Application of hsa_circ_0136682 or its encoded protein in the preparation of tumor diagnostic reagents or anti-tumor drugs

Abstract

The present invention studies has_circ_0136682, a protein-encoding protein, for the first time, discloses the relationship between has_circ_0136682 and tumor development, and provides the use of has_circ_0136682 or its encoded protein in the preparation of tumor diagnostic reagents or anti-tumor drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the use of hsa_circ_0136682 or its encoded protein in the preparation of tumor diagnostic reagents or anti-tumor drugs. Background Art

[0002] Circular RNA molecules are a type of RNA molecules that form a single-stranded closed ring structure by covalent bonding between the head and the tail. Due to its unique covalent closed ring structure, circular RNA is not easily hydrolyzed by nucleases compared to linear RNA, and has stronger stability and a longer half-life. Circular RNA is widely distributed in the body and can be stably present in blood, saliva, and tissues. It also shows obvious tissue specificity as the tissue develops, which makes the expression of circRNA in tumor cells and normal tissue cells significantly different. In recent years, with the rise of second-generation sequencing technology, people's research on circRNA has gradually deepened. Functionally, the main functions of circRNA include: acting as a sponge for mirna, relieving the degradation of mirna on target genes by adsorbing mirna, binding to RNA binding proteins, changing the function of binding proteins to affect downstream target proteins, encoding proteins, and exerting their effects by encoding proteins. Summary of the invention

[0003] The present invention studies a protein-encoding hsa_circ_0136682 for the first time, discloses the relationship between the protein and tumor development, and provides the use of hsa_circ_0136682 or its encoded protein in the preparation of tumor diagnostic reagents or anti-tumor drugs.

[0004] The specific technical solutions of the present invention are as follows:

[0005] Use of hsa_circ_0136682 or a protein encoded thereby as a diagnostic marker in the preparation of a tumor diagnostic product, wherein the cDNA nucleotide sequence of hsa_circ_0136682 is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded thereby is shown in SEQ ID NO: 2.

[0006] Preferably, the diagnostic products include diagnostic reagents, diagnostic test strips, and diagnostic chips.

[0007] Preferably, the diagnostic reagent comprises a nucleic acid or protein diagnostic reagent, the nucleic acid diagnostic reagent comprises an RNA extraction system, an RNA reverse transcription system and a PCR reaction system; wherein the PCR reaction system contains a primer sequence for specifically amplifying hsa_circ_0136682; the protein diagnostic reagent comprises an antibody, receptor, ligand, cytokine, enzyme or small molecule compound that specifically binds to the protein encoded by hsa_circ_0136682.

[0008] In a specific embodiment of the present invention, the PCR amplification primer sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4, and the specific information is as follows:

[0009] Forward primer: 5'TGGAAGAAGGTATTGCTTGGCT 3' (SEQ ID NO: 3).

[0010] Reverse primer: 5'AATGCTTGCTGTTGTGCTGT 3' (SEQ ID NO: 4).

[0011] Preferably, the diagnostic product also includes a probe that hybridizes with hsa_circ_0136682 or a protein encoded thereby.

[0012] Another object of the present invention is to provide a use of hsa_circ_0136682 or a protein encoded thereby in the preparation of anti-tumor drugs.

[0013] Preferably, the drug is hsa_circ_0136682 or a protein encoded therein, an expression vector of hsa_circ_0136682 or a protein encoded therein, or a substance that promotes the expression of hsa_circ_0136682 or a protein encoded therein, such as an agonist.

[0014] The activator is not limited as long as it can increase the expression level of hsa_circ_0136682 or improve the functional activity of hsa_circ_0136682.

[0015] The activator includes a promoting transcriptional regulatory factor or a promoting targeted small molecule compound.

[0016] Furthermore, the drug also includes a gene drug delivery system or a protein drug delivery system, and the delivery system includes a pharmaceutically acceptable carrier in a clinically acceptable form.

[0017] Preferably, the tumor is liver cancer, lung cancer, colorectal cancer, gastric cancer or breast cancer, more preferably gastric cancer.

[0018] Advantages of the present invention: The present invention reveals for the first time that there are significant differences in the expression of hsa_circ_0136682 in normal human gastric tissue and gastric cancer primary lesions and gastric cancer metastases. hsa_circ_0136682 is abnormally low expressed in advanced gastric cancer tissue and is related to the malignancy of the tumor. It can be used as a major marker for auxiliary diagnosis of gastric cancer. The present invention has experimentally demonstrated that lentiviral overexpression of hsa_circ_0136682 can significantly inhibit the proliferation, migration and invasion of gastric cancer cells, and knocking down hsa_circ_0136682 can promote the proliferation, migration and invasion of gastric cancer cells.

[0019] The present invention further proves through experiments that overexpression of the encoded protein of hsa_circ_0136682 can significantly inhibit the proliferation, migration and invasion of gastric cancer cells, and is related to the malignancy of the tumor. It suggests that promoters of hsa_circ_0136682 or its encoded protein or both can be used as drugs for the treatment of gastric cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 :The expression detection results of hsa_circ_0136682 in gastric epithelial cells and gastric cancer cells.

[0021] Figure 2 :The expression detection results of hsa_circ_0136682 in normal gastric tissue, paracancerous tissue and gastric cancer tissue.

[0022] Figure 3 :Mass spectrometry detection results of hsa_circ_0136682 encoded protein.

[0023] Figure 4 : Figure 4 A is the western blot result of the efficiency of overexpression of hsa_circ_0136682. Figure 4 B is the cell viability result of MKN-45 cells overexpressing hsa_circ_0136682. Figure 4 C is the result of clonal survival ability of MKN-45 cells after overexpression of hsa_circ_0136682. Figure 4 D is the invasion ability result of MKN-45 cells overexpressing hsa_circ_0136682. Figure 4 E is the result of invasion ability of MKN-45 cells after overexpression of hsa_circ_0136682.

[0024] Figure 5 : Figure 5 A is the western blot result of the knockdown efficiency of hsa_circ_0136682. Figure 5B is the cell viability result after knocking down hsa_circ_0136682 in AGS cells. Figure 5 C is the result of clone survival ability after knocking down hsa_circ_0136682 in AGS cells. Figure 5 D is the invasion ability result of AGS cells after knocking down hsa_circ_0136682. Figure 5 E is the result of invasion ability of AGS cells after knockdown of hsa_circ_0136682.

[0025] Figure 6 : Figure 6 A is the western blot result of overexpression efficiency of hsa_circ_0136682 encoding protein. Figure 6 B is the cell viability result of MKN-45 cells overexpressing hsa_circ_0136682 encoded protein. Figure 6 C is the result of clonal survival ability of MKN-45 cells after overexpression of hsa_circ_0136682 encoded protein. Figure 6 D and Figure 6 E shows the invasion and migration ability of MKN-45 cells after overexpression of hsa_circ_0136682 encoded protein.

[0026] Figure 7 :The results of in vivo tumorigenicity of MKN cells after overexpression of hsa_circ_0136682. DETAILED DESCRIPTION

[0027] The present invention is further described below by examples, including materials used and specific sources. But it should be understood that these are exemplary only, not limiting the present invention. Materials similar or identical to the types and models of the following reagents, instruments, or properties or functions can all be used for the implementation of the present invention. Unless otherwise indicated, the reagent used in the present invention can be any suitable commercially available reagent.

[0028] Human gastric cancer cell line MKN-45 / AGS: purchased from Wuhan Punosai Life Science Co., Ltd.; AGS medium: purchased from Wuhan Punosai Life Science Co., Ltd.; RPMI 1640 medium: purchased from Jiangsu Keygen Biotechnology Co., Ltd.; serum: purchased from Gibco, product catalog number 10099-141; trypsin: purchased from Invitrogen, product catalog number 25300-354; hsa_circ_0136682 overexpression lentivirus and shRNA were constructed by Shanghai Jima Biotechnology Co., Ltd. The methods in the following examples are all common methods unless otherwise specified.

[0029] Example 1: Real-time fluorescence quantitative PCR (qRT-PCR) detection of hsa_circ_0136682 expression

[0030] 1. Culture of Gastric Cancer Cell Lines

[0031] Our laboratory purchased AGS and MKN-45 gastric cancer cell lines from Wuhan Pronocell Life Sciences Co., Ltd. in 2021 and cultured the cells using the recommended cell culture system. Both cell lines were identified as human gastric cancer cells through STR analysis.

[0032] 2. RNA extraction and real-time quantitative PCR (qRT-PCR)

[0033] (1) RNA extraction

[0034] The culture medium of gastric cancer cells in the logarithmic growth phase was aspirated, washed twice with PBS, and lysed for two minutes by adding Trizol, l, and the solution was aspirated into a centrifuge tube, 200ul of chloroform was added, mixed, and placed for 3 minutes, centrifuged at 12000rpm, 15min, and 4℃, the supernatant was taken, an equal volume of isopropanol was added, mixed, placed at -20℃ for 30min, centrifuged at 12000rpm, 15min, and 4℃, the solution was aspirated and the precipitate was retained, 1 ml of 75% ethanol was added, centrifuged at 12000rpm, 4℃, the precipitate was retained, and an appropriate amount of DEPC water was added to dissolve the precipitate. The OD260 and OD280 absorption values ​​were measured. It is generally believed that A260 / A280 between 1.8-2.1 can be preliminarily judged to be of good quality for total RNA, and it was stored in a -20℃ refrigerator.

[0035] RNA is reverse transcribed into cDNA. Configure the system according to the following table:

[0036]

[0037] Mix thoroughly, centrifuge, and place the PCR tube in a PCR instrument at 37°C for 15 min, then at 85°C for 5 sec.

[0038] Real-time PCR:

[0039] The cDNA was diluted to 4 ng / μL as a template for fluorescence quantitative PCR reaction. Amplification was performed on an ABI 7500 fluorescence quantitative PCR instrument using forward primers (5'GGACATCTAAGGGCATCACA3' SEQ ID No: 5) targeting hsa_circ_0136682 and 18SrRNA internal reference genes, reverse primers (5'ACACGGACAGGATTGACAGA3' SEQ ID No: 6) and 2×SYBR Green qPCR Mixture.

[0040] The reaction system is as follows:

[0041]

[0042] The PCR conditions were: 50°C for 20 seconds; 95°C for 10 minutes; 95°C for 1 minute; 60°C for 1 minute, repeated for 40 cycles; and the CT value of the sample hsa-miR-149-3p / reference gene amplification was measured.

[0043] 3. Data Processing and Analysis

[0044] The ratio of hsa_circ_0006787 expression in GES-1, MKN-45, and AGS was calculated using 2 -ΔΔCT *p<0.05, ***p<0.001, ****p<0.0001. Figure 1 The results showed that there was a difference in the expression of hsa_circ_0136682 between normal gastric epithelial cells and gastric cancer cells, and the expression level of hsa_circ_0136682 was the lowest in MKN-45 cells with a higher degree of malignancy.

[0045] Example 2: FISH detection of differential expression of hsa_circ_0136682 in gastric tissue and gastric cancer tissue

[0046] This laboratory purchased tissue chips from Shanghai Xinchao Biotechnology Co., Ltd. in 2021. The chip number is HStmA050Me01. The entire collection and subsequent experimental process complies with medical ethical requirements and strictly follows the principle of confidentiality of case data.

[0047] 1. Tissue Microarray Processing

[0048] After the tissue is removed and washed, it is immediately placed in a fixative (prepared with DEPC water) for 2-12 hours. After the tissue is fixed, it is dehydrated with gradient alcohol, dipped in wax, and embedded. The slices are placed in xylene I for 15 minutes, xylene for 15 minutes, anhydrous ethanol for 5 minutes, anhydrous ethanol for 5 minutes, 85% alcohol for 5 minutes, 75% alcohol for 5 minutes, and washed with DEPC water. Depending on the length of tissue fixation time, the slices are boiled in the repair solution for 10-15 minutes and cooled naturally. Then circle with a gene pen, and according to the different indicators and characteristics of different tissues, proteinase K (20μg / ml) is added and digested at 37° for 20-30 minutes. After rinsing with pure water, wash with PBS 3 times × 5 minutes.

[0049] 2. Tissue Microarray Staining

[0050] Add pre-hybridization solution and incubate at 37℃ for 1h. Pour off the pre-hybridization solution, add probe-containing hybridization solution, and hybridize overnight at 37℃ in a thermostat. Wash away the hybridization solution, wash with 2×SSC at 37℃ for 10min, 1×SSC at 37℃ for 2×5min, and 0.5×SSC at room temperature for 10min. If there are many non-specific hybrids, you can add formamide washing. Add primary antibody and dilute with PBS. Incubate at 4° overnight. Then wash with PBS for 3×5min. Add corresponding secondary antibody and incubate at room temperature for 50min. Then wash with PBS for 3×5min. Add DAPI staining solution to the slices, incubate in dark for 8min, and then add anti-fluorescence quenching sealing agent to seal the slices after rinsing. Observe the slices under a Nikon upright fluorescence microscope and collect images.

[0051] 3. Analysis of tissue microarray FISH results

[0052] The tissue microarray scanning results were imported into Image Pro Plus for fluorescence intensity analysis, and statistical analysis was performed using Graphpad Prism. *p<0.05, ***p<0.001, ****p<0.0001. Figure 2 shown.

[0053] The results showed that hsa_circ_0136682 was significantly downregulated in metastatic gastric cancer tissues compared with normal gastric tissues and adjacent tumor tissues, and was correlated with the malignancy of the tumor.

[0054] Example 3. Detection of hsa_circ_0136682 encoded protein by mass spectrometry

[0055] 1. Construction of hsa_circ_0136682 overexpression plasmid

[0056] The sequence of hsa_circ_0136682 was inserted into the pLC5-ciR expression vector to construct a plasmid vector overexpressing hsa_circ_0136682. The sequence map of hsa_circ_0136682 was provided by the inventors, and the plasmid vector was commissioned to Guangzhou Jisai Biotechnology Co., Ltd.

[0057] 2. Cell lines and cell culture

[0058] 293T cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% double antibody in a 5% CO2 incubator at 37°C.

[0059] 3. Plasmid Transfection

[0060] 293T cells were seeded into 6-well plates one day in advance, and the cell density was controlled to reach 70% on the second day. The overexpression plasmid of hsa_circ_0136682 was transfected using Polyplus transfection reagent.

[0061] 4. Extraction of Cell Protein

[0062] Discard the culture medium, wash the cells twice with 4℃ pre-cooled PBS, pour out the PBS, and place the cell culture bottle on ice. Add 200μl of lysis solution with protease and phosphatase inhibitors, shake well, and place on ice for 30 minutes. The cell bottle should be shaken continuously during the lysis. After complete lysis, scrape the adherent cells with a cell scraper, and transfer the cells and lysis solution to a clean 1.5ml centrifuge tube. 12000rpm, 4℃, 5min. Aspirate the supernatant in the centrifuge tube after centrifugation and transfer it to a new centrifuge tube. The supernatant contains protein samples. If not used immediately, store the samples in a -80℃ refrigerator.

[0063] 5. Protein Profile

[0064] The protein samples were subjected to SDS-PAGE gel electrophoresis and stained with Coomassie Brilliant Blue for 20 min, and then the gel bands were subjected to protein mass spectrometry analysis to obtain protein mass spectra. Figure 3 shown.

[0065] The results showed that hsa_circ_0136682 can encode a new type of protein, whose amino acid sequence is shown in SEQ ID No: 2.

[0066] Example 4. Lentivirus overexpression of hsa_circ_0136682 can inhibit the proliferation, migration and invasion of gastric cancer cells

[0067] 1. Viral vector construction

[0068] The cDNA sequence of hsa_circ_0136682 was inserted into the lentiviral expression vector to construct an overexpression vector.

[0069] The viral vector of hsa_circ_0136682. The sequence map of hsa_circ_0136682 was provided by the inventor, and the viral vector was commissioned to Shanghai Jima Technology Co., Ltd.

[0070] 2. Cell lines and cell culture

[0071] MKN-45 cells, a human gastric cancer cell line, were cultured in RPMI-1640 medium supplemented with 20% fetal bovine serum and 1% double antibody in a 5% CO2 incubator at 37°C.

[0072] 3. Viral Transfection

[0073] (1) 18-24 hours before lentiviral transfection, adherent cells were cultured at 1×10 5 / well in a 24-well plate. The number of cells during lentiviral transfection is 2×10 5 / hole left and right.

[0074] (2) On the next day, replace the original culture medium with 2 ml of fresh culture medium containing 6 μg / ml polybrene, add an appropriate amount of virus suspension, and incubate at 37°C.

[0075] (3) Continue culturing for 24 hours and replace the virus-containing medium with fresh medium.

[0076] (4) Observe the fluorescence expression 72 to 96 hours after infection.

[0077] (5) The cells were expanded into a 12-well plate and culture medium containing 0.8 μg / ml puromycin was added for screening and culture.

[0078] Western blot was used to detect the efficiency of lentiviral overexpression. Figure 4 As shown in A, the effect of lentiviral infection overexpressing hsa_circ_0136682 is significant.

[0079] 5. Clone Survival Assay

[0080] (1) Take cells from the experimental group and the control group, digest them, centrifuge them, resuspend the cell pellets, and count them.

[0081] (2) The cell suspension was diluted in equal proportions to 2000 cells / mL, 1 mL of the cell suspension was added to each well of a 6-well plate, 3 replicates were set up, and the plate was cultured in a cell culture incubator.

[0082] (3) After about two weeks of culture, visible cell colonies grow and the plate is taken out. Wash with PBS three times, fix with 75% ethanol for 5 minutes, discard the 75% ethanol, and air dry. Add 1 mL of crystal violet staining solution and stain for 0.5 h. Discard the crystal violet staining solution, wash with PBS twice, and place the stained cell plate on white paper to take a photo.

[0083] (4) Analysis of colony cloning results: Calculate the number of colonies and compare the trend of the results. Figure 4 As shown in C.

[0084] 6. Transwell cell migration assay

[0085] (1) The cells were digested and centrifuged, the culture medium was discarded, and the cell pellet was resuspended in 1 mL of serum-free DMEM culture medium containing 0.05%-0.2% BSA. The cells were counted and the density was 2.5×10 5 of cell suspension.

[0086] (2) First, moisten the chamber with serum-free MEM, take 600 μL of empty MEM into a 24-well plate, gently place the chamber in the well, and then aspirate 200 μL of MEM culture medium and gently drip it into the chamber.

[0087] (3) After the chamber is moistened, discard the MEM culture medium above and below the chamber. Add 600 μL of MEM complete culture medium to the 24-well plate, gently place the chamber in the well with tweezers (do not create bubbles at the bottom of the chamber), add 100 μL of the mixed cell suspension to the chamber, that is, each well contains 25,000 cells, and then place the culture plate in the incubator for culture.

[0088] (4) After 44 hours of culture, the chamber was taken out and the results were collected. The chamber was first placed in a new external 24-plate. According to the standard that the upper chamber volume was 100 μL and the lower chamber volume was 600 μL, the chamber was first gently washed three times with PBS, then placed in 4% paraformaldehyde for 10 minutes, and then washed three times with PBS. Finally, it was stained with 0.2% crystal violet for 20 minutes. After staining, it was rinsed with slow running water and the cells on the upper surface of the chamber were wiped clean with a cotton swab. Then, a microscope was used to take pictures to observe the cells under the chamber. Five pictures were taken randomly for each sample and the average value was calculated for statistics. The results are as follows Figure 4 As shown in D.

[0089] 7.CCK-8 Experiment

[0090] (1) After digestion and centrifugation, the cells were collected and counted. The cell suspension was adjusted to a concentration of 8×10 4 / mL, the cell suspension was mixed and plated into a 96-well plate, with 100 μL of cell suspension per well, i.e. 8,000 cells per well. Four replicate wells were set for each group of cells, and two wells containing culture medium were set on each plate as blank controls (100 μL of empty culture medium was also added to each well).

[0091] (2) Perform CCK-8 testing on days 1, 2, 3, and 4

[0092] (3) After measuring the cell OD value for four consecutive days, the data were analyzed using Graphpad Prime software. Figure 4 As shown in B.

[0093] 8. Cell scratch assay

[0094] (1) Digest the cells, resuspend them into a single cell suspension, and then inoculate the cells into a 6-well plate. When the cell density reaches 100%, scratch the cell surface with a 200ul pipette tip, and then wash them three times with PBS solution. Add culture medium with a 2% serum concentration.

[0095] (2) Take a photo of the scratch at hour 0.

[0096] (3) Observe the degree of scratch healing and take photos for record.

[0097] (4) Use image J to process the scratch image. The result is as follows Figure 4 As shown in E.

[0098] 9. Xenograft Tumor Experiment

[0099] (1) Preparation of nude mice: Male 5-week-old BALB / c nude mice, weighing 18-20 g, were purchased from Hangzhou Ziyuan Experimental Animal Technology Co., Ltd. (License No.: SYXK(Su)2018-0019) and maintained in an SPF-grade experimental animal breeding room with a 12:12 light / dark cycle and constant temperature and humidity.

[0100] (2) Cell preparation: expand the experimental group and blank control group cells, digest and centrifuge to collect cells, and count the cells. Prepare the cell suspension to a density of 1×10 7 pcs / 150μL of cell suspension.

[0101] (3) During tumor formation, the cell resuspension was injected into the subcutaneous sites of the left and right ventral axilla and groin of nude mice, with 1×10 7 cells. After injection, the original feeding environment was maintained. The nude mice were killed after ether inhalation anesthesia and photographed. The tumor was removed, weighed, and photographed. Figure 7 shown.

[0102] 10. Data Processing and Analysis

[0103] Graph Pad Prism software was used for statistical analysis and plotting. Paired t-test was used for statistical analysis as appropriate. Data are presented as mean ± standard deviation of at least three independent experiments, *p < 0.05, ***p < 0.001,

[0104] ****p<0.0001.

[0105] Figure 4 The results of A showed that overexpression of hsa_circ_0136682 inhibited the proliferation, migration and invasion of gastric cancer cells. Figure 4 B Results showed that overexpression of hsa_circ_0136682 could reduce the proliferation ability of gastric cancer cells. Figure 4 C The results showed that overexpression of hsa_circ_0136682 inhibited the clonal viability of gastric cancer. Figure 4 D and Figure 4 E The results showed that overexpression of hsa_circ_0136682 could reduce the invasion and migration ability of gastric cancer cells. Figure 7 The results showed that overexpression of hsa_circ_0136682 could reduce the tumorigenicity of gastric cancer cells in nude mice.

[0106] This example verifies from multiple experiments such as CCK-8, clone survival, invasion and migration ability, and xenograft tumor formation that the lentiviral vector overexpressing hsa_circ_0136682 can inhibit the tumorigenicity of gastric cancer cells. hsa_circ_0136682 can be used as a new target for targeted therapy of gastric cancer.

[0107] Example 5: Knockdown of hsa_circ_0136682 promotes the tumorigenicity of gastric cancer cells Reverse verification that hsa_circ_0136682 can be used as a new target for the treatment of gastric cancer

[0108] 1. Interference Lentivirus Construction

[0109] The specific interference lentivirus targeting the reverse splicing site of hsa_circ_0136682 and the negative control virus were synthesized by Genema Gene (Shanghai), and the sequence map of hsa_circ_0136682 was provided by the inventor. The shRNA target sequence is as follows: 5'

[0110] gcaagcauuacagacaucu 3' (SEQ ID No: 7).

[0111] 2. shRNA infection

[0112] Interference lentivirus infected human gastric cancer AGS cells. Western blot was used to detect the infection efficiency of lentivirus.

[0113] Referring to Example 4, the effects of knocking down hsa_circ_0136682 on the clonal survival, invasion and migration ability of gastric cancer cells and CCK-8 were investigated. Figure 5 The results showed that the effect of siRNA knocking down hsa_circ_0136682 was significant. Figure 5 The results of A showed that knockdown of hsa_circ_0136682 promoted the proliferation, migration and invasion of gastric cancer cells. Figure 5 The results of B showed that knocking down hsa_circ_0136682 could enhance the proliferation ability of gastric cancer cells. Figure 5 The results of C showed that knocking down hsa_circ_0136682 could enhance the clonal survival ability of gastric cancer cells. Figure 5 D and Figure 5 The results of E showed that knocking down hsa_circ_0136682 could promote the invasion and migration ability of gastric cancer cells.

[0114] This experiment verified from multiple experiments such as clone survival, invasion and migration ability, and CCK-8 that knocking down hsa_circ_0136682 can promote the proliferation, migration and invasion of gastric cancer cells. This reverse verification shows that hsa_circ_0136682 can be used as a new target for targeted therapy of gastric cancer.

[0115] Example 6: Overexpression of hsa_circ_0136682 encoded protein can inhibit the proliferation, migration and invasion of gastric cancer cells 1. Construction of overexpression vector

[0116] The nucleotide sequence of hsa_circ_0136682 encoding protein (SEQ ID No: 8) was inserted into the overexpression vector to construct the overexpression plasmid vector. The plasmid vector was commissioned to Suzhou Jinweizhi Biotechnology Co., Ltd.

[0117] 2. Plasmid Transfection

[0118] The constructed overexpression plasmid and overexpression vector were transfected into human gastric cancer cell MKN-45. Referring to Example 4, the effect of overexpression of hsa_circ_0136682 encoding protein on the clonal survival, invasion and migration ability of gastric cancer cells and CCK-8 was investigated. Figure 6 As shown in B.

[0119] The results showed that overexpression inhibited the proliferation, migration and invasion of gastric cancer cells. Figure 6 The results of A showed that the overexpression plasmid can significantly increase the expression level of hsa_circ_0136682 encoded protein. Figure 6 The results of B showed that overexpression of hsa_circ_0136682 encoded protein could inhibit the proliferation of gastric cancer cells. Figure 6 The results of C showed that overexpression of hsa_circ_0136682 encoded protein could inhibit the clonal survival ability of gastric cancer cells. Figure 6 D and Figure 6 The results of E showed that overexpression of hsa_circ_0136682 encoded protein could inhibit the invasion and migration ability of gastric cancer cells.

[0120] This example verifies from multiple experiments such as clone survival, invasion and migration ability, and CCK-8 that overexpression of hsa_circ_0136682 encoded protein can inhibit the tumorigenicity of gastric cancer cells. It verifies that hsa_circ_0136682 encoded protein can be used as a new target for targeted treatment of gastric cancer.

[0121] The embodiments described above are exemplary and are only preferred specific implementation methods of the present invention. The protection scope of the present invention is not limited thereto. A person skilled in the art may make several improvements and modifications without departing from the technical principles of the present invention. Such improvements and modifications shall also be regarded as within the protection scope of the present invention.

Claims

1. Use of a reagent for detecting hsa_circ_0136682 or its encoded protein in the preparation of a gastric cancer diagnostic product, wherein the cDNA nucleotide sequence of hsa_circ_0136682 is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by hsa_circ_0136682 is shown in SEQ ID NO:

2.

2. The use according to claim 1, characterized in that The diagnostic products include diagnostic reagents, diagnostic test strips, and diagnostic chips.

3. The use according to claim 2, characterized in that The diagnostic reagent includes a nucleic acid or protein diagnostic reagent, wherein the nucleic acid diagnostic reagent includes an RNA extraction system, an RNA reverse transcription system and a PCR reaction system; wherein the PCR reaction system contains a primer sequence for specifically amplifying hsa_circ_0136682; and the protein diagnostic reagent includes an antibody, a receptor, a ligand, a cytokine, an enzyme or a small molecule compound that specifically binds to the protein encoded by hsa_circ_0136682.

4. The use according to claim 2, characterized in that The diagnostic product also includes a probe that hybridizes to hsa_circ_0136682 or a protein encoded by it.

5. Use of hsa_circ_0136682 or a protein encoded thereby in the preparation of a drug for treating gastric cancer, wherein the cDNA nucleotide sequence of hsa_circ_0136682 is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded thereby is shown in SEQ ID NO:

2.

6. The use according to claim 5, characterized in that The drug is hsa_circ_0136682 or a protein encoded thereby, or an expression vector of hsa_circ_0136682 or a protein encoded thereby.

7. The use according to claim 6, characterized in that The drug also includes a gene drug delivery system or a protein drug delivery system.

Images