A kind of Aspergillus terreus strain and its application

Abstract

This invention relates to the field of microbial technology, and in particular to a strain of *Aspergillus terreus* and its applications. The preservation number of the *Aspergillus terreus* strain is CCTCC NO: M 20231397. The *Aspergillus terreus* fungus JH92 can significantly inhibit the mycelial growth, sclerotium germination, and sclerotium formation of *Sclerotinia sclerotiorum*, and has broad-spectrum antibacterial activity. Microbial pesticides made using this *Aspergillus terreus* fungus JH92 or its metabolites as active ingredients have inhibitory effects on a variety of plant pathogens and can be used to control various plant diseases caused by multiple plant pathogens, with a wide range of applications.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, in particular to an Aspergillus terreus strain and application thereof. Background Art

[0002] Sclerotinia is a worldwide fungal disease caused by pathogens that produce sclerotia. These pathogens include Sclerotinia and Botrytis of the Ascomycetes and Rhizoctonia and Sclerotium of the Basidiomycetes. The main pathogen causing sclerotinia of vegetables is S. sclerotiorum of the genus Sclerotinia, which can infect more than 400 plant species in 75 families and 278 genera worldwide, including many important crops, most of which are dicotyledons, such as various vegetables including greens, lettuce and romaine lettuce, often causing huge economic losses.

[0003] The primary source of infection of Sclerotinia sclerotiorum is mainly the germination of sclerotia to form ascodis and release ascospores. After the ascospores are strongly ejected from the asci of the ascodis, they are carried by the wind to the entire field or adjacent fields, infecting the above-ground plants. When Sclerotinia sclerotiorum infects the host, brown spots appear on the host surface, which in turn causes severe tissue degradation and forms soft rot. For most infected hosts, the initial infection often manifests as water-soaked spots on the surface of leaves or young stem tissues, and then the spots slowly expand to form water-soaked soft rot; in addition to infecting leaves and young stem tissues, Sclerotinia sclerotiorum will also infect the host's stems or twigs. As the spots develop, ring-shaped spots form on the infected stems, causing the terminal leaves to turn yellow, then brown, until the entire plant dies. A large number of black sclerotia are usually produced on the dead tissue, which serves as the inoculum for the following year.

[0004] In the prior art, comprehensive control measures are usually adopted to prevent and control plant diseases caused by plant pathogens, including: selecting disease-resistant varieties, strengthening cultivation management, and rationally using chemical pesticides. Although the prevention and control method of promoting disease-resistant varieties is the most economical and effective, there are currently no varieties that are completely disease-resistant or completely immune. Cultivation management cannot fundamentally solve the harm of plant pathogens. The long-term use of chemical agents may lead to the increase of plant pathogen resistance, and there are also pesticide residues and safety issues. Biological control methods have the advantages of long-lasting effect, low environmental pollution, and good safety. The use of biological control measures to control plant diseases with bacteria has broad market prospects. On the one hand, biological bacterial agents are safe and environmentally friendly, will not cause pesticide residues, are safer, can also avoid the generation of plant resistance, and are easy to mix with other pesticides; on the other hand, some biological control bacteria have a wide antibacterial spectrum and can be used to prevent and control a variety of plant diseases. For example, the Chinese patent document with publication number CN112680360A discloses a strain of Aspergillus polymorpha, the preservation number of which is CGMCC No. 19278. It has nitrogen fixation and strong secretion ability, has a strong inhibitory effect on fungi and bacteria, can promote the germination of plant seeds, and can achieve the growth-promoting effect by regulating the content of endogenous hormones in plants; the Chinese patent document with publication number CN109182145A discloses a strain of Aspergillus aculeatus, the preservation number of which is CCTCC NO: M 2018648, which has good preventive effect on soil-borne diseases of vegetables.

[0005] Therefore, screening out new biocontrol strains that can colonize in the soil and inhibit the growth of a variety of plant pathogens is a prerequisite for the development of biocontrol agents and plays an important role in the effective prevention and control of plant diseases. Summary of the invention

[0006] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide an Aspergillus terreus strain and application thereof, so as to solve the problems in the prior art.

[0007] To achieve the above purpose and other related purposes, the present invention provides an Aspergillus terreus strain Aspergillus sp. JH92, with a deposit number of CCTCC NO: M 20231397.

[0008] The present invention also provides a microbial agent, which is the fermentation liquid of the Aspergillus terreus strain JH92.

[0009] The present invention also provides a method for preparing the microbial agent, which comprises the following steps: inoculating the Aspergillus terreus strain JH92 cake into a culture solution for cultivation, and obtaining the Aspergillus fungus JH92 fermentation solution, which is the microbial agent.

[0010] The present invention also provides the use of the Aspergillus terreus strain JH92 or the microbial agent in the preparation of microbial pesticides.

[0011] The present invention also provides a microbial pesticide, which is prepared from the microbial agent and includes the Aspergillus terreus strain JH92 or its metabolites.

[0012] The present invention also provides a method for preparing the microbial pesticide, the method comprising centrifuging the microbial agent and collecting the supernatant as the microbial pesticide; or the method comprising the following steps:

[0013] 1) filtering the microbial agent to remove the bacterial cells and obtain a filtrate;

[0014] 2) extracting the filtrate, retaining the extract and concentrating it to obtain a crude extract;

[0015] 3) further purifying the crude extract to obtain the microbial pesticide.

[0016] The present invention also provides the use of the Aspergillus terreus strain JH92 or the microbial agent or the microbial pesticide in inhibiting plant pathogens, or in preventing or treating plant diseases caused by plant pathogens.

[0017] The present invention also provides a method for preventing or treating plant diseases, comprising the following steps: applying the microbial agent or microbial pesticide to plants.

[0018] As described above, the Aspergillus terreus strain of the present invention and its application have the following beneficial effects:

[0019] (1) The Aspergillus terreus fungus JH92 screened by the present invention can significantly inhibit the mycelial growth, sclerotial germination and sclerotial formation of S. sclerotiorum, and has a good application prospect in preventing and controlling lettuce sclerotinia disease.

[0020] (2) The Aspergillus fungus JH92 screened by the present invention has a broad-spectrum antibacterial activity, and has an inhibitory effect on plant pathogens such as S. sclerotiorum, P. microspora, R. solani (isolated from rice), F. oxysporum (isolated from soybean), P. capsici, F. fujikuroi and B. sorokiniana, and can be used to prevent and control a variety of plant diseases caused by a variety of plant pathogens, and has a wide range of applications.

[0021] (3) The microbial pesticide prepared by using the Aspergillus fungus JH92 or its metabolites as active ingredients has good antibacterial effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the colony morphology of Aspergillus terreus strain JH92.

[0023] Figure 2 Phylogenetic tree constructed by combining the ITS region and β-tubulin, rpb2, and CMD gene sequences of Aspergillus.

[0024] Figure 3 This is a diagram showing the results of a plate confrontation experiment between Aspergillus terreus JH92 and Sclerotinia sclerotiorum, where A is the control group and B is the treatment group.

[0025] Figure 4 This is a diagram showing the inhibitory effect of microbial pesticides on the mycelial growth of Sclerotinia sclerotiorum, wherein A is a control group without microbial pesticides, and B is a treatment group with microbial pesticides added.

[0026] Figure 5 This is a diagram showing the inhibitory effect of microbial pesticides on the germination of Sclerotinia sclerotiorum, wherein A is the control group without microbial pesticides, and B is the treatment group with microbial pesticides added.

[0027] Figure 6 This is a diagram showing the effect of microbial pesticides on the sclerotia formation of Sclerotinia sclerotiorum, where A is the control group without microbial pesticides, and the concentration of microbial pesticides in BD is gradually increased.

[0028] Figure 7 This is a graph showing the control effect of microbial pesticides on lettuce sclerotinia disease, where A is the control group sprayed with clean water, and B is the treatment group sprayed with microbial pesticides.

[0029] Figure 8 This is a graph showing the results of a plate confrontation experiment between Aspergillus terreus JH92 and six plant pathogens.

[0030] Fig. 9 This is a graph showing the inhibitory effect of microbial pesticides on the mycelial growth of six plant pathogens. DETAILED DESCRIPTION

[0031] The invention provides an Aspergillus terreus strain, which is classified and named Aspergillus sp. JH92, with strain number JH92, preservation number CCTCC NO: M 20231397, preservation unit is China Center for Type Culture Collection, preservation date is August 9, 2023, and preservation address is Wuhan University, Wuhan, China.

[0032] The Aspergillus fungus JH92 was isolated from the soil of a lettuce field in Shanghai Chunchang Vegetable and Fruit Professional Cooperative in Qingpu District, Shanghai. The strain was identified as Aspergillus terreus through morphological observation, genomic DNA extraction, PCR amplification, gene sequence determination and phylogenetic analysis.

[0033] The ITS rDNA gene sequence of strain JH92 is shown in SEQ ID NO.1, the β-tubulin gene sequence is shown in SEQ ID NO.2, the RNA polymerase II (rpb2) gene sequence is shown in SEQ ID NO.3, and the calmodulin (CAM) gene sequence is shown in SEQ ID NO.4.

[0034] SEQ ID NO.1:CGGAAGGATCATTACCGAGTGCGGGTCTTTATGGCCCAACCTCCCACCCGTGACTATTGTACCTTGTTGCTTCGGCGGGCCCGCCAGCGTTGCTGGCCCGCCGGGGGGCGACTCGCCCCCGGGCCCGTGCCCGCCGGAGAC CCCAACATGAACCCTGTTCTGAAAGCTTGCAGTCTGAGTGTGATTCTTTGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTCAGT GAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCTCGTCCCCCGGCTCCCGGGGGACGGGCCCGAAAGGCAGCGG CGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCTTCCGCTCCGTAGGCCCGGCCGGCGCCCGCCGACGCATTTATTTGCAACTTGTTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATA

[0035] SEQ ID NO.2:

[0036] TGCTGCTTTCTGGTACGTCTGGAATCAACCTGGGGAATGCTGGCTCTCGTGGGATGCAGAGTCTTACGGACATGCGTCCTCGGGCTAAAAAGGGTTCTGTGGTGGCATGATGCTGACAACTGTACAGGCAAACCATCTCTGGCGAGCACGGCCTTGATGGCTCCGGTGTGTAAGTGTCACCGACGCCCGCTCAATGGGCTCCCATAATGGAGGTTTACACGACGATGGACGATTCTGATGTGGAAACAGCTTCAATGGCTCCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACGTCCCTTCCACACCATCCTGGGACAGATTCTCCACGCTCCAAAGACCTCGACACTAATTTCGATCCCCTTTAGGCCAGCGGAAACAAGTATGTTCCTCGTGCCGTCCTCGTTGACCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCCGGTAACAACTGGGCCAAGGGT

[0037] SEQ ID NO.3:

[0038]

[0039] SEQ ID NO.4:

[0040] CCTTCTCCCTCTTCGTATGTCTTGACTTACCCCTCTTCCATCTCTCCGTGTTCCAGGCTCGTTTTCCGAAACACAAGCTAACTGGGATTCTCCTCTGTTTTAGGACAAGGATGGTGATGGTTAGTGCAATTTCCC GCTCCGATTGCCTCATGCGACCGATCGATTGCATCGTTCTATGTCGAATCTCGAGTCTTGACTTTATCTTCTGTTATGGTCGATCATTTAACACCATGTAGGCCAGATCACCACCAAGGAGCTGGGAACCGTCAT GCGCTCGCTGGGCCAGAACCTCCGAGTCGGAGCTCCAGGACATGATCAACGAGGTTGATGCTGACAACAACGGCACCATTGACTTTCCTGGTACGTTCCGTTCTACACGAGTCGCTGGAACCAGTTGTTGACA TTTCCTTGAACAGAGTTCCTCACGATGATGGCCCGCAAGATGAAAGACACCGACTCCGAGGAGGAAATCCGGGAAGCTTTCAAGGTCTTTGACCGCGATAACAACGGTTTCATCTCCGCCGCCGAGCTGCGCCACG

[0041] In the plate confrontation experiment between the Aspergillus terreus strain JH92 and Sclerotinia sclerotiorum, the hyphae inhibition rate of Sclerotinia sclerotiorum was 51.42%. The hyphae inhibition rate was detected by the following method:

[0042] 1) Transfer the Aspergillus terreus strain JH92 bacterial cake to the edge of the plate containing PDA, and connect the activated Sclerotinia sclerotiorum bacterial cake to the other end of the plate. The plate without Aspergillus JH92 bacterial cake was used as the control;

[0043] 2) The plate was incubated at 25°C. After the hyphae of the control group grew all over the plate, the antibacterial effect of the treatment group was observed, and the inhibition rate of Aspergillus fungus JH92 on the growth of Sclerotinia sclerotiorum hyphae was calculated according to the following formula:

[0044] Mycelial growth inhibition rate (%) = [(the colony diameter of Sclerotinia sclerotiorum in the control group - the colony diameter of Sclerotinia sclerotiorum in the treatment group) / the colony diameter of Sclerotinia sclerotiorum in the control group] × 100%.

[0045] The present invention also provides a microbial agent, which is the fermentation liquid of the Aspergillus terreus strain JH92.

[0046] In the microbial agent, the content of the Aspergillus terreus strain JH92 is 1×10 7 ~10 8 Spores / mL or more.

[0047] The present invention also provides a method for preparing the microbial agent, which comprises the following steps: inoculating the Aspergillus terreus strain JH92 cake into a culture solution for cultivation, and obtaining the Aspergillus fungus JH92 fermentation solution, which is the microbial agent.

[0048] In certain embodiments of the present invention, the culture medium is potato glucose culture medium (PDB culture medium). The PDB culture medium comprises potatoes, glucose and water. In one embodiment, the PDB culture medium comprises 200 g of potatoes, 20 g of glucose and 1 L of deionized water.

[0049] In certain embodiments of the present invention, the culture conditions include any one or more of the following: 24-26° C., 160-190 rpm, and a culture time of 5-14 days.

[0050] The present invention also provides the use of the Aspergillus terreus strain JH92 or the microbial agent in the preparation of microbial pesticides.

[0051] The present invention also provides a microbial pesticide, which is prepared from the microbial agent and includes the Aspergillus terreus strain JH92 or its metabolites.

[0052] In certain embodiments of the present invention, the microbial pesticide is a product prepared by the following method, and the microbial pesticide is referred to as the first microbial pesticide:

[0053] 1) filtering the microbial agent to remove the bacterial cells and obtain a filtrate;

[0054] 2) extracting the filtrate, retaining the organic layer and concentrating it to obtain a crude extract;

[0055] 3) Purifying the crude extract to obtain the first microbial agent.

[0056] In other embodiments of the present invention, the microbial pesticide is the supernatant obtained after centrifugation of the microbial agent.

[0057] The present invention also provides a method for preparing the microbial pesticide, the method comprising centrifuging the microbial agent and collecting the supernatant as the microbial pesticide; or the method comprising the following steps:

[0058] 1) filtering the microbial agent to remove the bacterial cells and obtain a filtrate;

[0059] 2) extracting the filtrate, retaining the extract and concentrating it to obtain a crude extract;

[0060] 3) further purifying the crude extract to obtain the microbial pesticide.

[0061] In certain embodiments of the present invention, the supernatant collected after centrifugation of the microbial agent is further filtered through a bacterial filter.

[0062] In certain embodiments of the present invention, extraction is performed twice or more in step 2).

[0063] In certain embodiments of the present invention, in step 2), the filtrate and the extractant are mixed in a ratio of 1:1 and then extracted.

[0064] The extractant can be selected according to the prior art, for example, alcohols: isoamyl alcohol, sec-octanol, substituted primary alcohols, etc., or ethers: diisopropyl ether, ethyl hexyl ether, etc., or ketones: methyl isobutyl ketone, cyclohexanone, etc., or esters: ethyl acetate, amyl acetate, butyl acetate, etc.; or carboxylic acids: cinnamic acid, fatty acids, lauric acid, cycloalkane acid, etc.; sulfonic acids: dodecylbenzenesulfonic acid, trinonylnaphthalenesulfonic acid, etc., or phosphates: di(2-ethylhexyl)hexyl phosphate, dioctyl octyl phosphate, tributyl phosphate, etc., or sulfoxides: dioctyl sulfoxide, diphenyl sulfoxide, alkyl sulfoxide, etc., or organic amines: trialkylmethylamine, didecylamine, trioctylamine, trinonylamine, etc. Preferably, the extractant is an ester, and more preferably ethyl acetate.

[0065] In certain embodiments of the present invention, the extract is concentrated using a rotary evaporator, and the obtained paste residue is the crude extract.

[0066] In certain embodiments of the present invention, the further purification in step 3) is specifically to dissolve the crude extract in an organic solvent and then purify it in an ultra-low temperature rotary evaporator. In one embodiment, the purification is carried out at 40-50°C.

[0067] The organic solvent may be selected from any one or more of methanol, DMSO, DMF, DMAC, toluene, NMP or pyridine.

[0068] In certain embodiments of the present invention, the crude extract is dissolved in an organic solvent and then placed in an ultra-low temperature rotary evaporator for purification to obtain a solid microbial pesticide. The solid can also be dissolved in an organic solvent or water to obtain a liquid microbial pesticide.

[0069] The present invention also provides the use of the Aspergillus terreus strain JH92 or the microbial agent or the microbial pesticide in inhibiting plant pathogens, or in preventing or treating plant diseases caused by plant pathogens.

[0070] The plant pathogenic bacteria are selected from any one or more of the following: S. sclerotiorum, P. microspora, R. solani, F. oxysporum, P. capsici, F. fujikuroi or B. sorokiniana.

[0071] The plant is selected from crops. The crops are selected from vegetables. The vegetables are selected from nightshades or leafy vegetables. The nightshades are selected from tomatoes such as cherry tomatoes, peppers, pumpkins, wax gourds, bitter melons, cucumbers, loofahs, melons, gourds, courgettes, chayote, zucchini, eggplants, kidney beans, cowpeas, peas, pole beans, sword beans, lentils, kidney beans, edamame, snake beans or sweet corn. The leafy vegetables are selected from lettuce, celery, cabbage, cabbage such as Chinese cabbage, green cabbage or purple cabbage.

[0072] In one embodiment, the plant disease is lettuce sclerotinia rot.

[0073] The present invention also provides a method for preventing or treating plant diseases, comprising the following steps: applying the microbial agent or microbial pesticide to plants.

[0074] In certain embodiments of the present invention, the microbial agent or microbial pesticide is applied by spraying.

[0075] In certain embodiments of the present invention, if the microbial pesticide is solid, it can be dissolved before application. The solvent can be ethyl acetate, methanol or water.

[0076] The working concentration of the microbial agent or microbial pesticide is 1×10 7 ~10 8 Spores / mL.

[0077] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0078] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0079] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0080] The culture medium components involved in the following examples include:

[0081] Potato glucose culture medium (PDB culture medium): 200 g potatoes, 20 g glucose, 1 L deionized water, sterilized at 121°C for 20 min.

[0082] Potato dextrose agar medium (PDA medium): 200 g potatoes, 20 g glucose, 12 g agar powder, 1 L deionized water, sterilized at 121°C for 20 min.

[0083] Example 1 Soil sample collection and separation of biocontrol bacteria

[0084] Soil samples were collected from the lettuce field of Shanghai Chunchang Vegetable and Fruit Professional Cooperative in Qingpu District, Shanghai in May 2023.

[0085] Weigh 1g of soil sample and add it to 10mL of 0.7mol / L NaCl solution. After shaking, make a soil suspension. Then dilute the soil suspension to 10 with 0.7mol / L NaCl solution. -2 , 10 -3 and 10 -4To screen antagonistic fungi, 100 μL of the diluted soil suspension was evenly applied to the PDA plate, and 3 plates were applied for each gradient; after the PDA plate was dried, it was placed in a 25°C constant temperature incubator for culture. Every 24 hours, the presence of newly grown single colonies was observed, and the newly grown single colonies were picked out and inoculated on the PDA plate for purification culture (the hyphae at the edge of the colony were picked out on the PDA plate and transferred three times). The purified strains obtained after three transfers were stored in a 4°C refrigerator for future use.

[0086] Use a 6mm diameter puncher to punch holes at the edge of the purified strain colony, transfer the bacterial disc to the edge of a 90mm PDA plate, and transfer an activated S. sclerotiorum bacterial disc of equal diameter to the other end of the plate. The PDA plate with the S. sclerotiorum bacterial disc inoculated on one side of the edge of the PDA plate and the other end untreated was used as the control. Subsequently, the plate was placed in a 25℃ incubator for culture. After the hyphae of the control group grew all over the plate, the width of the inhibition zone of the treatment group was observed, and the inhibition rate of different strains on S. sclerotiorum hyphae was calculated.

[0087] Mycelial growth inhibition rate (%) = [(colony diameter of Sclerotinia sclerotiorum in the control group - colony diameter of Sclerotinia sclerotiorum in the treatment group) / colony diameter of Sclerotinia sclerotiorum in the control group] × 100%.

[0088] A biocontrol bacterium (A. terreus. JH92) was screened out from the above-mentioned lettuce field soil samples, which had a significant inhibitory effect on the hyphae growth of Sclerotinia sclerotiorum.

[0089] Example 2 Identification of biocontrol bacteria

[0090] 1. Morphological observation

[0091] like Figure 1 As shown, after the Aspergillus fungus JH92 was cultured at a constant temperature (25°C) for 96 hours on the PDA plate, its colony morphology was round, the colony edge was white and irregular, the colony color was orange-pink, and a large number of spores were produced.

[0092] 2. ITS, β-tubulin, rpb2, and CMD sequence analysis

[0093] Aspergillus fungus JH92 was cultured, genomic DNA was extracted from the hyphae, and the gene sequence was amplified using fungal ITS, β-tubulin, rpb2, and CMD universal primers (Table 1). The PCR amplification reaction system was 50 μL, namely 17.5 μL of ddH2O, 25 μL of Taq Mix, 2.5 μL of ITS-F primer, 2.5 μL of ITS-R primer, and 2.5 μL of DNA template. The PCR reaction program was 98°C for 5 min; 98°C for 30 s, 56°C for 10 s, 72°C for 25 s, and 25 cycles; stored at 4°C. The PCR amplification product was sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing to obtain the sequence. Its rDNA ITS sequence is shown in SEQ ID NO.1; its β-tubulin gene sequence is shown in SEQ ID NO.2; its rpb2 gene sequence is shown in SEQ ID NO.3; its CMD gene sequence is shown in SEQ ID NO.4. By searching and comparing homologous genes in GenBank using Blast, the strain was preliminarily identified as Aspergillus.

[0094] Figure 2 The phylogenetic tree analysis results of the Aspergillus fungus show that JH92 is clustered with 22 Aspergillus terreus to form a clear branch with a 100% support value. Combining morphological characteristics and phylogenetic analysis, the Aspergillus fungus JH92 was named Aspergillus terreus, with the strain number JH92. It was deposited in the China Center for Type Culture Collection on August 9, 2023, with the deposit number CCTCC NO: M 20231397.

[0095] Table 1 Primer sequences

[0096]

[0097] Example 3 Plate confrontation experiment between Aspergillus fungus JH92 and Sclerotinia sclerotiorum

[0098] Use a 6mm diameter puncher to punch a cake on the edge of the activated Aspergillus JH92 colony, transfer the cake to the edge of a 90mm diameter plate containing PDA, and connect the activated Sclerotinia cake to the other end of the plate. The plate without the Aspergillus JH92 cake was used as the control, and each treatment was repeated three times. The plate was placed in a 25℃ incubator for culture. After the hyphae of the control group grew all over the plate (about 3 days), the antibacterial effect of the treatment group was observed, and the inhibition rate of Aspergillus JH92 on the growth of Sclerotinia hyphae was calculated. Mycelial growth inhibition rate (%) = [(control group Sclerotinia colony diameter - treatment group Sclerotinia colony diameter) / control group Sclerotinia colony diameter] × 100%.

[0099] like Figure 3As shown in A and B in the figure, in the plate confrontation experiment between Aspergillus fungus JH92 and S. sclerotiorum, the inhibition rate of mycelium of S. sclerotiorum was 51.42%.

[0100] Example 4 Preparation of microbial pesticides

[0101] PDB juice was selected as the fermentation culture medium of Aspergillus JH92. A hole was punched at the edge of the activated Aspergillus JH92 colony with a 6-mm diameter puncher. Four bacterial cakes were inoculated into a triangular flask containing 800 mL of PDB culture medium, which was placed in a shaker at 25°C and 180 rpm for 7 days to obtain the fermentation liquid of Aspergillus JH92.

[0102] After filtering and removing the bacterial cells, a filtrate (containing the secondary metabolites of Aspergillus fungus JH92) was obtained. The filtrate was extracted twice with ethyl acetate (V:V=1:1), the ester layer was retained, and then the extract was concentrated by a rotary evaporator to obtain a paste residue, i.e., a crude extract. The crude extract was dissolved in methanol, and the crude extract adhering to the bottle wall could be dissolved by ultrasonic vibration, and then placed in an ultra-low temperature rotary evaporator at 45°C to evaporate to dryness, and a certain amount of solid was weighed and dissolved in methanol to obtain the first microbial pesticide.

[0103] The fermentation liquid of the Aspergillus fungus JH92 is centrifuged, and the supernatant obtained by centrifugation is filtered through a bacterial filter to obtain the second microbial pesticide.

[0104] The fermentation liquid of the Aspergillus fungus JH92 is used as the third microbial pesticide (or microbial agent).

[0105] Example 5 Effect of microbial pesticides on the growth of Sclerotinia sclerotiorum hyphae

[0106] The first microbial pesticide solution prepared in Example 4 was added to 50 mL PDA medium to make the final concentration of microbial pesticide in PDA medium 1 mg / mL, and poured into three 90 mm culture dishes on average. After condensation, air-dry for 25 min. Use a 6 mm diameter puncher to punch holes at the edge of the activated Sclerotinia sclerotiorum colony, pick the bacterial disc and inoculate it in the center of the PDA flat plate. Add an equal volume of methanol to the PDA flat plate as a control. The flat plate was placed in a 25 ° C incubator for cultivation. After the mycelium of the control group grew all over the flat plate (about 3 days), the colony diameter of each flat plate was observed and recorded, and the growth inhibition rate of the microbial pesticide solution to the mycelium of Sclerotinia sclerotiorum was calculated.

[0107] The results are as follows Figure 4 As shown in A and B in the figure, the experimental results show that the microbial pesticide solution has a significant inhibitory effect on the growth of Sclerotinia sclerotiorum hyphae, and the hyphae inhibition rate is 100%.

[0108] Example 6 Effect of microbial pesticides on sclerotinia germination

[0109] Collection of Sclerotinia sclerotia: Inoculate Sclerotinia sclerotia in the center of the PDA plate, culture at 25°C for 10 days, collect mature sclerotia, treat with 75% alcohol for 5 minutes, and then rinse with sterile water. Subsequently, disinfect with 1% sodium hypochlorite solution for 5 minutes, and then wash three times with sterile water, each time for 1 minute. According to the method of Example 5, a PDA plate containing 1 mg / mL microbial pesticide was prepared, and the treated sclerotia were placed on an air-dried plate. Each plate was inoculated with 4 sclerotia, and the experiment was repeated three times. The plate was placed in a 25°C incubator for 7 days. After the sclerotia on the plate without microbial pesticide germinated and grew full of hyphae, the germination was observed and recorded, and the germination rate of sclerotia was calculated. Sclerotia germination rate (%) = [(average number of germination of sclerotia in the control group - average number of germination of sclerotia in the treatment group) / average number of germination of sclerotia in the control group] × 100%.

[0110] like Figure 5 As shown in the figure, in the control group without adding microbial pesticide, the germination rate of sclerotia was 100%, in the treatment group with adding microbial pesticide at a concentration of 1 mg / mL, the germination rate of sclerotia was 12.5%, and the germination inhibition rate of sclerotia was 87.5%. The experimental results show that the metabolites of Aspergillus fungus JH92 can effectively inhibit the germination of sclerotia of Sclerotinia sclerotiorum.

[0111] Example 7 Effect of microbial pesticides on sclerotinia formation

[0112] 0, 2.5, 5, and 7.5 mL of the second microbial pesticide solution prepared in Example 4 were added to 50 mL of PDA medium, respectively, and after sufficient mixing, three plates were made for each concentration, and the control group was not added with the fermentation supernatant (microbial pesticide solution), and air-dried after condensation. A hole was punched at the edge of the activated Sclerotinia sclerotiorum colony with a 6 mm diameter puncher, and the bacterial sheet was picked in the center of the plate, placed in a 25 ° C incubator for 10 days, and the number of sclerotia of Sclerotinia sclerotiorum was observed and counted.

[0113] The experimental results are as follows Figure 6 As shown in Figures AD, the number of sclerotia produced by Sclerotinia sclerotiorum treated with fermentation supernatant was significantly less than that of the untreated control group, and with the increase of fermentation supernatant concentration, the number of sclerotia gradually decreased. The metabolites of Aspergillus fungus JH92 can significantly inhibit the formation of Sclerotinia sclerotiorum.

[0114] Example 8 Lettuce Leaf Control Experiment

[0115] Take fresh lettuce leaves with the same growth potential, rinse them with sterile water, inoculate a 6 mm diameter Sclerotinia sclerotiorum piece on each leaf, and cover the petiole with a moist cotton ball. Spray 5 mL of water on the surface of each leaf of the control group, and spray 5 mL of the third microbial pesticide solution prepared in Example 4 (fermentation broth of Aspergillus fungus JH92, spore concentration: 1×10 7 ~10 8 Spores / mL), 10 replicates per group, and the experiment was repeated three times. The lettuce leaves were cultured in an incubator at 25°C for 2 days, and the disease incidence, disease index, and control effect were calculated.

[0116] The lesion grading standards are as follows: Level 0: no symptoms; Level I: leaf lesion diameter ≤ 2cm; Level II: 2cm<leaf lesion diameter ≤ 3cm; Level III: 3cm<leaf lesion diameter ≤ 4cm; Level IV: 4cm<leaf lesion diameter, or all leaves are rotten.

[0117] Disease index = ∑ (number of diseased leaves at each level × relative level) / (total number of leaves × highest level) × 100;

[0118] Preventive effect (%) = [(average disease index of sterile water control - average disease index of treatment) / average disease index of sterile water control] × 100%.

[0119] like Figure 7 As shown in A and B in the figure and in Table 2, the fermentation liquid of Aspergillus fungus JH92 can effectively prevent the occurrence of sclerotinia in the control experiment of detached lettuce leaves, wherein the disease index of the control group is 85.00, and the disease index of the treatment group is 11.67, and the control efficiency of the fermentation liquid reaches 86.27±0.02%. The experimental results show that the fermentation liquid of Aspergillus fungus JH92 can effectively inhibit the infection of sclerotinia on lettuce leaves.

[0120] Table 2 Control effect of Aspergillus terreus JH92 fermentation liquid on detached lettuce leaves on sclerotinia

[0121]

[0122] Example 9 Experiment on the antagonistic effect of Aspergillus fungus JH92 on six plant pathogens

[0123] Referring to the experimental method of Example 3, the Aspergillus fungus JH92 was subjected to a confrontation experiment with P. microspora, R. solani, F. oxysporum, P. capsici, F. fujikuroi and B. sorokiniana, and cultured in an incubator at 25°C. The antibacterial effect was observed after 7 days. The test results are shown in FIG. Figure 8 As shown, compared with the control group in which the plant pathogens were cultured alone, the mycelial growth of the six plant pathogens in the confrontation test group was inhibited, and there was an obvious inhibition zone.

[0124] Referring to the experimental method of Example 5, the effects of microbial pesticides on the mycelial growth of six plant pathogens were tested.

[0125] A certain amount of the first microbial pesticide solution prepared in Example 4 was added to 50 mL of PDA medium to make the concentration of the microbial pesticide in the PDA medium 1 mg / mL, and evenly poured into a culture dish with a diameter of 90 mm. After the plate was cooled and air-dried, a plant pathogenic bacteria sheet with a diameter of 6 mm was inoculated in the center. The experiment was repeated three times, with the plate without microbial pesticide solution as the control. Placed in a 25°C incubator for cultivation, when the mycelium of the control group covered the plate, the colony diameter of each strain was observed and recorded, and the microbial pesticide inhibition rate on the mycelium growth of different plant pathogens was calculated.

[0126] The test results are as follows Fig. 9 As shown, compared with the control group, the six plant pathogens in the treatment group with the addition of microbial pesticides grew slowly. The first microbial pesticide prepared in Example 4 had a significant inhibitory effect on the mycelial growth of P. microspora, R. solani, F. oxysporum, P. capsici, F. fujikuroi and B. sorokiniana, and the mycelial inhibition rates were 76.62±4.0%, 76.19%, 80.77%, 92.80%, 79.10±0.6% and 63.36%, respectively.

[0127] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. An Aspergillus sp. strain JH92, with a deposit number of CCTCC NO: M 20231397.

2. A microbial agent, characterized in that: The microbial agent is the fermentation broth of the Aspergillus sp. JH92 according to claim 1.

3. The microbial agent according to claim 2, characterized in that: The content of the Aspergillus terreus strain JH92 in the microbial agent is 1×10 7 ~10 8 Spores / mL.

4. The method for preparing the microbial agent according to claim 2 or 3, characterized in that: The preparation method comprises the following steps: inoculating the bacterial cake of the Aspergillus sp. JH92 according to claim 1 into a culture solution for cultivation, and the obtained fermentation solution is the microbial agent.

5. The preparation method according to claim 4, characterized in that: The culture conditions include any one or more of the following: 24-26° C., 160-190 rpm, and a culture time of 5-14 days.

6. Use of the Aspergillus sp. JH92 according to claim 1 or the microbial agent according to claim 2 or 3 in the preparation of microbial pesticides.

7. A microbial pesticide, characterized in that: The microbial pesticide is prepared from the microbial agent according to claim 2 or 3.

8. The microbial pesticide according to claim 7, characterized in that: The microbial pesticide is the supernatant obtained after centrifugation of the microbial agent according to claim 2 or 3, or the microbial pesticide is a product prepared by the following method: 1) filtering the microbial agent according to claim 2 or 3 to remove the bacterial cells and obtain a filtrate; 2) extracting the filtrate, retaining the organic layer and concentrating it to obtain a crude extract; 3) Purifying the crude extract to obtain the first microbial agent.

9. The method for preparing the microbial pesticide according to any one of claims 7 to 8, characterized in that: The preparation method comprises centrifuging the microbial agent according to claim 2 or 3, and collecting the supernatant as the microbial pesticide; or, the preparation method comprises the following steps: 1) filtering the microbial agent to remove the bacterial cells and obtain a filtrate; 2) extracting the filtrate, retaining the extract and concentrating it to obtain a crude extract; 3) Purifying the crude extract to obtain the microbial pesticide.

10. The preparation method according to claim 9, characterized in that: Also includes any one or more of the following features: A. The supernatant collected after centrifugation of the microbial agent is also filtered through a bacterial filter; B. extracting twice or more in step 2); C. During the extraction in step 2), the filtrate and the extractant are mixed in a ratio of 1:1 and then extracted; D. The purification in step 3) is specifically to dissolve the crude extract in an organic solvent and then purify it in an ultra-low temperature rotary evaporator; E. Step 3) also includes dissolving the purified microbial pesticide in an organic solvent or water.

11. Use of the Aspergillus sp. JH92 according to claim 1, the microbial agent according to claim 2 or 3, or the microbial pesticide according to any one of claims 7 to 8 in inhibiting plant pathogens, or in preventing or treating plant diseases caused by plant pathogens, wherein the plant pathogens are selected from any one or more of the following: S. sclerotiorum, P. microspora, Rhizoctonia solani, F. oxysporum, P. capsici, F. fujikuroi, or B. sorokiniana.

12. The use according to claim 11, characterized in that: Also includes any one or more of the following features: 1) The plant is selected from crops; 2) The plant disease is lettuce sclerotinia rot.

13. The use according to claim 11, characterized in that: The plants are vegetables.

14. The use according to claim 11, characterized in that: The plant is selected from nightshades or leafy vegetables.

15. The use according to claim 11, characterized in that: The plant is selected from lettuce, celery, cabbage, Chinese cabbage or red cabbage.

16. A method for preventing or treating plant diseases, characterized in that: The method comprises the following steps: applying the microbial agent according to claim 2 or 3 or the microbial pesticide according to any one of claims 7 to 8 to plants.

17. The method according to claim 16, characterized in that Also includes any one or more of the following features: 1) The microbial agent or microbial pesticide is applied by spraying; 2) The working concentration of the microbial agent or microbial pesticide is 1×10 7 ~10 8 Spores / mL.

Images