A method for preparing a recombinant rescue virus of type Ⅺ Newcastle disease virus (F48E9), a recombinant virus and its application

Abstract

The present invention relates to the field of biomedical technology, and in particular to a method for preparing a recombinant rescued virus of type XI Newcastle disease virus (F48E9), a recombinant virus and an application thereof. By establishing a reverse genetics operating system for type XI Newcastle disease virus F48E9 strain, site-directed amino acid mutation is performed on the full-length genome P gene in the reverse genetics system, and the full-length NDV genome cDNA is rescued, and type XI Newcastle disease virus P protein mutant strains rF48E9 / P (R386A) and rF48E9 / P (K387A) are rescued. The toxicity of these two recombinant viruses is significantly weakened, and at the same time, they have high titers on chicken embryos, stable genetic properties, and no pathogenicity to animals, providing technical support for the development of a new generation of Newcastle disease vaccines.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, in particular to a method for preparing a recombinant rescue virus of type Ⅺ Newcastle disease virus (F48E9), a recombinant virus and an application thereof. Background Art

[0002] Newcastle Disease (ND) is an acute, highly lethal infectious disease caused by Newcastle Disease Virus (NDV), which is characterized by damage to the respiratory tract, digestive tract and nervous system of poultry. NDV is a single-stranded negative-sense RNA virus belonging to the Paramyxoviridae family and the genus Avian Paramyxovirus. NDV has only one serotype, but different genotypes exist. According to pathogenicity, NDV is divided into four different strains: rapid-onset visceral Newcastle disease virus, rapid-onset neurotropic Newcastle disease virus, intermediate-onset Newcastle disease virus and slow-onset asymptomatic enteric Newcastle disease virus. The total size of the NDV genome is 15186, 15192 or 15198 bp, and its genes encode six structural proteins including nucleoprotein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), hemagglutinin-nueraminidase (HN) and large polymerase protein (RNA-dependent RNApolymerase or large ploymerase, L), as well as two non-structural proteins V and W. The genome is arranged in the order of 3'-NP-PMF-HN-L-5'.

[0003] The viral RNA-dependent RNA polymerase (RdRp) composed of the viral L and P proteins and the nucleoprotein complex (NC) composed of the NP protein and the viral genomic RNA constitute the viral ribonucleoprotein (RNP) complex, which is the basic unit of NDV replication. Among them, the P protein has a total of 395 amino acids, and phosphorylation occurs on specific amino acid residues, resulting in its molecular weight ranging from 50 to 55 kDa. Different phosphorylation forms play a role in its formation of homo-oligomers. The C-terminal 32 amino acids (amino acids 316 to 347) and the N-terminal 59 amino acids of the P protein form a superhelical structure, which is the main region for interaction between LP, PP, and P-NP. The transcription of the P gene can produce auxiliary proteins V protein and W protein through RNA editing. The P protein, which plays a bridging role in the RNP complex, plays an indispensable role in the replication and transcription of the viral genome. At the same time, the P protein can interact with host proteins to regulate viral replication. However, there are currently few reports on the relationship between P protein and viral virulence. The structure and function of NDV gene sequences and strain evolution need further research in order to provide technical support for the development of a new generation of Newcastle disease vaccines. Summary of the invention

[0004] The invention provides a method for preparing a recombinant rescued virus of type XI Newcastle disease virus (F48E9), the recombinant virus and an application thereof. By establishing a reverse genetics operating system for the type XI Newcastle disease virus F48E9 strain, site-directed amino acid mutation is performed on a P gene in a full-length genome in the reverse genetics system, and the full-length NDV genome cDNA is rescued, so that type XI Newcastle disease virus P protein mutant strains rF48E9 / P (R386A) and rF48E9 / P (K387A) are rescued. The toxicity of the two recombinant viruses is significantly weakened, and the recombinant viruses have high titers on chicken embryos, stable genetic properties and no pathogenicity to animals. The invention provides technical support for the development of a new generation of Newcastle disease vaccines and solves the problems existing in the prior art.

[0005] One of the technical solutions adopted by the present invention is:

[0006] A method for preparing a recombinant rescue virus of type Ⅺ Newcastle disease virus (F48E9), comprising the following steps:

[0007] (1) Construction of full-length cDNA transcription vector of Newcastle disease virus type Ⅺ (F48E9) genome:

[0008] The full-length cDNA of the genome of type Ⅺ NDV F48E9 strain was constructed in plasmid pBR322, and the plasmid was named pBR322-rF48E9;

[0009] (2) Establishment of reverse genetics system of Newcastle disease virus type Ⅺ:

[0010] According to the sequence of the full-length infectious cloning vector pBR322-rF48E9 of the type Ⅺ NDV F48E9 strain, the primers required for constructing a vector in which different amino acid sites of the P protein are mutated to alanine (A) were designed; the construction of the vector was to amplify the point mutation fragment using the overlap method, and then connect the amplified fragment to the vector using the homologous recombination method, that is, 15-20bp of bases homologous to the end of the vector after enzyme cutting were added upstream and downstream of the primer; the constructed plasmid was named pBR322-rF48E9 / P(*A);

[0011] (3) Preparation of recombinant virus with amino acid point mutations in P protein of Newcastle disease virus type Ⅺ:

[0012] Plasmids pBR322-rF48E9 and pBR322-rF48E9 / P(*A) were co-transfected with pCI-NP, pCI-P and PCI-L, pCAGGS-T7 into BHK-21 cells (hamster kidney cells), respectively. Cell supernatants were collected 3-4 days after transfection and inoculated into the allantoic cavity of 9-11 day old SPF chicken embryos. Three cells were inoculated per sample, 0.2 mL / cell, and the recombinant virus rF48E9 / P(*A) and the control virus rF48E9 were successfully harvested.

[0013] Furthermore, the different amino acid mutation points in step (2) are 386 R or 387 K; The recombinant virus rF48E9 / P(R386A) or the recombinant virus rF48E9 / P(K387A) is prepared and harvested through step (3).

[0014] Furthermore, the method for constructing the cDNA transcription vector in step (1) comprises the following steps:

[0015] (1) The fragment between the AscI and RsrII sites of plasmid pBR322 was removed and replaced with a 122nt oligonucleotide linker; an 84nt hepatitis delta virus (HDV) antigenomic ribozyme sequence and a T7 RNA polymerase transcription termination signal were inserted into the downstream end of the linker;

[0016] (2) RNA was extracted from the allantoic fluid of chicken embryos infected with NDVF48E9, and the full-length cDNA of the complete 15192 nt genome was generated by RT-PCR; the full-length genome was constructed into 8 fragments, and 6 restriction endonuclease sites Pme I, Pac I, AsiS I, NotI and SnaBI were created in the 3' untranslated region (3'-UTR) of NP, P, M, F and HN genes respectively; 2 restriction sites SpeI and SacII were created in the L gene; and the RsrII restriction site on the HN and L gene sequences was deleted by overlapping PCR;

[0017] (3) The above fragments were cloned sequentially between the T7 promoter and the HDV antigen group ribozyme sequence of the pBR322 plasmid to obtain plasmid pBR322-rF48E9.

[0018] The second technical solution adopted by the present invention is:

[0019] A type Ⅺ Newcastle disease recombinant virus is prepared by the above-mentioned preparation method.

[0020] Furthermore, the type XI Newcastle disease recombinant virus is a virus that converts the type XI Newcastle disease virus P protein into 386 R amino acid or 387 The recombinant virus was obtained by point mutation of R amino acid to alanine.

[0021] Furthermore, the P protein of the type Ⅺ Newcastle disease recombinant virus 386 The R amino acid point mutation was changed from arginine (R) to alanine (A), and the recombinant virus rF48E9 / P (R386A) was obtained; P protein 387 The K amino acid point mutation was changed from lysine (K) to alanine (A), and the recombinant virus rF48E9 / P (K387A) was obtained.

[0022] Furthermore, the P protein encoding gene sequence of the recombinant virus rF48E9 / P(R386A) is shown in SEQ ID NO.2; the P protein encoding gene sequence of rF48E9 / P(K387A) is shown in SEQ ID NO.3.

[0023] The third technical solution adopted by the present invention is:

[0024] The use of the above-mentioned type Ⅺ Newcastle disease recombinant virus in the screening or evaluation of Newcastle disease antibodies or vaccines.

[0025] Beneficial effects of the present invention:

[0026] The present invention first constructs a reverse genetic operating system for type XI NDV strains, and successfully rescues recombinant viruses R386A and K387A with amino acid point mutations in the P protein by screening amino acid site-directed mutation sites. It is found through the determination of viral virulence indicators that these two recombinant NDVs with amino acid point mutations in type XI P proteins can weaken the virulence of the virus, and have stable genetic properties and no pathogenicity to animals. We have reason to infer that the NDV P protein plays a vital role in the virulence of the virus. The experiments of the present invention fully illustrate that there is a connection between the P protein and the virulence of the virus. The implementation of the technical solution of the present invention has laid a solid foundation for the development of NDV attenuated vaccines and basic research related to NDV. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of the construction of pBR322-F48E9 full-length cDNA vector;

[0028] Figure 2 It is used to construct the full-length cDNA vector for the amino acid mutations of P protein of Newcastle disease virus type Ⅺ at different sites.

[0029] Figure 3 Newcastle disease virus type XI P protein 386 R point mutation recombinant virus, 387 Rescue and identification of recombinant viruses with K point mutations;

[0030] Figure 4 for recombinant virus plaques;

[0031] Figure 5 is the growth characteristic of the recombinant virus in BHK-21 cells; the virus infection dose is 0.01 MOI;

[0032] Figure 6 The pathogenicity of the recombinant virus was measured; the recombinant virus infected 4-week-old chickens, and the animal challenge dose was 10 5 pfu / 100μL, the method of attack was nose drops and eye drops;

[0033] in, Figure 2 Figure A in the figure is a schematic diagram of the construction. Figure 2 Figure B shows the PCR amplification of the target mutation fragment. Figure 2 Figure C shows the sequencing result of the full-length cDNA vector; M: DL2000plus DNA standard;

[0034] Figure 3 Figure A shows the cell-pathogenic effect caused by virus rescue. Figure 3 Figure B in the figure shows the sequencing result of recombinant virus RNA;

[0035] Figure 4 Figure A is a picture of erosion spots. Figure 4Figure B shows the diameter and area of ​​the plaque formation;

[0036] Figure 6 Figure A is the survival curve. Figure 6 Figure B shows organ lesions in chicks. Figure 6 Figure C shows the virus titer of each tissue. Figure 6 Figure D is the result of tissue HE staining; brain: brain; adenogastric: glandular stomach; lung: lung; duodenum: duodenum; pancreas: pancreas; trachea: trachea; cerebrum: cerebrum; cerebellum: cerebellum; myogastric: muscular stomach; pleura: pleural trachea. DETAILED DESCRIPTION

[0037] In order to clearly illustrate the technical features of the present invention, the present invention is described in detail below through specific implementation methods in conjunction with the accompanying drawings.

[0038] Example 1 Construction of transcription vector:

[0039] The BHK-21 cells used by the inventors are hamster kidney cells; the culture medium contains 10% fetal bovine serum (ZITA); the NDVF48E9 strain (GenBank: MG456905) is preserved by the major animal disease prevention and control team of the College of Veterinary Medicine of Northwest Agriculture and Forestry University; SPF chicken embryos and SPF chickens are purchased from Shandong Haotai Experimental Animal Breeding Co., Ltd.

[0040] The reverse genetics platform of NDV F48E9 strain was constructed on a modified form of plasmid pBR322, i.e. pBR322 / m, in which the fragment between Asc I and Rsr II sites was removed and replaced by a 122nt oligonucleotide linker. An 84nt delta hepatitis virus (HDV) antigenomic ribozyme sequence and a T7 RNA polymerase transcription termination signal were inserted into the downstream end of the linker.

[0041] Design Linker according to the required restriction sites and connect it to the linearized vector pBR322 (Asc I / RsrII). The resulting plasmid is named pBR322m / Linker and used as the basic vector for subsequent full-length infectious cloning plasmids. The primer sequences are as follows:

[0042] Linker-F:

[0043] CGCGCCAAGCTTTTGTTTAAACGGCCCTTAATTAAGGACGCGATCGCGTA

[0044] TAAGAATGCGGCCGCCTAAACTATGCTACGTACCGGACTAGTCCTCCCCGC

[0045] GGGGATTCG

[0046] Linker-R:

[0047] GACCGAATCCCCGCGGGGAGGACTAGTCCGGTACGTAGCATAGTTTAGC

[0048] GGCCGCATTCTTATACGCGATCGCGTCCTTAATTAAGGGCCGTTTAAACAA AGCTTGG.

[0049] Example 2 Construction of full-length cDNA of NDV genome

[0050] In order to facilitate the construction of infectious clones of F48E9 strain, the full-length sequence of F48E9 was divided into eight fragments. Asc I and Rsr II are located in the cloning vector pBR322 / m; Pme I, Pac I, Asis I, Not I and SnaB I restriction sites are introduced into the 3'UTR region of NP, P, M, F, and HN through primers; Sac II is located inside the L gene; HN (6493bp) and L (13828bp) are subjected to nonsense mutation and Rsr II is deleted by Overlap PCR method, and ACTAGG in the L gene is mutated to ACTAGT, so that Spe I is introduced. The schematic diagram of the construction strategy is shown in the figure. Figure 1 shown.

[0051] SEQ ID NO.1 is the P protein gene sequence of NDV F48E9 strain.

[0052] Eight pairs of primers were designed to amplify the genome of NDV F48E9 strain; the primer sequences are as follows:

[0053] F1-F:

[0054] AGTTGGCGCGCCTAATACGACTCACTATAGGGACCAAACAGAGATTCTGT

[0055] GAGGTACGATAAAAAGC F1-R:

[0056] CCGGCGCGCCGTTTAAACTGTTGATGGGTCAAGTTGTGCCTGTGTTG F2-F:AGCTTTGTTTAAACAGAACCAAAGACATTAGAAAAAATACG F2-R:TGCCTTAATTAAGGTTGCGCGATTTTAATGAGATAATTAAGGTTGCGCGATTTTAATGAGGAGGAGGAGTF3-F2-F2:TGCCTTACCATGATTGATTGATTGATTGATTGA F3-R:ACGATTGCGATCGCGACAGATCATTATTGGCGCCGTGGTG

[0057] F4-F:ACGATTGCGATCGCTTATAGTTAGCTCACCTGTCTATC

[0058] F4-R:ATAGTTTAGCGGCCGCAATTCACACACAATTGCTCTTGGAGATAC F5-F:

[0059] ATAAGAATGCGGCCGCCTGTCAATTAGAAATTAAGAAAAAACTACC F5-R:ATCAGGTACGTATATTTTTTCTTAATCAAGTGACTATTGGCAAG F6-F:ATCAGGTACGTAGTAGTGAGATACGAGACAAAGCAACTCACF6-R:GGACTAGTAGTAGTAGTAGTCATCAAG

[0060] F7-F:GGACTAGTCCACCTGGTAATGGAGATTGGGCCAG

[0061] F7-R:TCCCCGCGGATAAGCCTCTTATTTTCGGGATTTC

[0062] F8-F:TCCCCGCGGAAGAAAAATGTTCAGTACTCACTGAG

[0063] F8-R:

[0064] GGTCCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCCACCAAACAA

[0065] AGATTTGGTGAATGACAGAAC

[0066] Design 2: nonsense mutation deletion of Rsr II for HN (6493 bp) and L (13828 bp), mutating ACTAGG in the L gene to ACTAGT, and introducing it into Spe I. The primer sequences are as follows: delRsr II 6493-F: TTCGAACAGCAGTCTTACTTTTAATAGTAGTGACCTTTTC delRsr II 6493-R:

[0067] GTCACTACTATTAAAAGTAAGACTGCTGTTCGAAATACCAAGCGC

[0068] CATGTATTTTTCG

[0069] delRsr II 13828-F: GGGCCAACCCCGACACAGTTCCTGAATTCAGTC

[0070] delRsr II 13828-R:

[0071] GACTGAATTCAGGAACTGTGTCGGGGTTGGCCCGAAATGTCGC

[0072] TGTGGGGGGTTCATC

[0073] The genomic RNA from the allantoic fluid of NDV F48E9 chicken embryos was extracted using the Trizol method. The detailed steps are as follows:

[0074] ① Take 250μL of chicken embryo allantoic fluid, add 250μL Trizol (TAKARA), shake and mix, and place at room temperature for 5 minutes; ② Add 200μL chloroform to each tube, cover the centrifuge tube tightly, shake vigorously for 15 seconds, place at room temperature for 10 minutes, and centrifuge at 4℃, 12000rpm for 15 minutes; ③ Take the upper aqueous phase and place it in a new centrifuge tube, add 700μL isopropanol, place at -20℃ for 30 minutes, and centrifuge at 4℃, 12000rpm for 10 minutes; ④ Discard the supernatant, add at least 1mL of Trizol per milliliter, add 75% ethanol and mix, centrifuge at 4℃, 7500g for 5 minutes; ⑤ Carefully discard the supernatant, dry at room temperature for 5-10 minutes, be careful not to dry too much, otherwise it will reduce the solubility of RNA; finally, dissolve the RNA in water. After reverse transcription of RNA into cDNA, use PCR method to amplify each gene fragment, cut the gel to recover the target fragment, and set aside.

[0075] According to the above primers, 8 fragments (F1-F8) of the entire genome were PCR amplified, and the amplified target fragments and the vector were double-digested, and each gene fragment was cloned into the modified vector pBR322m / Linker through the corresponding restriction sites. The constructed positive plasmid of the full-length infectious clone was named pBR322-rF48E9. The open reading frame (ORF) cDNA of the NP, P, and L genes was concatenated and cloned into the pCI eukaryotic expression vector to construct auxiliary plasmids pCI-NP, pCI-P, and PCI-L. The T7 RNA polymerase nucleotide sequence was gene-synthesized and cloned into pCAGGS to construct the auxiliary plasmid pCAGGS-T7. The cloned full-length cDNA of the corresponding genome is the basis for establishing a DNA reverse genetics operation platform, as a transcription template for the genomic negative-strand RNA.

[0076] Example 3 NDV F48E9 strain P protein 386 R. 387 Construction of full-length cDNA for site-directed amino acid mutagenesis:

[0077] Schematic diagram of the construction of recombinant mutant virus infectious clone plasmid Figure 2 As shown in A.

[0078] Our previous research results found that the host protein CARD11 interacts with the P protein and can inhibit the activity of NDV virus RNA polymerase, thereby inhibiting viral replication; further studies have found the specific amino acid sites where the P protein interacts with the CARD11 protein, namely 385 IRKI 388 Therefore, the experiment constructed 4 ( 385 I. 386 R. 387 K. 388 I) Different site mutation virus infectious clone plasmid, wherein P protein 386 R point mutation and 387 The K point mutation vector was connected to the target fragment and transformed to successfully rescue the virus, and the virus virulence was significantly reduced and the genetic stability was good; 385 I. 388 The recombinant virus with point mutation I could not be successfully rescued.

[0079] According to the sequence of the full-length infectious cloning vector pBR322-rF48E9 of NDV F48E9 strain, the P protein was designed and constructed. 385 I. 386 R. 387 K. 388I Primers required for point mutation vector. The construction of this vector uses the overlap method to amplify the point mutation fragment, and then uses the homologous recombination method to connect the amplified fragment to the vector, that is, 15-20bp of bases homologous to the end of the vector after enzyme cleavage need to be added upstream and downstream of the primer. The required point mutation primer sequence is as follows:

[0080] I385A-F: CGAAGAAGCCAGAAAAATCAAGCGCCTTG

[0081] I385A-R: GATTTTTCTGGCTTCTTCGATCGACCCG

[0082] R386A-F: AGAAATCGCAAAAATCAAGCGCCTTGCGC

[0083] R386A-R: CTTGATTTTTGCGATTTCTTCGATCGAC

[0084] K387A-F: AATCAGAGCAATCAAGCGCCTTGCGCTGA

[0085] K387A-R: GGCCTTGATTGCTCTGATTTCTTCGATC

[0086] I388A-F: CAGAAAAGCCAAGCGCCTTGCGCTGAATG

[0087] I388A-R: AAGGCGCTTGGCTTTTCTGATTTCTTCG

[0088] P Linker-F:

[0089] CACAACTTGACCCATCAACAGTTTAAACAGAACCAAAGACATTAGAAA

[0090] AAAATA P Linker-R:

[0091] ATCATTAATGTTGCAGGATTAATTAAGGTTGCGCGATTATTTAATGAG

[0092] Experimental methods:

[0093] (1) Amplification of target fragment: Using the above primers and template pBR322-rF48E9, overlap PCR was performed to obtain P protein 385 I. 386 R. 387 K.388 I single point mutation to alanine (A) gene sequence. After nucleic acid electrophoresis, the target band of the correct size was recovered by gel and stored at -20℃ for future use.

[0094] (2) Double digestion of infectious cloning vector: The infectious cloning vector pBR322-rF48E9 was double digested with Pac I and Mss I and incubated in a 37°C water bath for 60 min. The double-digested vector was run on agarose gel electrophoresis and cut, and then the vector was recovered using a gel recovery kit and ligated to the target fragment.

[0095] (3) Ligation: The target fragment and the vector are ligated using homologous recombination enzyme. The homologous recombination reaction system is 200 ng of linearized infectious cloning vector, 50 ng of target fragment, 2 μL of Exnase II, 4 μL of 5×CE II Buffer, and ddH2O to 20 μL, and incubate at 37°C for 30 min.

[0096] (4) Transformation: Take 20 μL of homologous recombination product, 10 μL of 5×KCM Buffer and 30 μL of ddH2O, mix well and transform into E. coli competent cells DH10β. After preparation, place on ice for 20 min, let stand at room temperature for 10 min, add autoclaved antibiotic-free LB medium, shake on an air shaker at 30°C and 180 rpm for 1 h, centrifuge and discard part of the supernatant, then take an appropriate amount of bacterial solution and spread on a tetracycline-resistant LB solid culture plate, and finally culture at 30°C for about 18 h.

[0097] (5) Screening and identification: After 12 hours of culture, single clones were picked and placed in 5 mL of tetracycline-resistant liquid LB, and the bacteria were shaken on an air shaker at 37°C and 230 rpm for about 10 hours, that is, when the bacterial concentration reached OD = 0.8, PCR identification of the bacterial solution was performed. The plasmids with correct sequencing were named pBR322-rF48E9P / (I385A), pBR322-rF48E9P / (R386A), pBR322-rF48E9P / (K387A), and pBR322-rF48E9P / (I388A), and stored at -20°C.

[0098] Experimental results: Using the infectious cloning vector pBR322-rF48E9 as a template, the P protein point mutation product amplified by overlap PCR was analyzed by nucleic acid gel electrophoresis. The results showed that there were bright bands of the correct size, and the fragment size was 1494bp. The results are as follows Figure 2 B. The amplified fragments were connected to the vectors by homologous recombination. The plasmids extracted from the bacterial solution with positive PCR were sent to the company for sequencing and the sequence was consistent with the target sequence ( Figure 2 C).

[0099] Example 4 NDV F48E9 strain P protein 386 R. 387 Rescue of recombinant virus by site-directed amino acid mutation of K:

[0100] (1) Co-transfection: BHK-21 cells were passaged into 6-well cell culture plates one day in advance, and co-transfection was performed when the cell density reached about 75% within 24 hours. The transfection was performed according to the transfection mass ratio of pBR322-rF48E9 or pBR322-rF48E9P / (R386A) or pBR322-rF48E9P / (K387A): pCAGGS-T7: pCI-NP: pCI-P: PCI-L = 5:2:2:2:1. The TurboFect transfection kit (Thermo Fisher) was used and the operation was performed according to the instructions of the kit. The cells were cultured in a cell culture incubator for about 4 days. The non-mutated infectious clone plasmid pBR322-rF48E9 was used as a positive control. Note that the wells without transfection of the infectious clone plasmid should be set as negative controls.

[0101] (2) Chicken embryo inoculation: Observe whether the cells show cytopathic effects, and decide the time to harvest the cell supernatant based on the cell status, which is about 3-4 days. Inoculate the harvested supernatant into the allantoic cavity of 9-11 day old SPF chicken embryos. Each chicken embryo should be inoculated with about 200 μL and placed in an incubator. Discard chicken embryos that die within 24 hours. Harvest the chicken embryo allantoic fluid 3 days later and conduct a hemagglutination (HA) test.

[0102] (3) HA experiment: Take 50 μL of allantoic fluid and perform hemagglutination test (HA) according to the traditional method. 6-8 , obtained F48E9 strain P protein 386 R site-directed amino acid mutation recombinant virus rF48E9P / (R386A), P protein 387 K site-directed amino acid mutation recombinant virus rF48E9P / (K387A) and control virus rF48E9.

[0103] (4) Experimental results: After the rescue plasmid system was co-transfected into BHK-21 cells, lesions were observed on the third day in cells transfected with pBR322-rF48E9 / P(R386A), pBR322-rF48E9 / P(K387A) and the positive control pBR322-rF48E9 ( Figure 3 A), and the other three wells showed no lesions. On the 4th day, the cell supernatants of all wells were collected, and the allantoic fluid was collected after inoculation with chicken embryos. The HA results showed that rF48E9 / P(R386A), rF48E9P / (K387A) and rF48E9 were all positive, with titers of 2 8 , 2 8 and 27 .

[0104] In the experiment of the present invention, rF48E9P / (I385A) and rF48E9P / (I388A) were not successfully rescued. We also made many attempts under the premise of ensuring that all experimental materials were accurate, such as multiple experimental operations (up to 20 times) without positive virus; changing different experimental personnel to perform experimental operations also failed; changing cells to rescue also failed. We speculate that 385 I. 388 The two isoleucines (I) of I play a key role in the spatial structure of the viral P protein or the function of the P protein, thereby affecting the transcription, replication or assembly of the virus. The role of these two sites needs further study.

[0105] Example 5 NDV F48E9 strain P protein 386 R. 387 Identification of recombinant viruses with site-directed amino acid mutations in K:

[0106] The obtained F48E9 strain P protein 386 R. 387 The K site-directed amino acid mutation recombinant viruses rF48E9P / (R386A), rF48E9P / (K387A) and the control virus rF48E9 were passaged to the 10th generation using 9-day-old SPF chicken embryos. The RNA of the 10th generation virus was extracted, reverse transcribed into cDNA, and the target fragment was amplified. The target fragment was recovered by gel excision and sent for sequencing.

[0107] Experimental results: The 386th amino acid mutation site of the P protein of the rF48E9 / P (R386A) strain and the mutations at the 1156th and 1157th nucleotide sequence sites still exist, indicating that the recombinant mutant virus rF48E9 / P (R386A) has good genetic stability; the 387th amino acid mutation site of the P protein of the rF48E9P / (K387A) strain, i.e. the mutations at the 1159th and 1160th nucleotide sequence sites, still exist, indicating that the genetic stability of the two recombinant mutant viruses is good ( Figure 3 B).

[0108] Example 6 NDV F48E9 strain P protein 386 R. 387 Analysis of biological characteristics of recombinant viruses with site-directed amino acid mutations in K:

[0109] Experimental method 1: Virus virulence determination

[0110] (1) Determination of the mean time (MDT) for the minimum lethal dose of virus to chicken embryos: Fresh infected allantoic fluid was diluted 10 times with sterile saline to make 10 -6 ~10-9 ; Each dilution was inoculated into 5 9-10 day old SPF chicken embryos through the allantoic cavity, each chicken embryo was inoculated with 0.1 mL, and cultured at 37°C; the remaining virus dilution was stored at 4°C, and after 8h, another 5 chicken embryos were inoculated with 0.1 mL for each chicken embryo, and cultured at 37°C; the eggs were illuminated twice a day for 7 consecutive days, and the death time of each chicken embryo was recorded; the minimum lethal dose refers to the maximum dilution that can cause the death of all chicken embryos inoculated with this dilution; MDT refers to the average time (h) of the minimum lethal dose causing the death of all chicken embryos, and the calculation formula is as follows:

[0111]

[0112] Where:

[0113] NX——number of embryos that died in X hours;

[0114] NY——number of embryos that died in Y hours;

[0115] X(Y)——embryo death time (h);

[0116] T is the total number of dead embryos.

[0117] (2) Determination of intracerebral inoculation pathogenicity index (ICPI) of 1-day-old SPF chicks: Take fresh infected allantoic fluid (no older than 24-48 hours, and negative for bacteria) with an HA titer of more than 1:16, and dilute it 10 times with sterile isotonic saline; intracerebral inoculation of SPF chicks between 24 and 40 hours after hatching, a total of 10 chicks, inoculated with 0.05 mL per chick; observe once every 24 hours for a total of 8 days; the chickens should be scored every day, with normal chickens scored as 0, sick chickens scored as 1, and dead chickens scored as 2 (each dead chicken is still scored as 2 in the daily observation after its death); ICPI is the average of all observation values ​​for each chicken within 8 days, and the calculation formula is as follows:

[0118]

[0119] Where:

[0120] ∑s——the cumulative number of cases in 8 days;

[0121] ∑d——8-day cumulative number of deaths;

[0122] T——The total number of chickens observed in 8 days.

[0123] Experimental results: The MDT values ​​of rF48E9 / P(R386A), rF48E9P / (K387A) and rF48E9 strains were 69.7h, 75.35h and 52.0h, respectively. The ICPI values ​​of rF48E9 / P(R386A), rF48E9P / (K387A) and rF48E9 strains were 1.50, 1.5625 and 2.0, respectively. The above results show that the recombinant mutant viruses rF48E9 / P(R386A) and rF48E9P / (K387A) are medium-virulence strains, and rF48E9 is a strong strain and has not changed compared with the wild strain F48E9. 386 R. 387 After the K mutation, the virulence of the virus is weakened, and 387 The virus becomes less virulent after the K mutation.

[0124] Experimental Method 2: Virus Plaque

[0125] One day in advance, BHK-21 cells were plated in 6-well cell culture plates. When the cell density reached about 75% within 24 hours, the allantoic fluid containing the recombinant virus was diluted 10 times with sterile saline to 10 -4 ~10 -7 Infect cells, cover each well with 2mL of 1% methylcellulose cell culture medium, place in a cell culture incubator, and harvest when the virus plaques formed no longer increase. Slowly discard the culture medium, fix with methanol for 10 minutes, wash away the methanol with PBS, add an appropriate amount of 0.1% crystal violet to stain for 20 minutes, wash the floating color with running water, take pictures after drying, and record the data.

[0126] Experimental results: The plaques produced by the recombinant virus are as follows Figure 4 A. Data analysis of the plaques formed. The diameter of the plaques formed by the recombinant mutant viruses rF48E9 / P(R386A) and rF48E9P / (K387A) Figure 4 B left) and area ( Figure 4 B right) were significantly smaller than the control virus rF48E9, indicating that the recombinant mutant viruses rF48E9 / P(R386A) and rF48E9P / (K387A) had weakened syncytium-forming ability.

[0127] Experimental method 3: Virus growth characteristics

[0128] (1) Virus infection experiment: BHK-21 cells were infected with recombinant viruses. The experimental steps were as follows: cells were counted and plated one day in advance. The cell supernatant was discarded on the next day and the cells were rinsed twice with sterile PBS. The recombinant viruses were mixed evenly with serum-free DMEM (GIBCO) culture medium at an infection dose of 0.01 MOI, and the virus dilution was slowly added to each well of the cell culture plate. The cells were placed at 37°C for 1-2 hours, and the culture dish was gently shaken during this period to allow the virus to be evenly adsorbed. The virus suspension was discarded and the cells were rinsed twice with sterile PBS. DMEM cell culture medium containing 2% serum was added and placed in a cell culture incubator. The cell pathological changes were observed every 12 hours after infection, and the results were recorded by taking photos. Cell samples were collected at 36 hours, and the expression of viral proteins in the cells was detected by Western blot.

[0129] (2) Virus titer determination: After cells were infected with the virus, the supernatant was collected every 12 hours and the half tissue culture infectious dose (TCID 50 ) determination. The method is as follows: one day in advance, BHK-21 cells were plated in a 96-well cell culture plate and the cell status was observed. The cell density was preferably 70-85%. The collected cell supernatant was diluted 10 times to 10 with serum-free DMEM medium. -1 ~10 -8 , and repeat at least three groups for each dilution. The pipette tip must be changed for each dilution gradient. When adding samples, add along the side wall of the centrifuge tube, and the pipette tip must not touch the culture medium. Discard the liquid from the 96-well culture plate first. Note: Do not discard too many wells at a time to avoid cell death due to drying. When aspirating liquid, the pipette tip should not touch the bottom of the 96-well plate. Add diluted toxic culture medium in order from low concentration to high concentration, 100 μL per well. After 1 hour, discard the toxic culture medium and add 2% serum DMEM culture medium, 100 μL per well. Place in a cell culture incubator and culture for about 2 to 3 days, take out and observe the results. The latest survival time of the uninfected cells is the last observation time, and the result obtained is the final result.

[0130] TCID 50 / mL was calculated using the Reed-Muench method.

[0131] Experimental results: After the recombinant mutant virus rF48E9 / P(R386A), rF48E9P / (K387A) and the recombinant wild virus rF48E9 were infected with BHK-21 cells at a dose of 0.01MOI, the cytopathic effect was observed and it was found that the recombinant wild virus rF48E9 could observe syncytia at 12hpi, the syncytia was obvious at 24hpi, and all the cells died at 48hpi. After infection with the two recombinant mutant viruses, the number of cell nuclei fused to form syncytia was significantly less, the cells showed vesicular degeneration at 36hpi, and all the cells died at 60hpi, which was 12h later than rF48E9, indicating that the recombinant mutant virus P protein amino acid mutations at positions 386 and 387 can delay cytopathic effect compared with the non-mutated virus, weaken the syncytia formation ability, and reduce the cytopathic ability. The results of virus titer detection of cell samples collected every 12 hours showed that the proliferation ability of recombinant viruses rF48E9 / P(R386A) and rF48E9P / (K387A) in BHK-21 cells was slightly reduced but there was no significant difference ( Figure 5 ).

[0132] Example 7 Pathogenicity of the recombinant virus:

[0133] Experimental purpose: To detect the P protein of Newcastle disease virus type Ⅺ rescued by reverse genetics technology 386 R. 387 Pathogenicity of the recombinant virus with K amino acid point mutation to SPF chickens.

[0134] Experimental methods:

[0135] (1) Virus challenge procedure: Fifteen 4-week-old SPF white Leghorn chickens were randomly divided into three groups, with six chickens in each experimental group and three chickens in each negative control group. Chickens in the experimental group were infected with the recombinant virus rF48E9 (10 5 pfu / 100μL), chickens in the second group were infected with the recombinant mutant virus rF48E9 / P(R386A) (10 5 pfu / 100μL), chickens in the three experimental groups were infected with the recombinant mutant virus rF48E9 / P(K387A) (10 5 pfu / 100μL). The three groups of chickens were raised in three isolators, respectively, and provided with sufficient water and feed. Each group of chickens was observed twice a day to observe clinical symptoms and calculate the survival rate of the chickens.

[0136] (2) Animal tissue collection and processing: Tissues and organs of dead chickens in each group were collected, and part of all collected tissues were fixed with 4% paraformaldehyde for histopathological analysis; part of them were used for TCID 50, determine the viral load of each tissue. Disinfect your hands before sampling, sterilize metal and glass instruments with high-pressure steam, disinfect the white porcelain plate with alcohol, and fix the animal on it. Sampling can be performed on a clean bench. When sampling, disinfect the scissors and tweezers after finding the target tissue, then take samples, and disinfect them again after sampling before collecting the next tissue. When disinfecting, first wipe the blood and dirt on the scissors and tweezers with an alcohol cotton ball, burn them on the outer flame of an alcohol lamp for sterilization, put them in 75% alcohol for use, burn them again before use, and wait until they cool to room temperature before use. The removed samples should be placed in a 1.5mL centrifuge tube as soon as possible, and the tissue type and sampling time should be marked.

[0137] (3) HE staining of tissues: The collected tissues were fixed with 4% paraformaldehyde overnight and then sent to Xi'an Yike Biotechnology Co., Ltd. for paraffin embedding, sectioning and HE staining.

[0138] (4) Tissue viral load: Record the weight of each collected tissue and organ. Generally, add 600 μL PBS solution for every 0.2 g of tissue. Grind the tissue according to the instructions of the grinder and centrifuge at 6000 rpm for 5 minutes. Pipette the supernatant into a new sterile 1.5 mL EP tube, add double antibodies (penicillin and streptomycin, 5000 IU / mL), and store at 4°C overnight. Subsequently, centrifuge at 6000 rpm for 5 minutes at low temperature, take the supernatant and place it in a sterile EP tube for TCID 50 / mL experiment. The collected tissue grinding supernatant was diluted 10 times with serum-free DMEM medium to 10 0 ~10 -7 Each dilution was repeated at least three times and inoculated into BHK-21 cells that were plated one day in advance. TCID 50 / mL, observe the results and record the data.

[0139] Experimental results: (1) Chicks infected with rF48E9 showed mild symptoms of depression and open mouth breathing at 2 dpi. Three chicks died at 3 dpi. The remaining chicks had loose stools, loss of appetite, fluid-filled crops, and leg paralysis. All chicks died at 5 dpi. However, no obvious clinical symptoms were observed in chicks infected with rF48E9 / P (R386A) and rF48E9 / P (K387A) until 10 dpi. The chickens in the PBS control group were healthy throughout the experiment. The results showed that the mortality rate of rF48E9 was 100%, and rF48E9 / P (R386A) and rF48E9 / P (K387A) were not lethal to 4-week-old chicks. Survival curves are shown in Figure 6A. (2) Autopsy of dead chickens revealed that the crop of chicks infected with rF48E9 was filled with thin fluid and gas, edema was visible in the lungs, meningeal hemorrhage but no visible changes in the brain parenchyma, necrotic foci in the spleen, most obvious in the duodenum, bleeding spots in the glandular stomach papillae, edema and hemorrhage in the bursa of Fabricius, and no special pathological changes in the liver and kidneys. At 6 dpi, chicks infected with rF48E9 / P (R386A) and rF48E9 / P (K387A) were randomly autopsied and no abnormal pathological changes were found in any tissue or organ. The lesions of various tissues and organs are as follows Figure 6 B. (3) Figure 6 As shown in Figure C, rF48E9 can proliferate in all tissues and organs collected, and its replication ability is higher than that of rF48E9 / P(R386A) and rF48E9 / P(K387A). These results show that the viral replication ability of the mutant strain in vivo is reduced compared with the wild-type strain. (4) HE staining results are shown in Figure Figure 6 As shown in D, the pathological changes of various tissues infected with rF48E9 were obvious, and the duodenum, glandular stomach, gizzard and trachea all had bleeding, among which the duodenal tissue bleeding was the most serious, the duodenum and glandular stomach tissue cells were obviously degenerated and necrotic, there was slight inflammatory cell infiltration in the gizzard tissue, and vascular cuffing phenomenon appeared in the brain and cerebellum tissue; while the pathological changes of various tissues infected by rF48E9 / P (R386A) and rF48E9 / P (K387A) were significantly alleviated, only slight bleeding was found in the brain and glandular stomach, slight degeneration and necrosis of duodenum and glandular stomach tissue cells, and no obvious lesions were found in the cerebellum, gizzard and trachea.

[0140] The above specific implementation manner cannot be used as a limitation on the protection scope of the present invention. For those skilled in the art, any substitution, improvement or change made to the implementation manner of the present invention falls within the protection scope of the present invention.

[0141] The matters not described in detail in the present invention are all known technologies to those skilled in the art.

Claims

1. A method for preparing a recombinant rescue virus of type Ⅺ Newcastle disease virus F48E9, comprising the following steps: (1) Construction of full-length cDNA transcription vector of Newcastle disease virus type Ⅺ F48E9 genome: The full-length cDNA of the type Ⅺ NDV F48E9 strain genome was constructed in plasmid pBR322, and the plasmid was named pBR322-rF48E9; (2) Establishment of the reverse genetics system of Newcastle disease virus type Ⅺ: According to the sequence of the full-length infectious cloning vector pBR322-rF48E9 of type Ⅺ NDV F48E9 strain, the primers required for constructing the vector in which different amino acid sites of the P protein are mutated to alanine (A) were designed; the constructed plasmid was named pBR322-rF48E9 / P (*A); wherein, The different amino acid mutation points are 386 R or 387 K; (3) Preparation of recombinant virus with amino acid point mutations in P protein of Newcastle disease virus type Ⅺ: Plasmid pBR322-rF48E9 / P (*A) was co-transfected with pCI-NP, pCI-P, pCI-L, and pCAGGS-T7 into BHK-21 hamster kidney cells, respectively. Cell supernatants were collected 3-4 days after transfection and inoculated into the allantoic cavity of 9-11 day old SPF chicken embryos to successfully harvest recombinant virus rF48E9 / P (R386A) or recombinant virus rF48E9 / P (K387A).

2. The method for preparing a recombinant rescued virus of type Ⅺ Newcastle disease virus F48E9 according to claim 1, characterized in that: Step (1) The method for constructing a cDNA transcription vector comprises the following steps: (1) The fragment between the AscI and RsrII sites of plasmid pBR322 was removed and replaced with a 122nt oligonucleotide linker; an 84nt hepatitis delta virus (HDV) antigenomic ribozyme sequence and a T7 RNA polymerase transcription termination signal were inserted into the downstream end of the linker; (2) RNA was extracted from the allantoic fluid of chicken embryos infected with NDVF48E9, and the full-length cDNA of the complete 15192 nt genome was generated by RT-PCR; the full-length genome was constructed into 8 fragments, and 6 restriction endonuclease sites Pme I, Pac I, AsiS I, NotI and SnaBI were created in the 3' untranslated region (3'-UTR) of NP, P, M, F and HN genes respectively; Two restriction sites, SpeI and Sac II, were created in the L gene; the RsrII restriction site on the HN and L gene sequences was deleted by overlapping PCR; (3) The above fragments were cloned in sequence between the T7 promoter and the hepatitis virus HDV antigenomic ribozyme sequence of the pBR322 plasmid to obtain the plasmid pBR322-rF48E9.

3. A type XI recombinant Newcastle disease virus, characterized in that: The preparation method as claimed in claim 1 or 2 is used to prepare: Newcastle disease virus type Ⅺ P protein 386 The amino acid point mutation of R was from arginine to alanine (A), and the recombinant virus rF48E9 / P (R386A) was obtained; Newcastle disease virus type Ⅺ P protein 387 The K amino acid point mutation was from lysine to alanine (A), resulting in the recombinant virus rF48E9 / P (K387A); The P protein encoding gene sequence of the recombinant virus rF48E9 / P (R386A) is shown in SEQ ID NO.2; the P protein encoding gene sequence of the recombinant virus rF48E9 / P (K387A) is shown in SEQ ID NO.

3.

4. Use of the type XI Newcastle disease recombinant virus as claimed in claim 3 in the preparation of Newcastle disease antibodies or vaccines.

Images