elution-TTH.

[0125] The nucleic acid molecules in elution-TTH were used as templates and amplified by ordinary PCR. The method is as follows: all template elution-TTH was added to 2mL PCR mix (purchased from Baorui Bio, 2X STR Premix (079201)) and mixed evenly, the template and PCR mix mixture was divided into 100μL / tube and added to the PCR tube, placed in the PCR instrument and amplified according to the following conditions: 95℃ pre-denaturation for 2 minutes; 95℃ denaturation for 60 seconds, 60℃ annealing for 60 seconds, 72℃ extension for 60 seconds, a total of 25 cycles, and stored at 4℃.

[0126] The amplified product was purified using SA magnetic beads (SM017100) purchased from Huatiandi Renhe Biotechnology Co., Ltd. to prepare a secondary library for the next round of screening.

[0127] The 2nd to 6th rounds of screening: The operation is the same as the 1st round of screening, except that each round uses the secondary library obtained from the previous round of screening as the starting screening library.

[0128] During the screening process, surface plasmon resonance (SPR) was used to detect the changes in the recognition ability of the DNA single-stranded library for Tth polymerase. When the recognition ability of the DNA single-stranded library for Tth polymerase meets the requirements, that is, the binding ability of the screened DNA single-stranded library with the target protein gradually increases ( Figure 1 ),from Figure 1 As can be seen from the figure, as the screening progresses, the retention rate increases significantly from the second round and reaches a peak in the fifth round, indicating that the binding affinity between the aptamer and the target is significantly improved with the increase in the number of screening rounds. The obtained library is analyzed by high-throughput sequencing to meet the sequencing requirements.

[0129] 3. Analysis and identification of nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the obtained enriched library products, two aptamer sequences with the strongest affinity were finally selected and named XY01 and XY02, respectively. Their nucleotide sequences are shown in Table 2 below.

[0130] Table 2 Screened aptamers

[0131]

[0132] Example 2

[0133] This example is used to illustrate the Tth enzyme affinity of the nucleic acid aptamer provided by the present invention.

[0134] Suzhou Genewise Biotechnology Co., Ltd. was commissioned to synthesize nucleic acid aptamers with sequences as shown in SEQ ID NO.1 and SEQ ID NO.2, and diluted them with DPBS buffer to 12.5 nM, 25 nM, 50 nM, 100 nM, 200 nM, and 400 nM for use.

[0135] 1. Tth polymerase was coupled to the second channel on the surface of CM5 chip (purchased from Beijing Bio-Technology Co., Ltd.) as follows: first, the chip was cleaned with 50 mM NaOH, 20 μL was injected, and the flow rate was 10 μL / min. Then, equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) were mixed and 50 μL was injected to activate the chip, and the flow rate was 5 μL / min. Tth polymerase was diluted with 10 mM NaAc solution at pH = 4 to a final concentration of 50 μg / mL and then injected, with an injection volume of 50 μL, a flow rate of 5 μL / min, and the amount of Tth polymerase coupled was 4000 Ru. After the injection was completed, ethanolamine was injected to seal the chip, with a flow rate of 10 μL / min and an injection volume of 100 μL. Wherein, Ru is the response value (response), which is the unit of resonance angle in SPR, 1RU = 10 -4According to measurement experience, the resonance angle increases by 1000RU, which is about 1ng / mm 2 of proteins attached to the surface.

[0136] Channel 1 and channel 2 were treated in the same way, except that the Tth enzyme was replaced with 4000Ru BSA as the control channel.

[0137] 2. Detection: Surface plasmon resonance (GE Healthcare, model: Biacore 8K) was used to set the detection parameters. The diluted two aptamer samples flowed through channels 1 and 2 in turn. The program for each aptamer was as follows: injection 30 μL / min, time 2 min, dissociation 30 μL / min, time 2 min, regeneration 1 M NaCl 30 μL / min, time 30 s.

[0138] The affinity test data of nucleic acid aptamers and Tth polymerase are shown in Figure 2-3 , Figure 2 This is the affinity test diagram of aptamer XY01 and Tth polymerase; Figure 3 The affinity test diagram of aptamer XY02 and Tth polymerase is shown in Table 3. The KD value test results were read by the instrument supporting software, and the specific results are shown in Table 3. It can be seen that the KD values ​​of the two nucleic acid aptamers are small, reaching the nM level, indicating that the corresponding nucleic acid aptamers have strong binding ability with the target protein Tth polymerase.

[0139] Table 3 Affinity of nucleic acid aptamers to Tth polymerase (the smaller the KD value, the greater the affinity)

[0140] Aptamers Affinity for Tth polymerase KD (nM) XY01 (SEQ ID NO: 1) 5.03 XY02 (SEQ ID NO: 2) 4.73

[0141] Example 3

[0142] This example is used to illustrate the effect of the nucleic acid aptamer provided by the present invention as a hot start molecule of the Tth enzyme.

[0143] The genomic RNA of the 2019n-CoV virus (GenBank ID: NC_045512.2) was used as a template and the primers in Table 4 were used for real-time fluorescence PCR (qPCR) reaction.

[0144] Table 4 Primer sequences

[0145] name Sequence 5'-3' SEQ ID NO Upstream primer CTGGACTTCCCTATGGT 9 Downstream primer TGATCTTTTGGTGTATTCAAGGCT 10 Probe Fam-TGCAACCCATATGATGCCGT-MGB 11

[0146] The qPCR reaction system was prepared according to Table 5, and the qPCR conditions were set as follows: reverse transcription at 50°C for 2 minutes; denaturation at 95°C for 15 seconds, annealing and extension at 60°C for 30 seconds, for a total of 45 cycles.

[0147] Table 5 qPCR reaction system

[0148] Reagents Final concentration <![CDATA[MgCl2]]> 4mM dNTPs(100mM) 0.25mM Upstream primer 200nM Downstream primer 200nM Probe 100nM Enzyme (5U / μL) 5U 1x PCR buffer Make up to a total volume of 50 μL

[0149] In the qPCR reaction, the enzyme used in the experimental group was the conjugate of the aptamer XY01 and Tth enzyme (Atp-Tth) obtained in Example 1, wherein the Tth enzyme activity was 5 U / μL; the enzyme used in the control group was Tth enzyme, and the enzyme activity was 5 U / μL.

[0150] The preparation method of Atp-Tth is as follows:

[0151] 1. Treatment of aptamers: Add 1.5 μL, 100 μM aptamers to 98.5 μL binding solution, treat at 95°C for 5 minutes, and then quickly anneal in a -20°C refrigerator for 5 minutes to obtain an annealed aptamer solution. The binding solution is Tris-HCl buffer.

[0152] 2. Combination of aptamer and enzyme: directly add 30 μL Tth original enzyme solution (5 U / μL, prepared with Tris-HCl buffer) to the above 100 μL annealed aptamer solution, mix well and place at 4°C for 20 min to obtain Atp-Tth solution (enzyme activity 5 U / μL).

[0153] Test results such as Figure 4 As shown in the figure, when Atp-Tth is used for qPCR, its activity as a DNA amplification enzyme is significantly higher than that of Tth enzyme alone.

[0154] The same method was used to detect the conjugate of aptamer XY02 and Tth enzyme, and similar results were obtained.

[0155] Example 4

[0156] This example is used to illustrate the stability of the nucleic acid aptamer provided by the present invention.

[0157] The genomic RNA of the 2019n-CoV virus (GenBank ID: NC_045512.2) was amplified using the conjugate of aptamer XY01 and Tth enzyme (Atp-Tth) and Tth enzyme respectively according to the method of Example 3. The difference is that the Atp-Tth and Tth enzymes used in this example were placed at 4°C for 7 days before use. Figure 5-6 The melting curves of qPCR using Atp-Tth and Tth as amplification enzymes are shown respectively. It can be seen from the figure that after storage at 4°C for 7 days, the melting curve using Atp-Tth presents a single peak, indicating that there are no non-specific products, while using Tth enzyme presents a miscellaneous peak, and the peak of the amplification product is significantly reduced, indicating that non-specific amplification occurs.

[0158] The same method was used to perform qPCR using a conjugate of aptamer XY02 and Tth enzyme placed at 4°C for 7 days as an amplification enzyme, and similar results were obtained.

[0159] It can be seen that compared with the simple Tth enzyme, the combination of the aptamer provided by the present invention and the Tth enzyme has better stability, which also shows that the combination of the nucleic acid aptamer provided by the present invention promotes the long-term preservation of the Tth enzyme.

[0160] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A nucleic acid aptamer that binds to Tth DNA polymerase, characterized in that: The nucleotide sequence of the nucleic acid aptamer has at least 30% homology with the following sequences (1) and / or (2): (1) the DNA sequence shown in SEQ ID NO: 1; (2) The DNA sequence shown in SEQ ID NO:

2.

2. The nucleic acid aptamer according to claim 1, wherein The nucleotide sequence of the nucleic acid aptamer has at least 50% homology with the sequence of (1) and / or (2), preferably at least 80% homology; Preferably, the nucleotide sequence of the nucleic acid aptamer includes the sequence of (1) and / or (2); Preferably, the KD value of the nucleic acid aptamer and Tth DNA polymerase is no more than 10nM, preferably 0.5nM-7nM; More preferably, the nucleotide sequence of the nucleic acid aptamer is as shown in SEQ ID NO:1 or SEQ ID NO:

2.

3. The nucleic acid aptamer according to claim 1 or 2, wherein The nucleic acid aptamer is also modified or transformed; Preferably, the modification or transformation includes: backbone transformation based on the nucleic acid aptamer; Preferably, the modification or transformation comprises: connecting a chemical modification group to the nucleic acid aptamer; And / or, the nucleic acid aptamer is also connected to a marker; Preferably, the marker comprises at least one of a fluorescent marker, a radioactive marker, siRNA, a nanoluminescent marker, a chemiluminescent marker, an enzyme marker and a drug.

4. The use of the nucleic acid aptamer according to any one of claims 1 to 3, characterized in that: The application includes at least one of the following: (a) Application in detecting Tth DNA polymerase; (b) Application in purification of Tth DNA polymerase; (c) Application in prolonging the storage time of Tth DNA polymerase; (d) Use as a hot start molecule for Tth DNA polymerase; (e) Use in the preparation of drugs targeting Tth DNA polymerase.

5. A Tth DNA polymerase preparation, characterized in that The preparation comprises a nucleic acid aptamer and Tth DNA polymerase, wherein the nucleic acid aptamer is the nucleic acid aptamer according to any one of claims 1 to 3.

6. The preparation according to claim 5, wherein In the preparation, the content of the nucleic acid aptamer is 1-20 nM relative to 1 U of Tth DNA polymerase; Preferably, the preparation is a liquid preparation, and preferably the liquid preparation comprises water and / or TE buffer; Preferably, the preparation is a solid preparation, and preferably the solid preparation is passed through.

7. The preparation according to claim 5 or 6, wherein In the preparation, the nucleic acid aptamer and the Tth DNA polymerase are packaged independently, or the nucleic acid aptamer and the Tth DNA polymerase are packaged together; Preferably, the nucleic acid aptamer and Tth DNA polymerase are mixed and packaged in the preparation, and the nucleic acid aptamer and Tth DNA polymerase are combined in the preparation.

8. Use of the nucleic acid aptamer according to any one of claims 1 to 3, or the preparation according to any one of claims 5 to 7 in polymerase chain reaction and related reactions, preferably the related reactions include RT-PCR and / or cDNA synthesis.

9. A method for in vitro synthesis and / or amplification of nucleic acids, characterized in that: The method comprises using the preparation according to any one of claims 5 to 7 as RNA reverse transcriptase and / or DNA polymerase for in vitro nucleic acid synthesis and / or amplification.

10. The method according to claim 9, wherein: When performing in vitro nucleic acid synthesis and / or amplification, the activation temperature of the Tth enzyme in the preparation is 55-60°C; Preferably, the temperature at which the preparation performs in vitro nucleic acid synthesis and / or amplification as an RNA reverse transcriptase is 50-55°C; Preferably, the temperature at which the preparation acts as a DNA polymerase to perform in vitro nucleic acid amplification is 70-74°C.

Images