A kind of Trichoderma subadenoviride and its application

Abstract

The present invention discloses a Trichoderma paraviridescens and its application. The strain number of the Trichoderma paraviridescens is JSAFC 3625, which was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on May 20, 2024, and the deposit number is CGMCC NO.41311. The Trichoderma paraviridescens JSAFC 3625 separated by the present invention can effectively inhibit the growth of Colletotrichum gloeosporioides, and the inhibition rate of plate confrontation culture is 68.17%. At the same time, the extracellular metabolites secreted by JSAFC 3625 also have an inhibitory effect on C.gloeosporioides. The Trichoderma paraviridescens JSAFC 3625 provided by the present invention can effectively inhibit the growth of C.gloeosporioides and has a growth-promoting effect on blueberry plants.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to Trichoderma subtilis and application thereof. Background Art

[0002] Blueberry (Vaccinium spp.) is a deciduous shrub belonging to the Ericaceae family and the genus Vaccinium, native to eastern Canada and the southern United States. Blueberries are sweet and sour and contain rich nutrients. They can prevent brain nerve aging, protect eyesight, strengthen the heart, fight cancer, soften blood vessels, and enhance human immunity. It ranks first among the 15 global health foods listed by British authoritative nutritionists, and was listed as one of the five major health foods for humans by the Food and Agriculture Organization of the United Nations in 2017. It is known as the "king of berries" and is a plant with high economic value. With the continuous expansion of the cultivated area, blueberry leaf and branch anthracnose is becoming more and more serious. Blueberry anthracnose occurs widely in various regions of the world. One of the main pathogens reported in research is infection with Colletotrichum gloeosporioides.

[0003] The typical symptoms of blueberry anthracnose caused by C.gloeosporioides are: the initial round or irregular or water-soaked lesions, which expand into spindle-shaped, long strips or irregular shapes in the later stage, with a red halo at the junction of the diseased and healthy branches; the diseased branches wilt and die, and the diseased leaves are wrinkled and deformed. The pathogen overwinters on diseased tissues such as soil, damaged branches, fruits, and residual leaves. In the spring and summer of the same year, the pathogen spores are spread by wind, rain, watering, etc., infecting young leaves, branches and young fruits. After the young fruits are infected, they do not show symptoms during the expansion period, and only show symptoms during the fruit ripening period or after harvesting. The suitable temperature for the growth of the pathogen is 26-28℃, which has the characteristics of latent infection. The flowering period to the young fruit period is the peak period for the spread of pathogen spores. High temperature and high humidity are conducive to the spread of this disease.

[0004] At present, agricultural control cannot completely eliminate the pathogens and is prone to recurrence; chemical control is prone to produce pesticide residues and may also cause disease resistance; biological control can effectively kill pathogens without damaging the environment, and is the future direction and trend of disease control. The control methods for blueberry anthracnose caused by C. gloeosporioides mostly use agricultural control and chemical control, and biological control methods are relatively rare. As an effective means of green control, microorganisms are increasingly important in my country's agriculture.

[0005] Therefore, finding an environmentally friendly and effective blueberry anthracnose control measure is an urgent problem to be solved today. The antibacterial substances produced by biocontrol bacteria usually act directly on the corresponding pathogens and have strong specificity, so they will not have adverse effects on other beneficial microorganisms in the agricultural ecosystem, which is conducive to maintaining ecological balance.

[0006] In summary, the prior art still lacks a green and highly effective probiotic for preventing blueberry anthracnose. Summary of the invention

[0007] Purpose of the invention: The purpose of the present invention is to provide a Trichoderma paraviridescens, and its application in inhibiting the growth of Colletotrichum gloeosporioides and promoting the growth of blueberry.

[0008] Technical solution: The present invention provides a Trichoderma paraviridescens, the strain number of the Trichoderma paraviridescens is JSAFC 3625, which was deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration on May 20, 2024, with a deposit number of CGMCC NO.41311.

[0009] Furthermore, the nucleotide sequence of the ITS gene of Trichoderma paraviridescens is shown as SEQ ID NO.1, the nucleotide sequence of the rpb2 gene is shown as SEQ ID NO.2, and the nucleotide sequence of the TEF-1α gene is shown as SEQ ID NO.3.

[0010] The present invention also provides a biocontrol fungus agent, wherein the active ingredient of the biocontrol fungus agent is the above-mentioned Trichoderma paraviridescens.

[0011] The present invention also provides the use of the Trichoderma paraviridescens or its extracellular metabolites and biocontrol bacteria in inhibiting the growth of Colletotrichum gloeosporioides.

[0012] The present invention also provides the use of the Trichoderma paraviridescens and the biocontrol fungus agent in promoting the growth of blueberries.

[0013] Furthermore, the method comprises planting blueberries in peat soil containing mycelium of Trichoderma paraviridescens JSAFC 3625, thereby promoting plant height and root growth of blueberries.

[0014] The present invention also provides the use of the Trichoderma paraviridescens and the biocontrol fungus agent in preventing and controlling blueberry anthracnose.

[0015] Furthermore, the blueberry anthracnose is caused by Colletotrichum gloeosporioides.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: the Trichoderma paraviridescens JSAFC 3625 isolated by the present invention can effectively inhibit the growth of Colletotrichum gloeosporioides, and the inhibition rate of plate confrontation culture is 68.17%. At the same time, the extracellular metabolites secreted by JSAFC3625 also have an inhibitory effect on C. gloeosporioides. The Trichoderma paraviridescens JSAFC 3625 provided by the present invention can effectively inhibit the growth of C. gloeosporioides and has a growth-promoting effect on blueberry plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 :Phylogenetic tree of Trichoderma paraviridescens JSAFC 3625 (based on rpb2 and TEF-1α sequences).

[0018] Figure 2 : The biocontrol bacteria Trichoderma paraviridescens JSAFC 3625 of the present invention and Colletotrichum gloeosporioides were cultured in opposition.

[0019] Figure 3 : The effects of the extracellular metabolites secreted by the biocontrol bacteria Trichoderma paraviridescens JSAFC 3625 of the present invention on Colletotrichum gloeosporioides.

[0020] Figure 4 : The effect of the biocontrol bacteria Trichoderma paraviridescens JSAFC 3625 of the present invention on the growth of blueberry. DETAILED DESCRIPTION

[0021] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0022] The following detailed descriptions are all illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0023] As used herein, the term "biocontrol bacteria" refers to beneficial microorganisms that can control plant diseases.

[0024] As described in the present invention, the term "blueberry anthracnose fungus (Colletotrichum gloeosporioides)" is classified as: Ascomycota, Sordariomycetes, Glomerellaceae, Colletotrichum. It is widely distributed in the world and causes serious damage to blueberries.

[0025] Example 1: Isolation and identification of Trichoderma paraviridescens JSAFC 3625

[0026] 1. Isolation of Trichoderma paraviridescens JSAFC 3625

[0027] Healthy blueberry plants with good growth were selected from Jurong, Jiangsu Province, and the root tissue was taken to isolate JSAFC3625. The colony characteristics were as follows: when cultured on PDA plate culture medium, the colonies grew rapidly, initially white and fluffy, slowly turned into yellow-green, and attached to the surface of the culture medium.

[0028] 2. Molecular biological identification of Trichoderma paraviridescens JSAFC 3625

[0029] (1) The genomic DNA of strain JSAFC 3625 was extracted using a kit from TIANGEN.

[0030] (2) Amplify the ITS, rpb2 and TEF-1α genes of genomic DNA respectively. DNA amplification used a 30 μL reaction volume, including 15 μL 2×EasyTaq PCR SuperMix (+dye), 1 μL each of the primer pairs ITS1 (SEQ ID NO.4: 5′-CTTGGTCATTTAGAGGAAGTAA-3′) & ITS4 (SEQ ID NO.5: 5′-TCCTCCGCTTATTGATATGC-3′), rpb2-5F (SEQ ID NO.6: 5′-GAYGAYMGWGATCAYTTYGG-3′) & rpb2-7cR (SEQ ID NO.7: 5′-CCCATRGCTTGYTTRCCCAT-3′), EF1-728F (SEQ ID NO.8: 5′-CATCGAGAAGTTCGAGAAGG-3′) & EF1-LLErev (SEQ ID NO.9: 5′-AACTTGCAGGCAATGTGG-3′), 2 μL template DNA and 11 μL ddHO. 2 O, PCR amplification program conditions are as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 54°C annealing for 45 s (59°C annealing for 45 s for rpb2 gene), 72°C extension for 1 min, a total of 35 cycles; and finally 72°C extension for 10 min.

[0031] (3) The amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light. The PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: the ITS gene sequence of strain JSAFC 3625 was SEQ ID NO.1 (CTGCTGAAGCGGAGGGACATTACCGAGTTTACAACTCCCAAACCCAATGTGAAC), and the rpb2 gene sequence was SEQ ID NO.2 (ACTCGCCACTGGAAACTGGGGTGACCAGAAGAAGGCAATGAGCTCGACCGCAGGTGTCTCACAGGTGCTTAACCGTTACACTTTTGCTTCTACACTTTCCCATTTGCGTCGTACCAATACTCCCATCGGAAGAGATGGTAAGCTGGCGAAGCCTCGTCAGCTCCACAACACACATTGGGGTTTGGTGTGCCCGGCCGAGACCCCTGAAGGACAGGCTTGTGGTCTGGTCAAGAATTTGTCTCTGATGTGCTACGTCAGTGTTGGATCTCCTTCTGAGCCTTTGATCGAGTTTATGATCAACAGAGGCATGGAAGTTGTTGAGGAGTATGAGCCACTGAGGTATCCCCATGCCACAAAGATCTTTGTGAATGGTGTCTGGGTTGGAATCCATCAAGACCCCAAGCATCTGGTGAACCAAGTTTTGGATACTCGTCGCAAATCCTATCTGCAGTACGAGGTCTCTCTGATCAGAGAAATTCGAGACCAAGAATTCAAAATCTTCTCTGATGCCGGTCGTGTTATGCGTCCCGTCTTCACCGTACAGCAGGAAGATGACCCGGAAACGGGTATCAACAAGGGCCACCTGGTTTTGACCAAGGAACTCGTCAATAGACTGGCTAAAGAGCAGGCTGAGCCTCCAGAAGACCCAAGCATGAAGCTCGGATGGGAGGGGCTGATTAGGGCTGGTGCGGTGGAATATCTCGACGCCGAGGAAGAAGAAACGTCCATGATTTGCATGACACCGGAAGATCTTGAGCTTTATCGTCTTCAAAAGGCCGGCATTTCCACGGAAGAAGATATAGGAGATGATCCAAATAAGCGTCTCAAGACCAAGACAAATCCGACAACTCACATGTATACGCATTGCGAGATTCACCCGAGTATGATCTTAGGTATCTGTGCCAGTATCATTCCTTTCCCCGATCACAACCAGGTACGTCAACCCGAGAAGCTATTCTCTGTTCTCTCTTCATCTTGATGTATGTTACGTTCAAAACGCTAACTGAT), the TEF-1α gene sequence is SEQIDNO.3(TACGCTTTCTTGACACAATCGTGTCCGACAATTCTGTTCCTCAGTCTTGACAATT TTTTCTCGCGTCGTCACACCCCGCTCTACCTGTCTACCCCTCCTTTGGCACAGCAGAAATTTTCTGGCTGCCTTGTTTGGCTTTTAGTGGGGTGCCATTTTTTTTTGGCAACAACCCCGCTATCGCCGTTGTCCCTCATCCATTGTACCAACAATTTGATCTCACTCAATCACATCGTCTTCTGCCTCATTTTGTCCGTGGTTCATTGTGCTGATCAT GATTCAATCAATAGGAAGCCGCCGAACTCGGCAAGGGTCTTTCAAGTATGCGTGGGTTCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCAAGTACTATGTCACCGTCATTGGTATGTTTTGGTTTCCTCATTGACACCCCCGGAATCATTATTCTAACGTGCCGCTCCACAGACG).

[0032] (4) SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 were compared on the NCBI database website. The comparison results are shown in Table 1. The two sequences of SEQ ID NO.2 and SEQ ID NO.3 were combined to establish a phylogenetic tree. Figure 1 .according to Figure 1 From the results in Table 1, it can be inferred that the biocontrol bacteria JSAFC 3625 of the present invention is Trichoderma paraviridescens, named Trichoderma paraviridescens JSAFC 3625, and the strain was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on May 20, 2024, with a deposit number of CGMCC NO.41311, and a classification name of Trichoderma paraviridescens JSAFC 3625. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen 1st Yard, Chaoyang District, Beijing.

[0033] Table 1 Sequence alignment results of SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3

[0034]

[0035] Example 2: Inhibitory effect of Trichoderma paraviridescens JSAFC 3625 on Colletotrichum gloeosporioides

[0036] (1) On a clean bench, a 4 mm diameter bacterial cake of C. gloeosporioides JSAFC 2269 was inoculated on one side of a PDA culture medium plate as a control group, and a 4 mm diameter bacterial cake of Trichoderma paraviridescens JSAFC 3625 was inoculated on the symmetrical side of the PDA culture medium as an experimental group; and a culture medium plate inoculated only with C. gloeosporioides was used as a control group.

[0037] (2) The experimental group and control group cultures of step (1) were inverted and cultured in a constant temperature incubator at 25° C. under the conditions of 8 h of light and then 16 h of dark culture.

[0038] (3) After the experimental group and control group culture media of step (2) were artificially cultured under the above culture conditions for 7 days, the colony radius of C. gloeosporioides was measured by the plate confrontation method, and the inhibitory effect of Trichoderma paraviridescens JSAFC3625 on C. gloeosporioides was observed.

[0039] The results are as follows Figure 2 As shown, the colony radius of C. gloeosporioides in the blank control group was 5.31 cm; in the experimental group, the average radius of the C. gloeosporioides pathogen was only 1.69 cm as determined by the plate confrontation method, and the inhibition rate was 68.17%, indicating that Trichoderma paraviridescens JSAFC 3625 had a significant inhibitory effect on C. gloeosporioides.

[0040] Example 3: Effects of Trichoderma paraviridescens JSAFC 3625 extracellular metabolites on C. gloeosporioides

[0041] (1) Use a cork puncher to take 5 mm diameter mycelium blocks of C. gloeosporioides JSAFC 2269 and Trichoderma paraviridescens JSAFC 3625 and inoculate them into 9 cm diameter culture dishes containing 15 mL of PDA medium. Place them in a 25°C incubator and incubate them in the dark for 5 days. When the C. gloeosporioides strains have grown all over the culture dish, use a cork puncher (5 mm diameter) to punch holes at the edge of the colony to prepare bacterial plates.

[0042] (2) Cut a 3 mm × 3 mm mycelium block from the edge of a 5-day-old JSAFC 3625 colony and aseptically transfer 30 mycelium blocks into 200 ml PDB liquid culture medium. Culture the culture medium at 25°C, dark, and 160 rpm for 7 days. First, filter out the mycelium blocks in the culture medium with two layers of sterile gauze. Centrifuge at 10,000 rpm for 30 min at room temperature and collect the supernatant. Filter the supernatant once with a 0.45 μm bacterial filter and then filter it again with a 0.22 μm bacterial filter to completely remove the JSAFC 3625 bacteria. Obtain a sterile filtrate.

[0043] (3) Take 10 mL and 100 mL of the above sterile filtrate respectively, pour each into 100 mL of PDA medium (cooled to about 50°C), and mix quickly to prepare plates containing JSAFC 3625 sterile filtrate at concentrations of 10 mL / 100 mL and 100 mL / 100 mL. For control, replace the sterile filtrate with sterile water to prepare sterile level plates of corresponding concentrations.

[0044] (4) In an ultra-clean workbench, use an inoculation needle to pick up a C. gloeosporioides bacterial disk and inoculate it into the above-prepared plate, with the mycelium side facing downward. Set up 3 replicates for each concentration (sterile filtrate and sterile water).

[0045] (5) Place the inoculated culture dish in a 25°C incubator, incubate in the dark for 3-5 days, and measure the colony diameter. The inhibition rate is calculated according to the formula: inhibition rate = (colony diameter of the control group - colony diameter of the treatment group) / colony diameter of the control group × 100%.

[0046] The results are as follows Figure 3 As shown in Table 2

[0047] Table 2 Inhibition rate of extracellular metabolites secreted by strain JSAFC 3625 on C. gloeosporioides

[0048]

[0049] The numerical expression of colony diameter in the table is: mean ± standard error.

[0050] from Figure 3 As shown in Table 2, the extracellular metabolites secreted by strain JSAFC 3625 have an inhibitory effect on C. gloeosporioides, and the inhibitory effect tends to increase with the increase of the concentration of extracellular metabolites. When the concentration of JSAFC 3625 extracellular metabolites is 10mL / 100mL, the inhibition rate of C. gloeosporioides reaches 49.25%, and when the concentration of JSAFC3625 extracellular metabolites is 100mL / 100mL, the inhibition rate of C. gloeosporioides reaches 62.75%.

[0051] Example 4: Effect of JSAFC 3625 on the Growth of Blueberries

[0052] (1) A 5 mm diameter mycelium block of Trichoderma paraviridescens JSAFC 3625 was taken out using a borer and inoculated into a 9 cm diameter culture dish (containing 15 ml of PDA medium) and cultured at 25°C in the dark for 7 days.

[0053] (2) Select a pot with a diameter of 15 cm, and cut the culture medium of Trichoderma paraviridescens JSAFC3625 that has been cultured for 7 days into 0.5 cm × 0.5 cm flat blocks. The experiment was set up in two groups. The control group was: 4 0.5 cm × 0.5 cm PDA flat blocks were added to each pot; the experimental group was: 4 0.5 cm × 0.5 cm Trichoderma paraviridescens JSAFC 3625 flat blocks were added to each pot. Use sterilized peat soil to mix various flat blocks evenly, add to the pot to 1 / 3, transplant a healthy blueberry seedling with consistent growth into each pot, and then cover it with a layer of peat soil. Each treatment was set up with 3 replicates.

[0054] (3) Water each group of blueberries with sterile water and count the plant heights of the blueberries after 30 days.

[0055] The results are shown in Table 3.

[0056] Table 3 Statistical results of blueberry plant height

[0057]

[0058] The numerical expression of plant height in the table is mean ± standard error.

[0059] As shown in Table 3, there is a significant difference in plant height between the experimental group and the control group. Figure 4It can be seen that Trichodermaparaviridescens JSAFC 3625 can promote the growth of blueberry roots ( Figure 4 The above results show that Trichodermaparaviridescens JSAFC 3625 has a growth-promoting effect on blueberry plants.

[0060] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A Trichoderma subagrovirogenum ( Trichoderma paraviridescens ), characterized in that, The Trichoderma subadenoviride ( Trichoderma paraviridescens ) is strain numbered JSAFC 3625, and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on May 20, 2024, with the deposit number CGMCC NO. 41311.

2. A biocontrol agent, characterized in that: The active ingredient of the biocontrol fungus agent is the Trichoderma viridis described in claim 1 ( Trichoderma paraviridescens ).

3. The Trichoderma subadenoviride of claim 1 ( Trichoderma paraviridescens ) or its extracellular metabolites, the biocontrol agent according to claim 2 in inhibiting Colletotrichum gloeosporioides ( Colletotrichum gloeosporioides ) is used in the growth of Trichoderma subgradienta, and the extracellular metabolites of Trichoderma subgradienta are obtained by the following method: after culturing the mycelial blocks of Trichoderma subgradienta in PDB liquid culture medium, the mycelial blocks in the culture medium are first filtered out with gauze, and then centrifuged at 10000 rpm for 30 min at room temperature, the supernatant is taken, and the supernatant is filtered once with a 0.45 µm bacterial filter and then filtered once with a 0.22 µm bacterial filter to obtain the extracellular metabolites of Trichoderma subgradienta.

4. The Trichoderma subadenoviride of claim 1 ( Trichoderma paraviridescens ), Use of the biocontrol fungus agent according to claim 2 in promoting the growth of blueberries.

5. The use according to claim 4, characterized in that: The application is to plant blueberries in a soil containing Trichoderma subtilis ( Trichoderma paraviridescens ) The mycelium of JSAFC 3625 was introduced into the peat soil, thereby promoting the plant height and root growth of blueberry.

6. The Trichoderma subadenoviride of claim 1 ( Trichoderma paraviridescens ), Use of the biocontrol fungus agent according to claim 2 in preventing and controlling blueberry anthracnose.

7. The use according to claim 6, characterized in that: The blueberry anthracnose is caused by Colletotrichum gloeosporioides ( Colletotrichum gloeosporioides )cause.

Images