A xylanase mutant and bile acid compound enzyme preparation and application

Abstract

The present invention discloses a xylanase mutant and a bile acid compound enzyme preparation and application. The present invention mutates the xylanase xyn derived from the rumen fungus Neocallimastix patriciarum, and screens and obtains xylanase mutants xynM4, xynM5 and xynM6. Compared with the original gene, the thermal stability of the xylanase mutant after being treated at 85°C for 3 minutes is increased from 52% to 65%, 73%, and 85%, respectively, and the optimal reaction temperature is increased from 60°C to 70°C, indicating that the thermal stability and heat resistance of the mutant are improved. The present invention compounds the xylanase mutant with bile acid to obtain a bile acid compound enzyme preparation, which can significantly increase the market weight and European index of white-feathered broilers, and reduce the feed-to-weight ratio, thereby improving the feed conversion rate and production performance in poultry farming.

Description

Technical Field

[0001] This invention belongs to the field of enzyme engineering, specifically relating to a xylanase mutant, a bile acid compound enzyme preparation, and its application. Background Technology

[0002] Xylan is a pentose sugar, an important component of hemicellulose, and the second most abundant polysaccharide in nature after cellulose. It is widely found in feed ingredients such as corn, wheat bran, rice bran, straw, and soybean meal. As a non-starch polysaccharide in feed, it cannot be effectively degraded in the animal digestive system. Xylan itself is difficult for monogastric animals to digest, and when combined with a large amount of water, it increases the volume and viscosity of the digestate in the animal's digestive tract, reducing the activity of nutrients and endogenous enzymes, thus hindering the digestion and absorption of nutrients, especially fats and proteins, and reducing feed utilization. In the livestock industry, adding xylanase to feed to degrade the anti-nutritional factor xylan is a very economical and effective way to improve feed utilization.

[0003] Xylanases are a general term for a class of enzymes that can degrade xylan into oligosaccharides or xylose. They mainly include endoβ-1,4-xylanases, xylosidases, and arabinosidases, with endoβ-1,4-xylanases playing a major role. Most commercially available xylanases are suitable for temperatures between 40 and 60°C and pH levels between 5.0 and 7.0. Endoxylanases derived from rumen fungi have great application potential in industries such as feed and papermaking due to their excellent enzymatic hydrolytic properties. To widely apply rumen fungal endoxylanases in various industrial fields, improving their enzyme activity, heat resistance, acid resistance, and reducing production costs are urgent problems to be solved. Summary of the Invention

[0004] This invention provides a xylanase mutant, a bile acid-based enzyme preparation, and its application. Through extensive screening, this invention obtained xylanase mutants xynM4, xynM5, and xynM6 with improved heat resistance, and combined them with bile acids to form new enzyme preparations to improve feed utilization and broiler growth performance.

[0005] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0006] The present invention provides a xylanase mutant, wherein the xylanase mutant is xynM, and its amino acid sequence is shown in SEQ ID No. 3, or in SEQ ID No. 5, or in SEQ ID No. 7.

[0007] Furthermore, the xylanase mutant xynM specifically comprises: xynM4, obtained by changing tyrosine at position 43 of the xylanase shown in SEQ ID No. 1 to phenylalanine; xynM5, obtained by changing tyrosine at position 43 of the xylanase shown in SEQ ID No. 1 to phenylalanine and serine at position 62 to proline; and xynM6, obtained by changing tyrosine at position 43 of the xylanase shown in SEQ ID No. 1 to phenylalanine, serine at position 62 to proline, and glycine at position 76 to glutamic acid.

[0008] The present invention also provides a coding gene, which is the coding gene of the xylanase mutant xynM, and its nucleotide sequence is shown in SEQ ID No. 4, or in SEQ ID No. 6, or in SEQ ID No. 8.

[0009] The present invention also provides a recombinant expression vector comprising the aforementioned coding gene.

[0010] The present invention also provides a recombinant engineered bacterium, characterized in that it contains the aforementioned coding gene.

[0011] The present invention also provides a bile acid complex enzyme preparation, wherein the bile acid complex enzyme preparation comprises the xylanase mutant xynM and bile acids.

[0012] Furthermore, the bile acid complex enzyme preparation is a powder preparation obtained by fermentation, filtration and drying of recombinant engineered bacteria containing xylanase mutant xynM, mixed with bile acids at a mass-volume ratio of 1:8 to 12.

[0013] Furthermore, the xylanase mutant xynM in the bile acid compound enzyme preparation has an enzyme activity of not less than 100,000 U / g.

[0014] The present invention also provides the application of the xylanase mutant or the bile acid complex enzyme preparation in the preparation of feed additives to improve animal growth performance.

[0015] Furthermore, the amount of the xylanase mutant or bile acid compound enzyme preparation used is 0.005% to 0.02% of the feed weight.

[0016] Furthermore, the feed additive contains at least one of xylanase mutants xynM4, xynM5, and xynM6.

[0017] Compared with the prior art, the advantages and technical effects of the present invention are:

[0018] 1. This invention uses the xylanase gene of the rumen fungus *Neocallimastix patriciarum* as a basis for mutation modification, and screened to obtain xylanase mutants xynM4 (single-point mutation Y43F), xynM5 (double-point mutation Y43F / S62P), and xynM6 (triple-point mutation Y43F / S62P / G76E). Compared with the original gene, the thermal stability of the xylanase mutants after treatment at 85℃ for 3 minutes increased from 52% to 65%, 73%, and 85%, respectively, and the optimal reaction temperature increased from 60℃ to 70℃, indicating that the xylanase mutants have better thermal stability and heat resistance.

[0019] 2. This invention also utilizes engineered bacteria containing xylanase mutants to ferment, filter and dry a powder preparation, which is then compounded with bile acids. The resulting bile acid compound enzyme preparation can significantly increase the slaughter weight and European index of broiler chickens, and reduce the feed conversion ratio, thereby improving the feed conversion rate and production performance in broiler chicken farming. Attached Figure Description

[0020] Figure 1 This is a diagram showing the amplification electrophoresis results of the xylanase gene.

[0021] Figure 2 The comparison of the thermal stability of the xylanase mutants is as follows.

[0022] Figure 3 This is a comparison of the optimal reaction temperatures for the xylanase mutants.

[0023] Figure 4 This is the fermentation curve of the xylanase mutant in a 15L fermenter. Detailed Implementation

[0024] To facilitate understanding of the present invention, the invention will be described more fully and in detail below with reference to the accompanying drawings and embodiments. However, the scope of protection of the present invention is not limited to the specific embodiments described below. Unless otherwise specified, the reagents and biological materials used in the specific embodiments are commercially available.

[0025] The culture medium formula used in this invention is as follows:

[0026] LB medium: 1% tryptone, 0.5% yeast extract, 1% NaCl;

[0027] MD medium: 1.34% YNB, 0.4 mg / L biotin, 2% glucose;

[0028] YPD medium: 1% yeast extract, 2% peptone, 2% glucose;

[0029] BMGY medium: 1% yeast extract, 2% peptone, 100 mmol / L potassium phosphate buffer (pH 6.0), 1.34% YNB, 0.4 mg / L biotin, 1% glycerol;

[0030] BSM medium: 26.7 mL 85% phosphate, 0.93 g calcium sulfate dihydrate, 14.9 g magnesium sulfate dihydrate, 4.13 g potassium hydroxide, 18.2 g potassium sulfate, 40 g glycerol, 4.0 mL PMT1.

[0031] When the above culture medium is solid, add 2% agar powder.

[0032] Enzyme activity assay: Refer to the assay method in GB / T 23874-2009 Determination of xylanase activity in feed additives by spectrophotometry.

[0033] Example 1: Construction and screening of xylanase mutant genes

[0034] The amino acid sequence of xylanase xyn (GenBank: AKN90969.1) from the rumen fungus *Neocallimastix patriciarum* was translated into the corresponding nucleotide sequence. After gene sequence optimization, the sequence was artificially synthesized, and the resulting amino acid sequence is shown in SEQ ID NO: 1, while the corresponding nucleotide sequence is shown in SEQ ID NO: 2. Primers were designed based on the sequence, with an EcoR I restriction site at the 5' end and a Not I restriction site at the 3' end.

[0035] xyn-F: CCGGAATTCCAAAGTTTCTGTAGTTCAGC (SEQ ID NO: 9);

[0036] xyn-R: ATAAGCGGCCGCCTAATCACCAATGTAAACCT (SEQ ID NO: 10).

[0037] Using the GeneMorph II random mutagenesis PCR kit, a synthetically produced gene was used as a template, and the primer sequences designed above were used for random mutagenesis. The PCR amplification results are as follows: Figure 1 As shown. The amplified random mutant PCR product was digested with EcoRI and NotI, purified, and ligated into the pET-21a(+) vector. This vector was then transformed into *E. coli* BL21-DE3, and positive clones were selected using ampicillin-resistant LB plates to obtain pET-xynMx. The synthesized original gene was ligated into the pET-21a(+) vector and transformed into *E. coli* BL21-DE3 using the same method to obtain pET-xyn0.

[0038] Selected single colonies were inoculated into 96-well deep-well plates. Two single colonies (xyn0) expressing the original xylanase were inoculated into each plate as controls. 300 μL of LB liquid medium (containing 100 μg / mL ampicillin) was added to each well, and the plates were incubated at 37°C with shaking at 200 rpm for 4 hours. Then, 50 μL of the bacterial culture was transferred to a new 96-well plate for preservation. 200 μL of LB-Amp medium containing IPTG was added to the remaining bacterial culture on the plate to achieve a final IPTG concentration of 1 mM and a final ampicillin concentration of 100 μg / mL. The plates were then incubated at 37°C with shaking at 200 rpm for 10 hours to induce xylanase expression. The induced bacterial culture was repeatedly freeze-thawed to disrupt the cells. The supernatant was collected by centrifugation, and the xylanase activity and thermostability were then measured. The gene of the mutant with higher thermostability than the control was sequenced.

[0039] After sequencing, the xylanase mutant xynM4 was obtained. Its amino acid sequence is shown in SEQ ID NO:3, and its encoded nucleotide sequence is shown in SEQ ID NO:4.

[0040] Example 2: Random mutation of the xylanase mutant xynM4 gene as a template

[0041] Using the mutant xynM4 screened in Example 1 as a template, a second round of mutation and screening was carried out using the same random mutation method as in Example 1. During screening, xynM4 was used as a control, and the activity of xylanase was detected. The mutant genes with higher heat resistance than xynM4 were sequenced.

[0042] After extensive screening and testing, two mutants, xynM5 and xynM6, with good heat resistance were obtained:

[0043] The xynM5 mutation mode is Y43F / S62P, and its amino acid sequence is shown in SEQ ID NO: 5, and its nucleotide sequence is shown in SEQ ID NO: 6;

[0044] The xynM6 mutation mode is Y43F / S62P / G76E, and its amino acid sequence is shown in SEQ ID NO: 7. Its corresponding nucleotide sequence is shown in SEQ ID NO: 8.

[0045] Example 3: Transformation of Pichia pastoris GS115 with a xylanase mutant

[0046] The xylanase mutant gene described above was ligated into the pPIC9K plasmid using EcoRI and Not I double restriction sites and transformed into *E. coli* DH5α to obtain the expression vector, which was then verified by sequencing. The expression vector was linearized by Sal I digestion and electroporated into *Pichia pastoris* GS115. Transformants were selected by MD plate screening and then transferred to YPD plates for activation (generally 24-48 transformants were selected). The activated transformants were inoculated into shake flasks for fermentation (each flask contained 20 mL of BMGY medium), cultured at 30°C with shaking for 18 h, then induced with 1% methanol, and cultured with shaking for another 24 h, adding 1% methanol by volume every 24 h thereafter. After 96 h of induction, the culture medium was centrifuged to obtain the supernatant. The average enzyme activity of the fermentation broth supernatant and its thermostability after treatment at 85°C for 3 min were measured.

[0047] Following the method for xylanase determination in the national standard, the heat resistance and optimal reaction temperature of the supernatant after centrifugation of the fermentation broth were determined. The results are as follows: Figure 2 and Figure 3 As shown, the heat resistance of the xylanase mutant after treatment at 85℃ increased from 52% to 65%, 73%, and 85%, and the optimal reaction temperature increased from 60℃ to 70℃.

[0048] Example 4: Fermentation and preparation of xylanase mutant xynM6 in a 15L fermenter

[0049] Genetically engineered bacteria expressing the xylanase mutant xynM6 were streaked onto YPD plates and cultured at 30°C for 3 days to produce single colonies. Healthy single colonies were selected and streaked again on YPD plates. After three generations of activation, the resulting Pichia pastoris single colonies were inoculated into 20 mL of BMGY medium and cultured at 30°C and 200 rpm for 24 h. A 2% inoculum was then added to 300 mL of BMGY medium and cultured at 30°C and 200 rpm until an OD600 of 5 was reached. This inoculum was then used as seed culture for inoculating fermenters. Fermentation production process: BSM medium, pH 4.8, temperature 30℃, stirring speed 500rpm, ventilation 1.5 (v / v), dissolved oxygen controlled above 20%. The fermentation process is divided into three stages: (1) Cell culture stage: seed liquid is introduced at a ratio of 8%, cultured at 30℃ for 20-24h to deplete the glycerol in the fermentation broth; (2) Starvation stage: when the carbon source glycerol is depleted, no carbon source is added temporarily, and the starvation stage ends when the dissolved oxygen rises to 80%; (3) Induction expression stage: pH is adjusted to the required value with ammonia or phosphoric acid, methanol is added for induction, and dissolved oxygen is kept above 20%, and the induction time is 160-200h; after fermentation, the fermentation broth is processed by plate and frame filter and then sprayed dry into powder by spray tower for application testing.

[0050] Fermentation curve as follows Figure 4As shown: Samples were taken every 8 hours to measure enzyme production levels, and enzyme activity levels reached their peak after 162 hours of fermentation.

[0051] Example 5: Preparation of enzyme preparations and their application in broiler chicken farming

[0052] The xylanase mutant powder preparation prepared in Example 4 was uniformly mixed with bile acids at a mass-to-volume ratio of 1:10 to prepare a bile acid complex enzyme preparation.

[0053] The enzyme activity of the xylanase mutant in the enzyme preparation is not less than 100,000 U / g. The effective components of the bile acids include porcine cholic acid, porcine deoxycholic acid, and chenodeoxycholic acid, wherein the weight percentage of porcine cholic acid and porcine deoxycholic acid is 78.0%, the weight percentage of chenodeoxycholic acid is 20.0%, and the remainder is moisture and ash (the total weight percentage is calculated as 100%).

[0054] Healthy chicks of similar weight were randomly divided into 5 groups of 500 chicks each, with 2 replicates per group and 250 chicks per replicate. The rearing period was 42 days. After 42 days of rearing, growth indicators of each group were measured. The experimental design is shown in Table 1.

[0055] Table 1 Experimental group design

[0056]

[0057] Table 2 Comparison of production indicators for broiler chickens in different groups

[0058]

[0059] Note: The European Index for broiler farming is calculated as follows: [(body weight x survival rate) / (feedback ratio x age at slaughter)] x 10000. The European Efficiency Index is a comprehensive indicator for broiler farming.

[0060] The experimental results are shown in Table 2. The survival rates of the groups were not significantly different, but the weight of the broilers with added enzymes was significantly higher and the feed conversion ratio was significantly lower. According to the European index, all three experimental groups were significantly higher than the control group and the bile acid group.

[0061] The results above indicate that adding enzyme preparations containing xylanase mutants xynM4, xynM5, and xynM6 can improve feed conversion rate and production performance in broiler chicken farming, and the effect is better than using bile acids alone.

[0062] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A xylanase mutant, characterized in that The xylanase mutant is a xylanase mutant xynM, and its amino acid sequence is shown in SEQ ID No.3, or in SEQ ID No.5, or in SEQ ID No.

7.

2. A coding gene, characterized in that The encoding gene is the encoding gene of the xylanase mutant xynM according to claim 1, and its nucleotide sequence is shown as SEQ ID No.4, or as SEQ ID No.6, or as SEQ ID No.

8.

3. A recombinant expression vector, characterized in that: It comprises the coding gene according to claim 2.

4. A recombinant engineered bacterium, characterized in that: It comprises the coding gene according to claim 2.

5. A bile acid complex enzyme preparation, characterized in that: The bile acid complex enzyme preparation comprises the xylanase mutant xynM according to claim 1 and bile acid.

6. The bile acid complex enzyme preparation according to claim 5, characterized in that: The bile acid complex enzyme preparation is prepared by mixing a powder preparation obtained by fermenting, filtering and drying a recombinant engineering bacterium containing a xylanase mutant xynM with bile acid at a mass volume ratio of 1:8-12.

7. Use of the xylanase mutant according to claim 1 or the bile acid complex enzyme preparation according to claim 5 in the preparation of a feed additive for improving animal growth performance.

8. The use according to claim 7, characterized in that: The dosage of the xylanase mutant or bile acid compound enzyme preparation is 0.005% to 0.02% of the feed weight.

9. The use according to claim 7, characterized in that: The feed additive contains at least one of the xylanase mutants xynM4, xynM5 and xynM6.

Images