A tumor marker HE4 probe and its construction method and application

Abstract

The present invention provides a tumor marker HE4 probe and a construction method and application thereof, belonging to the field of bioanalysis technology; in the present invention, a tumor marker HE4 probe is constructed, the probe is recorded as Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe, and the linear range of the detectable concentration of the probe is 0.1pg·mL ‑1 ‑1ng·mL ‑1 , the detection limit is 0.01pg·mL ‑1 , the limit of quantification was 125.3 fg·mL ‑1 ; The present invention also constructs an electrochemical nucleic acid sensor based on the probe, which has a good application in HE4.

Description

Technical Field

[0001] The invention belongs to the technical field of biological analysis, and in particular relates to a tumor marker HE4 probe and a construction method and application thereof. Background Art

[0002] Human epididymis protein 4 (HE4), also known as WAP four disulfide core protein 2 (WFDC2), is located on chromosome 20q12-13, with a total length of about 12kb, consisting of 5 exons and 4 introns. It belongs to the protein family of orotic acid type four disulfide bond core domains and may have trypsin inhibitory activity. Under normal physiological conditions, HE4 is expressed at low levels in the reproductive system and ovarian tissues, but is highly expressed in ovarian cancer tissues and patient serum. Therefore, HE4 can be used as a tumor screening marker and has important clinical value.

[0003] At present, there are many methods for detecting HE4, such as enzyme immunoassay, enzyme-linked immunosorbent assay, radioimmunoassay and chemiluminescent enzyme immunoassay, etc. However, the above detection methods have the disadvantages of complex operation, time-consuming, low specificity, low stability, need for operator training, and expensive instruments and equipment. Summary of the invention

[0004] In view of some deficiencies in the prior art, the present invention provides a tumor marker HE4 probe and its construction method and application. In the present invention, a tumor marker HE4 probe is constructed, and the probe is Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe. The linear range of the probe's detectable concentration is 0.1 pg·mL -1 -1ng·mL -1 , the detection limit is 0.01pg·mL -1 , the limit of quantification was 125.3 fg·mL -1 ; The present invention also constructs an electrochemical nucleic acid sensor based on the probe, which has a good application in HE4.

[0005] The present invention first provides a tumor marker HE4 probe, which is denoted as Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe, wherein the probe connects ssDNA / Apt to the surface of Fe3O4 / α-Fe2O3@Au nanocomposite by self-assembly technology;

[0006] The sequence of the DNA aptamer (Apt) is 5'-TTATCGTACGACAGTCATCCTACAC-3', the sequence of the thiol-modified single-stranded DNA (ssDNA) is 5'-SH-TTTTTTTTTTTTTGTCGTACGAT-3', the ssDNA has a base sequence that is complementary to Apt, and SH is a thiol.

[0007] The present invention also provides a method for constructing the above tumor marker HE4 probe, and the specific steps are as follows:

[0008] S1. Preparation of Fe3O4 / α-Fe2O3@Au nanocomposites:

[0009] (1) hydrothermally reacting an aqueous solution containing FeCl3 and NH4H2PO4, centrifuging to obtain a precipitate after the reaction, washing, drying, and grinding, then mixing the ground product with glucose and calcining, and grinding to obtain magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorods after the calcination;

[0010] (2) preparing a suspension of magnetic Fe3O4 / α-Fe2O3 heterostructure nanorods, then adding polyethyleneimine solution, heating in a water bath for reaction, centrifuging, washing, and drying after the reaction is completed;

[0011] (3) The dried solid was dispersed in water, HAuCl4 solution was added and ultrasonically mixed, then trisodium citrate solution was added, and NaBH4 solution was added after stirring, and the reaction was continued with stirring. Finally, the reaction product was magnetically separated, washed, and dried to obtain a magnetic Fe3O4 / α-Fe2O3@Au nanocomposite.

[0012] Wherein, in step (1), the concentration of FeCl3 in the aqueous solution containing FeCl3 and NH4H2PO4 is 0.02 mM, and the concentration of NH4H2PO4 is 9.6×10 -4 mM;

[0013] The hydrothermal reaction conditions are constant temperature reaction at 180° C. for 12 hours;

[0014] The mass ratio of the ground product to glucose is 1:4-1:24;

[0015] The calcination conditions are as follows: the calcination temperature is 400-700° C. and the calcination time is 1-5 hours.

[0016] In step (2), the suspension of the magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorods is prepared by dispersing the magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorods in ultrapure water, and the concentration thereof is 5-30 mg / mL;

[0017] The concentrations of the suspension of magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorods and the polyethyleneimine solution are both 10 mg / mL, and the volume ratio of the suspension of magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorods to the polyethyleneimine solution is 3:80;

[0018] The hydrothermal reaction was carried out under the conditions of 90° C. for 2 h.

[0019] In step (3), the amount ratio of the dried solid, water, HAuCl4 solution, trisodium citrate solution and NaBH4 solution is 10 mg: 150 mL: 1 mL: 2 mL: 9 mL, wherein the concentration of HAuCl4 solution is 20 mg·mL -1 , the concentration of trisodium citrate solution is 38mM, and the concentration of NaBH4 solution is 0.075wt.%;

[0020] The ultrasonic mixing condition is 30-60 min at 0°C;

[0021] The stirring reaction condition is stirring at 0°C for 15-30 min.

[0022] S2. Preparation of tumor marker HE4 probe:

[0023] (4) Mixing the TCEP-activated ssDNA and Apt, denaturing at 95°C for 5 min, and then cooling and annealing to obtain double-stranded ssDNA / Apt;

[0024] The double-stranded ssDNA / Apt was activated by TCEP, and then Fe3O4 / α-Fe2O3@Au was added and continuously shaken to obtain Fe3O4 / α-Fe2O3@Au-ssDNA / Apt for later use;

[0025] Fe3O4 / α-Fe2O3@Au-ssDNA / Apt was dispersed in BSA solution and incubated. After the incubation, it was washed to obtain the tumor marker HE4 probe, which was recorded as Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe.

[0026] In step (4), the concentration and dosage of the ssDNA and Apt are the same; the dosage ratio of the ssDNA / Apt to the Fe3O4 / α-Fe2O3@Au and BSA solution is 40 μL: 0.2-1.2 mg: 50 μL, wherein the concentration of ssDNA / Apt is 5-25 μM;

[0027] The sequence of Apt is 5'-TTATCGTACGACAGTCATCCTACAC-3';

[0028] The sequence of ssDNA is 5'-SH-TTTTTTTTTTTTTGTCGTACGAT-3', wherein a base sequence in the ssDNA is complementary to Apt, and SH is a thiol group;

[0029] The concentration of the BSA solution is 0.25% (w / v);

[0030] The incubation conditions are as follows: the incubation temperature is 20-45° C., and the incubation time is 30 min-90 min.

[0031] The present invention also provides the use of the tumor marker HE4 probe in preparing an electrochemical biosensor for detecting HE4.

[0032] The present invention also provides an electrochemical biosensor for detecting HE4. The electrochemical biosensor for HE4 is prepared based on a tumor marker HE4 probe.

[0033] The specific preparation steps are as follows:

[0034] The Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe is dispersed in the HE4 protein solution and incubated with shaking. After the shaking incubation, the solid product is washed and then dispersed in a PBS solution to obtain a suspension for later use.

[0035] The suspension was dropped onto the surface of a magnetic glassy carbon electrode (MGCE) polished with alumina and dried at room temperature to obtain a magnetic glassy carbon electrode, which was recorded as MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA.

[0036] The electrochemical workstation and three-electrode system were used for testing. The obtained MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA was used as the working electrode, silver / silver chloride was used as the reference electrode, platinum wire electrode was used as the counter electrode, and [Fe(CN)6] 3- / 4- The solution was used as the electrolyte, and differential pulse voltammetry was performed using an electrochemical workstation.

[0037] The dosage ratio of Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe, HE4 protein solution and PBS solution is 5-25 μM: 40 μL: 40 μL, and the concentration of the HE4 protein solution is 100 pg·mL -1 , the pH of the PBS is 7.4; the shaking incubation condition is shaking incubation at 37° C. for 30 min.

[0038] The incubation temperature is 20-45°C and the time is 30-90min;

[0039] The amount of the suspension added is 8-10 μL;

[0040] In the electrolyte, the concentration of KCl is 0.1M, [Fe(CN)6] 3- / 4- The concentration is 5mM;

[0041] The detection range of the differential pulse voltammetry detection is 0.05-0.5V, the volume of the HE4 solution to be tested is 40μL, and the concentration is 0.1pg·mL -1 -1ng·mL -1 .

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] The present invention provides a tumor marker HE4 probe in response to existing detection technologies, which makes up for the defects of existing detection technologies and provides a nano tumor marker detection probe that is efficient, rapid, inexpensive, highly specific, and practical. In the present invention, the Fe3O4 / α-Fe2O3@Au nanocomposite is used in a signal amplification strategy. Compared with the existing Fe3O4 / α-Fe2O3@Au nanoparticles, the Fe3O4 / α-Fe2O3@Au nanorods in the present invention have a larger surface area and more Au particles are bound on the surface. The more Au particles there are, the more ssDNA / Apt is connected, which makes the detection limit lower and the detection range wider. The material has good conductivity and can better detect HE4, with a lower detection limit (4.3fg·mL -1 ), a wide linear range (0.1pg·mL -1 -1ng·mL -1 ) and better sensitivity.

[0044] In the present invention, in the process of preparing the Fe3O4 / α-Fe2O3@Au nanocomposite, polyethyleneimine is self-assembled onto the surface of Fe3O4 / α-Fe2O3 by water bath heating, so that Fe3O4 / α-Fe2O3 is positively charged, and then HAuCl4 is successfully reduced by NaBH4 to form gold nanoparticles, and citrate makes the gold nanoparticles negatively charged, and finally the magnetic Fe3O4 / α-Fe2O3@Au nanocomposite is obtained. In the present invention, the Fe3O4 / α-Fe2O3@Au nanocomposite is modified to the electrode surface by magnetic induced self-assembly technology, and α-Fe2O3 / Fe3O4@Au can be quickly removed by removing the magnetic core of MGCE, and the electrode regeneration is simple and rapid; the required equipment is not high, the operation is simple, and it is convenient to carry.

[0045] As a recognition element of electrochemical biosensors, Apt has the advantages of good stability, high specificity, and easy in vitro synthesis. The present invention uses self-assembly technology to connect ssDNA / Apt to the surface of Fe3O4 / α-Fe2O3@Au nanocomplexes through Au-S bonds. The operation is fast and simple, and no other materials are required. Apt is obtained through in vitro screening technology-exponential enrichment ligand system evolution technology. The Apt used in the present invention can produce high affinity and strong specific binding with ssDNA. A segment of ssDNA base sequence will complementarily pair with Apt, and the detection limit of the obtained probe is low and the sensitivity is good. If other sequences are replaced, a strong affinity cannot be achieved, and the detection limit and sensitivity of the obtained probe are poor.

[0046] The tumor marker HE4 probe prepared in the present invention does not require labeling or pretreatment; the detection process is fast and convenient, and the test results can be obtained in a few minutes. In addition, the amount of probe required for each test is extremely small, and the cost is low; the reaction conditions are mild, the process is easy to control, and no operator training is required; BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 This is a transmission electron microscope photograph of the Fe3O4 / α-Fe2O3@Au nanocomposite, where the scale bar in the figure is 40nm.

[0048] Figure 2 These are the cyclic voltammetry diagrams of the preparation process of Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe, where a is a bare electrode (MGCE), b is MGCE / Fe3O4 / α-Fe2O3, c is MGCE / Fe3O4 / α-Fe2O3@Au, d is MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA, e is MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / Apt, f is MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA, and g is MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA.

[0049] Figure 3 The peak current of the Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe detecting the blank group (Blank), HE4, interfering proteins (CA125, IgG, IgE, NSE) and the mixture of HE4 and interfering proteins (Mixture).

[0050] Figure 4This is a graph showing the concentration and linear range that can be detected by the Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe. DETAILED DESCRIPTION

[0051] In order to make the purpose, features and advantages of the present invention more obvious and easy to understand, the present invention is further described below in conjunction with specific embodiments and drawings, so that those skilled in the art can better understand the technical solution of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, and all other embodiments obtained by those skilled in the art without creative work, such as embodiments that only change the purpose without changing the basic principles involved in the claims, are within the scope of protection of the present invention.

[0052] The following are the raw materials used in the examples:

[0053] Tri(2-carboxyethyl)phosphine (TCEP) and bovine serum albumin (BSA) were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd.;

[0054] Human epididymis protein (HE4) was purchased from Lingchao Biotechnology (Shanghai) Co., Ltd., and DNA aptamers were purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; the sequence of the purchased DNA aptamer was 5'-TTATCGTACGACAGTCATCCTACAC-3', and the sequence of the single-stranded DNA (ssDNA) that was partially complementary to the base pairing of the DNA aptamer was 5'-SH-TTTTTTTTTTTTTGTCGTACGAT-3', where SH is a thiol group.

[0055] Example 1: Preparation of Fe3O4 / α-Fe2O3@Au nanocomposite

[0056] (1) 60 mL of 0.02 mM FeCl3 and 9.6 × 10 -4 The aqueous solution of 100 mM NH4H2PO4 was placed in a hydrothermal kettle, and then the hydrothermal kettle was placed in a calcining furnace and kept at a constant temperature of 180°C for 12 hours, and then the supernatant of the suspension was poured out, and then centrifuged to take out the precipitate; the precipitate was washed with alcohol 3 times and water 3 times, and the product was dried and then ground; then the product was fully mixed with glucose at a mass ratio of 1:20, and the crucible was placed in a series of protective atmosphere resistance furnaces and calcined at 600°C for 3 hours; after the calcination was completed, it was taken out and ground to obtain magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorods;

[0057] (2) Take 3 mL of 10 mg mL -1 The Fe3O4 / α-Fe2O3 suspension was added to 80 mL of 10 g mL -1The mixture was ultrasonically treated for 30 min in a polyethyleneimine solution. Polyethyleneimine is a dispersant of Fe3O4 / α-Fe2O3 (making Fe3O4 / α-Fe2O3 positively charged). The mixture was heated in a 90°C water bath for 2 h. During the heating process, polyethyleneimine self-assembled onto the surface of Fe3O4 / α-Fe2O3. The solid was washed with ethanol and water and dried in a vacuum at 60°C. 10 mg of the solid was ultrasonically dispersed in 150 mL of water. 1 mL of 20 mg mL -1 HAuCl4, then at 0 ℃ Ultrasonication for 30 min; 2 mL of 38 mM trisodium citrate solution was added to the mixed solution and stirred for 1 min; 9 mL of 0.075 wt.% NaBH4 was added to the mixed solution while mechanically stirring (NaBH4 successfully reduced HAuCl4 to form gold nanoparticles, and citrate made the gold nanoparticles negatively charged), and mechanical stirring was continued at 0°C for 15 min; the obtained solid was magnetically separated, washed and dried to obtain a magnetic Fe3O4 / α-Fe2O3@Au nanocomposite.

[0058] Figure 1 This is a transmission electron micrograph of the Fe3O4 / α-Fe2O3@Au nanocomposite prepared under the conditions described in this example; it can be seen from the electron micrograph that the Fe3O4 / α-Fe2O3 heterogeneous nanorods are coated with gold particles, the length of the nanorods is about 215.0 nm, the diameter is about 79.2 nm, and the average diameter of the gold particles coated on the surface is about 6.2 nm.

[0059] Example 2: Preparation of tumor marker HE4 probe and its use for detection

[0060] 50 μL of 30 μM ssDNA and 50 μL of 30 μM Apt were mixed after being activated by TCEP, and denatured at 95°C for 5 min. According to the Watson-Crick base pairing principle, the mixture was slowly cooled and annealed to form 15 μM double-stranded ssDNA / Apt. Then, TCEP was used to activate ssDNA / Apt at a constant temperature of 30°C for 1 h to eliminate disulfide bonds and set aside.

[0061] Add 0.6 mg of Fe3O4 / α-Fe2O3@Au to 40 μL of 15 μM ssDNA / Apt activated by TCEP, and oscillate continuously at 100 r / min for 2 h in a constant temperature oscillator at 37°C to allow ssDNA / Apt to bind to the Fe3O4 / α-Fe2O3@Au surface through Au-S bonds to obtain Fe3O4 / α-Fe2O3@Au-ssDNA / Apt for later use.

[0062] Fe3O4 / α-Fe2O3@Au-ssDNA / Apt was redispersed in 50 μL of 0.25% (w / v) BSA solution and incubated at 37°C for 30 min to block nonspecific sites. The solid was then washed twice with 100 μL of 20 mM PBS (pH = 7.4) to obtain the tumor marker HE4 probe, which was recorded as Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe.

[0063] In this example, the prepared tumor marker HE4 probe was constructed into an electrochemical biosensor for detecting HE4:

[0064] Take the prepared tumor marker HE4 probe and mix it in 40 μL of 100 pg mL -1 The mixture was redispersed in HE4 protein solution and incubated in a water bath at 37°C for 1 h with constant temperature shaking. Combined with magnetic separation, the solid product was washed twice with 100 μL of 20 mM PBS (pH = 7.4) solution and redispersed in 40 μL PBS (pH = 7.4) solution to allow HE4 to bind to Apt with high affinity. Apt fell off the surface of the nanocomplex and reached the solution and was removed by magnetic separation to obtain a suspension of Fe3O4 / α-Fe2O3@Au-ssDNA / BSA structure. 9 μL of the uniformly dispersed suspension was dropped onto the 3 mm MGCE surface polished with alumina for incubation. After the incubation, it was dried to obtain MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA.

[0065] The electrochemical workstation and three-electrode system were used for testing. The obtained MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA was used as the working electrode, silver / silver chloride was used as the reference electrode, and the platinum wire electrode was used as the counter electrode. 5 mM [Fe(CN)6] 3- / 4- The solution was used as an electrolyte, and differential pulse voltammetry (DPV) was performed in the range of 0.05-0.5 V using an electrochemical workstation, and the DPV current signal was 28.62 μA.

[0066] Example 3: Preparation of tumor marker HE4 probe and its use for detection

[0067] 50 μL of 10 μM ssDNA and 50 μL of 10 μM Apt were mixed after being activated by TCEP, and denatured at 95°C for 5 min. According to the Watson-Crick base pairing principle, the mixture was slowly cooled and annealed to form 5 μM double-stranded ssDNA / Apt. Then, TCEP was used to activate ssDNA / Apt at a constant temperature of 30°C for 1 h to eliminate disulfide bonds and set aside.

[0068] 1 mg of Fe3O4 / α-Fe2O3@Au was added to 40 μL of 5 μM ssDNA / Apt activated by TCEP to obtain a mixed solution, in which the concentration of Fe3O4 / α-Fe2O3@Au was 25 mg / mL. The mixed solution was continuously oscillated at 100 r / min for 2 h in a constant temperature oscillator at 37°C to allow ssDNA / Apt to bind to the surface of Fe3O4 / α-Fe2O3@Au through Au-S bonds to obtain Fe3O4 / α-Fe2O3@Au-ssDNA / Apt for later use.

[0069] Fe3O4 / α-Fe2O3@Au-ssDNA / Apt was redispersed in 50 μL of 0.25% BSA solution and incubated at 37°C for 30 min to block nonspecific sites. The solid was then washed twice with 100 μL of 20 mM PBS (pH = 7.4) to obtain the tumor marker HE4 probe, which was recorded as Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe.

[0070] In this example, the prepared tumor marker HE4 probe was constructed into an electrochemical biosensor for detecting HE4:

[0071] Take the prepared tumor marker HE4 probe and mix it in 40 μL of 100 pg mL -1 The mixture was redispersed in HE4 protein solution and incubated in a water bath at 37°C with constant temperature shaking for 75 min. Combined with magnetic separation, the solid product was washed twice with 100 μL of 20 mM PBS (pH = 7.4) and redispersed in 40 μL PBS (pH = 7.4) solution to allow HE4 to bind to Apt with high affinity. Apt fell off the surface of the nanocomplex and reached the solution, and was removed by magnetic separation to obtain a suspension. 9 μL of the uniformly dispersed suspension was dropped onto the 3 mm MGCE surface polished with alumina for incubation. After the incubation, it was dried to obtain MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA.

[0072] The electrochemical workstation and three-electrode system were used for testing. The obtained MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA was used as the working electrode, silver / silver chloride was used as the reference electrode, and the platinum wire electrode was used as the counter electrode. 5 mM [Fe(CN)6] 3- / 4- The solution was used as an electrolyte, and differential pulse voltammetry (DPV) was performed in the range of 0.05-0.5 V using an electrochemical workstation, and the DPV current signal was 61.35 μA.

[0073] Example 4: Preparation of tumor marker HE4 probe and its use for detection

[0074] 50 μL of 30 μM ssDNA and 50 μL of 30 μM Apt were mixed after being activated by TCEP, and denatured at 95°C for 5 min. According to the Watson-Crick base pairing principle, the mixture was slowly cooled and annealed to form 15 μM double-stranded ssDNA / Apt. Then, TCEP was used to activate ssDNA / Apt at a constant temperature of 30°C for 1 h to eliminate disulfide bonds and set aside.

[0075] 0.2 mg of Fe3O4 / α-Fe2O3@Au was added to 40 μL of 15 μM ssDNA / Apt activated by TCEP to obtain a mixed solution, in which the concentration of Fe3O4 / α-Fe2O3@Au was 5 mg / mL. The mixed solution was continuously oscillated at 100 r / min for 2 h in a constant temperature oscillator at 37°C to allow ssDNA / Apt to bind to the surface of Fe3O4 / α-Fe2O3@Au through Au-S bonds to obtain Fe3O4 / α-Fe2O3@Au-ssDNA / Apt for later use.

[0076] Fe3O4 / α-Fe2O3@Au-ssDNA / Apt was redispersed in 50 μL of 0.25% BSA solution and incubated at 37°C for 30 min to block nonspecific sites. The solid was then washed twice with 100 μL of 20 mM PBS (pH = 7.4) to obtain the tumor marker HE4 probe, which was recorded as Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe.

[0077] In this example, the prepared tumor marker HE4 probe was constructed into an electrochemical biosensor for detecting HE4:

[0078] Take the prepared tumor marker HE4 probe and mix it in 40 μL of 100 pg mL -1 The mixture was redispersed in HE4 protein solution and incubated in a water bath at 20°C with constant temperature shaking for 75 min. Combined with magnetic separation, the solid product was washed twice with 100 μL of 20 mM PBS (pH = 7.4) and redispersed in 40 μL PBS (pH = 7.4) solution to allow HE4 to bind to Apt with high affinity. Apt fell off the surface of the nanocomplex and reached the solution, and was removed by magnetic separation to obtain a suspension. 8 μL of the uniformly dispersed suspension was dropped onto the 3 mm MGCE surface polished with alumina for incubation. After the incubation, it was dried to obtain MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA.

[0079] The electrochemical workstation and three-electrode system were used for testing. The obtained MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA was used as the working electrode, silver / silver chloride was used as the reference electrode, and the platinum wire electrode was used as the counter electrode. 5 mM [Fe(CN)6] 3- / 4- The solution was used as an electrolyte, and differential pulse voltammetry (DPV) was performed in the range of 0.05-0.5 V using an electrochemical workstation, and the DPV current signal was 30.14 μA.

[0080] Example 5: Preparation of tumor marker HE4 probe and its use for detection

[0081] 50 μL of 10 μM ssDNA and 50 μL of 10 μM Apt were mixed after being activated by TCEP, and denatured at 95°C for 5 min. According to the Watson-Crick base pairing principle, the mixture was slowly cooled and annealed to form 5 μM double-stranded ssDNA / Apt. Then, TCEP was used to activate ssDNA / Apt at a constant temperature of 30°C for 1 h to eliminate disulfide bonds and set aside.

[0082] 1.2 mg of Fe3O4 / α-Fe2O3@Au was added to 40 μL of 5 μM ssDNA / Apt activated by TCEP to obtain a mixed solution, in which the concentration of Fe3O4 / α-Fe2O3@Au was 30 mg / mL. The mixed solution was continuously oscillated at 100 r / min for 2 h in a constant temperature oscillator at 37°C to allow ssDNA / Apt to bind to the surface of Fe3O4 / α-Fe2O3@Au through Au-S bonds to obtain Fe3O4 / α-Fe2O3@Au-ssDNA / Apt for later use.

[0083] Fe3O4 / α-Fe2O3@Au-ssDNA / Apt was redispersed in 50 μL of 0.25% BSA solution and incubated at 37°C for 30 min to block nonspecific sites. The solid was then washed twice with 100 μL of 20 mM PBS (pH = 7.4) to obtain the tumor marker HE4 probe, which was recorded as Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe.

[0084] In this example, the prepared tumor marker HE4 probe was constructed into an electrochemical biosensor for detecting HE4:

[0085] Take the prepared tumor marker HE4 probe and mix it in 40 μL of 10 pg mL -1The solid product was washed twice with 100 μL of 20 mM PBS (pH = 7.4) combined with magnetic separation, and then redispersed in 40 μL PBS (pH = 7.4) solution to allow HE4 to bind to Apt with high affinity. Apt fell off the surface of the nanocomplex and reached the solution, and was removed by magnetic separation to obtain a suspension. 10 μL of the uniformly dispersed suspension was dropped onto the 3 mm MGCE surface polished with alumina for incubation. After the incubation, it was dried to obtain MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA.

[0086] The electrochemical workstation and three-electrode system were used for testing. The obtained MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA was used as the working electrode, silver / silver chloride was used as the reference electrode, and the platinum wire electrode was used as the counter electrode. 5 mM [Fe(CN)6] 3- / 4- The solution was used as an electrolyte, and differential pulse voltammetry (DPV) was performed in the range of 0.05-0.5 V using an electrochemical workstation, and the DPV current signal was 46.37 μA.

[0087] Example 6: Preparation of tumor marker HE4 probe and its use for detection

[0088] 50 μL of 10 μM ssDNA and 50 μL of 10 μM Apt were mixed after being activated by TCEP, and denatured at 95°C for 5 min. According to the Watson-Crick base pairing principle, the mixture was slowly cooled and annealed to form 5 μM double-stranded ssDNA / Apt. Then, TCEP was used to activate ssDNA / Apt at a constant temperature of 30°C for 1 h to eliminate disulfide bonds and set aside.

[0089] 1 mg of Fe3O4 / α-Fe2O3@Au was added to 40 μL of 5 μM ssDNA / Apt activated by TCEP to obtain a mixed solution, in which the concentration of Fe3O4 / α-Fe2O3@Au was 25 mg / mL. The mixed solution was continuously oscillated at 100 r / min for 2 h in a constant temperature oscillator at 37°C to allow ssDNA / Apt to bind to the surface of Fe3O4 / α-Fe2O3@Au through Au-S bonds to obtain Fe3O4 / α-Fe2O3@Au-ssDNA / Apt for later use.

[0090] Fe3O4 / α-Fe2O3@Au-ssDNA / Apt was redispersed in 50 μL of 0.25% BSA solution and incubated at 37°C for 30 min to block nonspecific sites. The solid was then washed twice with 100 μL of 20 mM PBS (pH = 7.4) to obtain the tumor marker HE4 probe, which was recorded as Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe.

[0091] In this example, the prepared tumor marker HE4 probe was constructed into an electrochemical biosensor for detecting HE4:

[0092] Take the prepared tumor marker HE4 probe and mix it in 40 μL of 1 ng mL -1 The mixture was redispersed in HE4 protein solution and incubated in a water bath at 45°C for 30 min with constant temperature shaking. Combined with magnetic separation, the solid product was washed twice with 100 μL of 20 mM PBS (pH = 7.4) and redispersed in 40 μL PBS (pH = 7.4) solution to allow HE4 to bind to Apt with high affinity. Apt fell off the surface of the nanocomplex and reached the solution, and was removed by magnetic separation to obtain a suspension. 8 μL of the uniformly dispersed suspension was dropped onto the 3 mm MGCE surface polished with alumina for incubation. After the incubation, it was dried to obtain MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA.

[0093] The electrochemical workstation and three-electrode system were used for testing. The obtained MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA was used as the working electrode, silver / silver chloride was used as the reference electrode, and the platinum wire electrode was used as the counter electrode. 5 mM [Fe(CN)6] 3- / 4- The solution was used as an electrolyte, and differential pulse voltammetry (DPV) was performed in the range of 0.05-0.5 V using an electrochemical workstation, and the DPV current signal was 53.87 μA.

[0094] Example 7: Preparation of tumor marker HE4 probe and its use for detection

[0095] 50 μL of 30 μM ssDNA and 50 μL of 30 μM Apt were mixed after being activated by TCEP, and denatured at 95°C for 5 min. According to the Watson-Crick base pairing principle, the mixture was slowly cooled and annealed to form 15 μM double-stranded ssDNA / Apt. Then, TCEP was used to activate ssDNA / Apt at a constant temperature of 30°C for 1 h to eliminate disulfide bonds and set aside.

[0096] 1 mg of Fe3O4 / α-Fe2O3@Au was added to 40 μL of 15 μM ssDNA / Apt activated by TCEP to obtain a mixed solution, in which the concentration of Fe3O4 / α-Fe2O3@Au was 25 mg / mL. The mixed solution was continuously oscillated at 100 r / min for 2 h in a constant temperature oscillator at 37°C to allow ssDNA / Apt to bind to the surface of Fe3O4 / α-Fe2O3@Au through Au-S bonds to obtain Fe3O4 / α-Fe2O3@Au-ssDNA / Apt for later use.

[0097] Fe3O4 / α-Fe2O3@Au-ssDNA / Apt was redispersed in 50 μL of 0.25% BSA solution and incubated at 37°C for 30 min to block nonspecific sites. The solid was then washed twice with 100 μL of 20 mM PBS (pH = 7.4) to obtain the tumor marker HE4 probe, which was recorded as Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe.

[0098] In this example, the prepared tumor marker HE4 probe was constructed into an electrochemical biosensor for detecting HE4:

[0099] Take the prepared tumor marker HE4 probe and mix it in 40 μL of 1 ng mL -1 The mixture was redispersed in HE4 protein solution and incubated in a water bath at 37°C with constant temperature shaking for 1 h. Combined with magnetic separation, the solid product was washed twice with 100 μL of 20 mM PBS (pH = 7.4) and redispersed in 40 μL PBS (pH = 7.4) solution to allow HE4 to bind to Apt with high affinity. Apt fell off the surface of the nanocomplex and reached the solution, and was removed by magnetic separation to obtain a suspension. 10 μL of the uniformly dispersed suspension was dropped onto the 3 mm MGCE surface polished with alumina for incubation. After the incubation, it was dried to obtain MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA.

[0100] The electrochemical workstation and three-electrode system were used for testing. The obtained MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA was used as the working electrode, silver / silver chloride was used as the reference electrode, and the platinum wire electrode was used as the counter electrode. 5 mM [Fe(CN)6] 3- / 4- The solution was used as an electrolyte, and differential pulse voltammetry (DPV) was performed in the range of 0.05-0.5 V using an electrochemical workstation, and the DPV current signal was 15.69 μA.

[0101] Embodiment 8:

[0102] In this example, the cyclic voltammetry method was used to investigate the gradual modification process of the Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe, and the cyclic voltammetry curves of bare electrode (MGCE), MGCE / Fe3O4 / α-Fe2O3, MGCE / Fe3O4 / α-Fe2O3@Au, MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA, MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / Apt, MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA, and MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA were investigated respectively. The preparation methods of each electrode are as follows.

[0103] Among them, the bare electrode (MGCE) is a clean magnetic glassy carbon electrode;

[0104] MGCE / Fe3O4 / α-Fe2O3: The Fe3O4 / α-Fe2O3 heterogeneous nanorods obtained in Example 1 were ultrasonically dispersed in ultrapure water to prepare a Fe3O4 / α-Fe2O3 heterogeneous nanorod suspension with a concentration of 15 mg / mL. 9 μL of the uniformly dispersed suspension was dropped onto a 3 mm MGCE surface polished with alumina and incubated. After the incubation, the surface was dried at 37°C to obtain MGCE / Fe3O4 / α-Fe2O3.

[0105] MGCE / Fe3O4 / α-Fe2O3@Au: The Fe3O4 / α-Fe2O3@Au nanocomposite obtained in Example 1 was ultrasonically dispersed in ultrapure water to prepare a Fe3O4 / α-Fe2O3@Au nanocomposite suspension with a concentration of 15 mg / mL. 9 μL of the uniformly dispersed suspension was dropped onto the 3 mm MGCE surface after alumina polishing and incubated. After the incubation, it was dried at 37°C to obtain MGCE / Fe3O4 / α-Fe2O3@Au.

[0106] MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA: 40 μL of 15 μM ssDNA activated by TCEP was added to 0.3 mg of Fe3O4 / α-Fe2O3@Au to obtain a Fe3O4 / α-Fe2O3@Au-ssDNA suspension. 9 μL of the evenly dispersed suspension was dropped onto a 3 mm MGCE surface polished with alumina and incubated. After the incubation, the surface was dried at 37 °C to obtain MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA.

[0107] MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / Apt, MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA: prepared from Fe3O4 / α-Fe2O3@Au-ssDNA / Apt and Fe3O4 / α-Fe2O3@Au-ssDNA / BSA in Example 2, respectively.

[0108] MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA: can be directly obtained from Example 2.

[0109] The test methods for each electrode are as follows:

[0110] The test was carried out using an electrochemical workstation and a three-electrode system, with the electrodes obtained in Example 8 as working electrodes, silver / silver chloride as reference electrodes, and platinum wire electrodes as counter electrodes. 5 mM [Fe(CN)6] containing 0.1 M KCl was used. 3- / 4- The solution was used as the electrolyte and cyclic voltammetry (CV) was performed in the range of -0.2-0.8V using an electrochemical workstation. The test results are shown in Figure 2 shown.

[0111] Figure 2 These are the cyclic voltammetry diagrams of the preparation process of Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe, where a is a bare electrode (MGCE), b is MGCE / Fe3O4 / α-Fe2O3, c is MGCE / Fe3O4 / α-Fe2O3@Au, d is MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA, e is MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / Apt, f is MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA, and g is MGCE / Fe3O4 / α-Fe2O3@Au-ssDNA / BSA. As can be seen from the figure, the current response value of curve c is higher than that of curve b. The reason is that when the Fe3O4 / α-Fe2O3 heterogeneous nanorods are coated with a layer of gold particles, Au has conductivity, and the conductivity of Fe3O4 / α-Fe2O3@Au nanorods is enhanced, so the peak current increases. The peak current of curve d decreases, which is due to the negative charge and steric hindrance of nucleic acids. The peak current of curve e is higher than that of curve d because the electron conduction ability of double-stranded DNA is stronger than that of single-stranded DNA. The peak current of curve f decreases because the introduction of BSA is not conductive. The electrical signal of curve g is significantly reduced because Apt successfully recognizes HE4 and causes Apt to fall off.

[0112] Embodiment 9:

[0113] In this example, the Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe constructed in Example 2 was dispersed in interfering proteins as working electrodes to construct an electrochemical biosensor to examine the selectivity of the electrochemical biosensor. The interfering proteins were CA125, IgG, IgE, and NSE.

[0114] Different interfering protein modified electrodes were obtained by the following methods:

[0115] The Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA prepared in Example 2 was respectively mixed in 40 μL of 1×10 4 pg·mL -1 The solid product was washed twice with 100 μL of 20 mM PBS (pH = 7.4) and then redispersed in 40 μL of PBS (pH = 7.4) solution to obtain a suspension. 9 μL of the evenly dispersed suspension was dropped onto the surface of 3 mm MGCE polished with alumina for incubation. After the incubation, it was dried to obtain CA125 MGCE, IgG MGCE, IgG MGCE, IgEM MGCE and NSE MGCE, respectively.

[0116] The Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA prepared in Example 2 was diluted in 40 μL containing 100 pg mL -1 The concentrations of HE4, CA125, NSE, IgG and IgE were all 1×10 4 pg·mL -1 The solid product was washed twice with 100 μL of 20 mM PBS (pH = 7.4) and then re-dispersed in 40 μL of PBS (pH = 7.4) solution to obtain a suspension. 9 μL of the evenly dispersed suspension was dropped onto the surface of 3 mm MGCE polished with alumina for incubation. After the incubation, it was dried to obtain a mixed protein MGCE (Mixture).

[0117] The test methods for each electrode are as follows:

[0118] The test was carried out using an electrochemical workstation and a three-electrode system, with the above electrode as the working electrode, silver / silver chloride as the reference electrode, a platinum wire electrode as the counter electrode, and a 5 mM [Fe(CN)6] 3- / 4-The solution was used as the electrolyte and the differential pulse voltammetry (DPV) was performed in the range of 0.05-0.5V using an electrochemical workstation. The test results were as follows: Figure 3 shown.

[0119] Figure 3 The peak current of Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe for detecting blank group (Blank), HE4, interfering proteins (CA125, IgG, IgE, NSE) and HE4 mixed with interfering proteins (Mixture). As can be seen from the figure, when the concentration of interfering substances is 100 times higher than that of HE4 protein, the current values ​​of CA125, IgG, IgE and NSE are close to those of the blank group, indicating that interfering proteins cannot be recognized by DNA aptamer probes, and the prepared sensor has strong specificity for HE4; when HE4 is mixed with interfering proteins, the current value increases significantly compared with the blank group, and is consistent with the current value of HE4 detected alone, indicating that only HE4 can cause a significant increase in the current value. The probe can detect trace amounts of HE4 in a complex matrix of the analyte, further illustrating that the prepared sensor has strong specificity for HE4.

[0120] Embodiment 10:

[0121] In this example, the Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe constructed in Example 2 was added to HE4 protein solutions of different concentrations (0.1 pg·mL -1 , 1pg·mL -1 , 10pg·mL -1 , 100pg·mL -1 , 1ng·mL -1 ) was redispersed to prepare the electrochemical biosensor, and the differential pulse voltammetry (DPV) was performed in the range of 0.05-0.5V using an electrochemical workstation to investigate the analytical performance of the electrochemical biosensor. The analysis results are shown in Figure 4 Shown

[0122] Figure 4 The concentration and linear range of the Fe3O4 / α-Fe2O3@Au-ssDNA / Apt / BSA magnetic nano HE4 aptamer probe can be detected. As can be seen from the figure, the current value and the HE4 protein concentration show a good linear correlation. The concentration that the nanoprobe can detect is 0.1pg·mL -1 -1ng·mL -1 , its linear regression equation is I(μA)=9.54706lg C(fg.mL -1 )+13.6108, correlation coefficient R2 =0.9955. I represents current and C represents concentration. The detection limit is 4.3 fg·mL calculated by linear fitting data. -1 , the limit of quantification was 125.3 fg·mL -1 Compared with the magnetic nanoprobes in the prior art, the electrochemical biosensor of the present invention has a lower detection concentration and a lower detection limit, and the detection method is simple and the preparation cycle is short.

[0123] In summary, the tumor marker HE4 probe provided in the present invention makes up for the defects of existing detection technologies and improves the efficiency, rapidity, low price, strong specificity and good practicality of the nano tumor marker detection probe. The electrochemical biosensor constructed based on the probe can better detect HE4 and has a lower detection limit (4.3 fg·mL -1 ), a wide linear range (0.1pg·mL -1 -1ng·mL -1 ) and better sensitivity.

[0124] The embodiments are preferred implementations of the present invention, but the present invention is not limited to the above-mentioned implementations. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essential content of the present invention belong to the protection scope of the present invention.

Claims

1. A tumor marker HE4 probe, characterized in that: The probe connects ssDNA / Apt to the surface of Fe3O4 / α-Fe2O3@Au nanocomposite by self-assembly technology; The sequence of Apt is 5'- TTATCGTACGACAGTCATCCTACAC -3'; The sequence of the ssDNA is 5'- SH-TTTTTTTTTTTTTGTCGTACGAT -3', wherein a base sequence in the ssDNA is complementary to Apt, and SH is a thiol group; The method for constructing the tumor marker HE4 probe comprises: S1. Preparation of Fe3O4 / α-Fe2O3@Au nanocomposites: (1) hydrothermally reacting an aqueous solution containing FeCl3 and NH4H2PO4, centrifuging and collecting the precipitate after the reaction, washing, drying, and grinding, then mixing the ground product with glucose and calcining, and grinding to obtain magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorods after calcination; (2) preparing a suspension of magnetic Fe3O4 / α-Fe2O3 heterostructure nanorods, then adding polyethyleneimine solution, heating in a water bath for reaction, centrifuging, washing and drying after the reaction is completed; (3) Dispersing the dried solid in water, adding HAuCl4 solution and mixing evenly by ultrasonication, then adding trisodium citrate solution, stirring and then adding NaBH4 solution, continuing to stir the reaction, and finally the reaction product is magnetically separated, washed and dried to obtain a magnetic Fe3O4 / α-Fe2O3@Au nanocomposite; S2. Preparation of tumor marker HE4 probe: (4) Mix the TCEP-activated ssDNA and Apt, denature at 95°C for 5 min, and then cool and anneal to obtain double-stranded ssDNA / Apt; The double-stranded ssDNA / Apt was activated by TCEP, and then Fe3O4 / α-Fe2O3@Au was added and continuously shaken to obtain Fe3O4 / α-Fe2O3@Au-ssDNA / Apt for later use; Fe3O4 / α-Fe2O3@Au-ssDNA / Apt was dispersed in BSA solution and incubated, and then washed after the incubation to obtain the tumor marker HE4 probe.

2. The tumor marker HE4 probe according to claim 1, characterized in that: In step (1), the concentration of FeCl3 in the aqueous solution containing FeCl3 and NH4H2PO4 is 0.02 mM, and the concentration of NH4H2PO4 is 9.6×10 -4 mM; The hydrothermal reaction conditions are constant temperature reaction at 180°C for 12 h; The mass ratio of the ground product to glucose is 1:4-1:24; The calcination conditions are as follows: the calcination temperature is 400-700° C. and the calcination time is 1-5 h.

3. The tumor marker HE4 probe according to claim 1, characterized in that: In step (2), the suspension of magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorods is prepared by dispersing magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorods in ultrapure water, and the concentration thereof is 5-30 mg / mL; The concentrations of the magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorod suspension and the polyethyleneimine solution are both 10 mg / mL, and the volume ratio of the magnetic Fe3O4 / α-Fe2O3 heterogeneous nanorod suspension to the polyethyleneimine solution is 3:80; The hydrothermal reaction was carried out under the conditions of 90° C. for 2 h.

4. The tumor marker HE4 probe according to claim 1, characterized in that: In step (3), the amount ratio of the dried solid, water, HAuCl4 solution, trisodium citrate solution and NaBH4 solution is 10 mg:150 mL:1 mL:2 mL:9 mL, wherein the concentration of HAuCl4 solution is 20 mg·mL -1 , the concentration of trisodium citrate solution is 38 mM, and the concentration of NaBH4 solution is 0.075wt.%; The ultrasonic mixing condition is 30-60 min at 0°C; The stirring reaction condition is stirring at 0°C for 15-30 min.

5. The tumor marker HE4 probe according to claim 1, characterized in that: In step (4), the concentration and dosage of the ssDNA and Apt are the same; the dosage ratio of the ssDNA / Apt to the Fe3O4 / α-Fe2O3@Au and BSA solution is 40 µL: 0.2~1.2 mg: 50 µL, wherein the concentration of ssDNA / Apt is 5~25 µM; The sequence of Apt is 5'- TTATCGTACGACAGTCATCCTACAC -3'; The sequence of the ssDNA is 5'-SH-TTTTTTTTTTTTTGTCGTACGAT -3', wherein the ssDNA has a base sequence that is complementary to Apt, and SH is a thiol group.

6. The tumor marker HE4 probe according to claim 1, characterized in that: In step (4), the concentration of the BSA solution is 0.25% (w / v); The incubation conditions are as follows: the incubation temperature is 20-45° C., and the incubation time is 30 min-90 min.

7. Use of the tumor marker HE4 probe according to claim 1 in preparing an electrochemical biosensor for detecting HE4.

8. An electrochemical biosensor for detecting HE4, characterized in that: The electrochemical biosensor of HE4 is prepared based on the tumor marker HE4 probe, and comprises: Dispersing the tumor marker HE4 probe according to claim 1 in the HE4 protein solution and incubating with shaking, washing the solid product after the shaking incubation, and then dispersing the solid product in a PBS solution to obtain a suspension for later use; The suspension is dropped onto the surface of the magnetic glassy carbon electrode polished with alumina, and dried at room temperature to obtain a magnetic glassy carbon electrode; The test was carried out using an electrochemical workstation and a three-electrode system. The obtained magnetic glassy carbon electrode was used as the working electrode, silver / silver chloride as the reference electrode, and a platinum wire electrode as the counter electrode. [Fe(CN)6] 3− / 4− The solution was used as electrolyte and differential pulse voltammetry was performed using an electrochemical workstation.

9. The electrochemical biosensor for detecting HE4 according to claim 8, characterized in that: The dosage ratio of tumor marker HE4 probe, HE4 protein solution and PBS solution is 5 ~25µM:40 µL:40 µL, where the concentration of HE4 protein solution is 100 pg·mL -1 , pH of PBS = 7.4; The shaking incubation condition is shaking incubation at 37°C for 30 min; The incubation temperature is 20-45°C and the time is 30-90 min; The amount of the suspension added is 8-10 μL; In the electrolyte, the concentration of KCl is 0.1 M, [Fe(CN)6] 3− / 4− The concentration is 5 mM; The detection range of the differential pulse voltammetry detection is 0.05-0.5 V, the volume of the HE4 solution to be tested is 40 µL, and the concentration is 0.1 pg mL -1 -1 ng·mL -1 .

Images