A strain of Ganoderma lucidum TCZ-0007, its mycelium culture and its application

Abstract

The invention discloses a strain of ganoderma lucidum TCZ-0007, a mycelium culture thereof and an application thereof, and belongs to the field of microorganisms. The ganoderma lucidum is deposited in the China Center for Type Culture Collection, with a deposit address of Wuhan University, Wuhan, China, with a deposit number of CCTCC NO:M 20231910, and a deposit date of October 16, 2023. The ganoderma lucidum is rich in ganoderma lucidum polysaccharides and ganoderma lucidum triterpenes, particularly rich in ganoderic acid B and ganoderic acid D. The culture of the ganoderma lucidum can reduce the level of malondialdehyde in the blood, increase the level of glutathione peroxidase and superoxide dismutase in the blood, reduce the level of protein carbonyl in tissues, and increase the level of red blood cells, white blood cells and granulocyte colony stimulating factor in the blood, and can be used for the prevention or adjuvant treatment of oxidative damage and / or anemia and / or immunosuppression and / or leukopenia and / or bone marrow suppression and other related diseases.

Description

Technical Field

[0001] The invention belongs to the field of microorganisms, and specifically relates to a ganoderma lucidum TCZ-0007, a mycelium culture thereof and an application thereof. Background Art

[0002] Any discussion of the prior art throughout the specification should not be considered as an admission that such prior art is widely known or forms part of the common general knowledge in the field.

[0003] Lingzhi Ganoderma lingzhi ) is a medicinal and edible fungus belonging to the kingdom Fungi, phylum Basidiomycetes, class Basidiomycetes, order Polyporaceae, family Ganoderma, genus Ganoderma. In recent years, more and more systematic studies have gradually clarified that Ganoderma contains a variety of functional substances such as Ganoderma polysaccharides and Ganoderma triterpenes. Among them, Ganoderma triterpenes include different types of active ingredients such as ganoderic acid, ganoderic alcohol, and ganoderic acid. Ganoderic acid, as the most important active substance in Ganoderma triterpenes, includes various compounds such as ganoderic acid A, B, C, D, E, F, G, I, L, ma, md, mg, etc., which have many functions including anti-oxidation, increasing white blood cell levels, anti-tumor, immunomodulation, and replenishing qi and blood.

[0004] Announcement No. 9 of 2023 of the National Health Commission officially included Ganoderma lucidum in the catalog of medicinal and edible substances, further expanding the scope of application and application value of Ganoderma lucidum. However, due to the heavy bitterness of Ganoderma lucidum, its application and addition in products with high taste requirements are limited. The main bitter ingredients are a variety of ganoderic acid active ingredients, among which some ganoderic acid active compounds (such as ganoderic acid B and ganoderic acid D) basically have no bitter characteristics. Therefore, screening and obtaining Ganoderma lucidum strains that specifically enrich for ganoderic acid active compounds that do not have bitterness and preparing effective raw materials are of great significance for expanding the scope of application and application value of Ganoderma lucidum. Summary of the invention

[0005] The present invention provides a Ganoderma lucidum ( Ganoderma lingzhi ) TCZ-0007, its mycelium culture and its application.

[0006] The technical solution provided by the present invention is as follows:

[0007] In a first aspect of the present invention, a Ganoderma lucidum ( Ganoderma lingzhi )TCZ-0007, the Ganoderma lucidum ( Ganoderma lingzhi )TCZ-0007 is deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, the deposit number is CCTCC NO: M 20231910, and the deposit date is October 16, 2023.

[0008] In a second aspect of the present invention, a Ganoderma lucidum rich in ganoderic acid B and ganoderic acid D is provided, wherein the Ganoderma lucidum ( Ganoderma lingzhi ) fruiting bodies of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma lingzhi ) mycelium of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma lingzhi )TCZ-0007 spore powder is inoculated into culture medium for cultivation.

[0009] In a third aspect of the present invention, a mycelium culture of Ganoderma lucidum is provided, wherein Ganoderma lucidum ( Ganoderma Lingzhi ) The mycelium of TCZ-0007 is inoculated into a liquid culture medium for cultivation, and the mycelium fermentation liquid is obtained, which is then sterilized and dried.

[0010] In one embodiment of the present invention, the composition of the liquid culture medium is: 18-25 grams of potato flour, 30-35 grams of bran, 6-10 grams of white sugar, 2-5 grams of potassium dihydrogen phosphate, 1-4 grams of magnesium sulfate and 8-12 milligrams of vitamin B1 per liter of culture medium. Preferably, the composition of the liquid culture medium is: 20 grams of potato flour, 30 grams of bran, 10 grams of white sugar, 3 grams of potassium dihydrogen phosphate, 1.5 grams of magnesium sulfate and 10 milligrams of vitamin B1 per liter of culture medium.

[0011] In some embodiments of the present invention, the inoculation amount is 2-5% (2-5 g of bacterial strain per 100 mL of liquid culture medium).

[0012] In one embodiment of the present invention, the culture temperature is 25-30°C.

[0013] In one embodiment of the present invention, the sterilization condition is 75-85°C, maintained for 10-20 min, and then rapidly cooled to 25-35°C.

[0014] In one embodiment of the present invention, the drying comprises pulping the sterilized mycelium fermentation liquid, filtering and freeze-drying the filtrate to obtain Ganoderma lucidum ( Ganoderma lingzhi ) Mycelial culture of TCZ-0007.

[0015] In one embodiment of the present invention, preparing Ganoderma lucidum ( Ganoderma lingzhi ) The method of mycelial culture of TCZ-0007 comprises:

[0016] Lingzhi Ganoderma lingzhi ) TCZ-0007 is a bacterial strain, and the bacterial strain is activated in PDA solid culture medium;

[0017] The activated bacterial strains are inoculated into a PDA liquid culture medium to obtain a bacterial strain culture solution;

[0018] The culture fluid of the bacterial strain is inoculated into a liquid culture medium to obtain a mycelium fermentation fluid; the composition of the liquid culture medium may be, for example, 20 grams of potato flour, 30 grams of bran, 10 grams of white sugar, 3 grams of potassium dihydrogen phosphate, 1.5 grams of magnesium sulfate and 10 milligrams of vitamin B1 per liter of culture medium. The mycelium fermentation fluid is sterilized, including heating the mycelium fermentation fluid to 75°C, maintaining it for 20 minutes, and then rapidly cooling it to 25°C;

[0019] The sterilized mycelium fermentation liquid is freeze-dried, including fully beating and sieving the sterilized mycelium fermentation liquid, and freeze-drying the filtrate to obtain the mycelium culture of Ganoderma lucidum.

[0020] In one embodiment of the present invention, the formula of the PDA solid culture medium is: 200 g / L potato, 20 g / L glucose, 20 g / L agar, natural pH, and sterilized at 115° C. for 20 min.

[0021] In one embodiment of the present invention, the PDA liquid culture medium formula consists of: 200 g / L potato, 20 g / L glucose, natural pH, and sterilization at 115° C. for 20 min.

[0022] In a fourth aspect of the present invention, a composition is provided, comprising Ganoderma lucidum ( Ganoderma lingzhi ) fruiting bodies of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma lingzhi ) spore powder of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma Lingzhi ) mycelium of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma lingzhi ) Mycelial culture of TCZ-0007.

[0023] In some embodiments of the present invention, the composition can be mixed with acceptable excipients, carriers, additives, etc. to prepare a product. The selection and use of the excipients, carriers, additives, etc. can refer to the relevant catalogues and their use regulations issued by the State Administration for Market Regulation of China. Among them, the selection and use of the excipients, carriers, additives, etc. of the drug can refer to the provisions of the Manual of Pharmaceutical Excipients and the Chinese Pharmacopoeia.

[0024] In a fifth aspect of the present invention, a product is provided, comprising Ganoderma lucidum ( Ganoderma lingzhi ) fruiting bodies of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma lingzhi ) spore powder of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma Lingzhi ) mycelium of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma lingzhi ) Mycelial culture of TCZ-0007.

[0025] In an embodiment of the present invention, the product includes but is not limited to medicines.

[0026] In one embodiment of the present invention, the product further comprises necessary auxiliary ingredients, such as pharmaceutically acceptable auxiliary materials, carriers, additives, etc. For example, the Ganoderma lucidum ( Ganoderma lingzhi ) fruiting bodies of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma lingzhi ) spore powder of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma lingzhi ) mycelium of TCZ-0007, and / or Ganoderma lucidum ( Ganoderma lingzhi ) The mycelium culture of TCZ-0007 is used as an active ingredient, and it can be mixed with other ingredients such as excipients to prepare the desired finished product. The preparation method can be selected according to the product type. For example, for medicines, the active ingredient can be mixed with the excipients, for example, after wet or dry granulation, the tablets can be obtained, or the tablets can be encapsulated in capsules to obtain capsules. For example, it can be prepared according to the conventional preparation method of medicines.

[0027] In a sixth aspect of the present invention, a method for preparing ganoderma lucidum polysaccharide is provided, comprising: preparing ganoderma lucidum polysaccharide from Ganoderma lingzhi ) The method is obtained from the mycelium or fermentation broth of Ganoderma lucidum cultured with TCZ-0007.

[0028] In the seventh aspect of the present invention, a method for preparing ganoderic acid B and / or ganoderic acid D is provided, comprising: preparing ganoderic acid B and / or ganoderic acid D from ganoderma lucidum ( Ganoderma lingzhi ) The method is obtained from the mycelium or fermentation broth of Ganoderma lucidum cultured with TCZ-0007.

[0029] In an eighth aspect of the present invention, there is provided Ganoderma lucidum ( Ganoderma lingzhi ) Use of TCZ-0007, or the Ganoderma lucidum rich in ganoderic acid B and ganoderic acid D described in the second aspect, or the mycelium culture of Ganoderma lucidum described in the third aspect, or the composition described in the fourth aspect in the preparation of a product having at least one of the following functions:

[0030] (1) Products that improve antioxidant capacity;

[0031] For example, in some embodiments, the activity of antioxidant enzymes (such as GSH-Px and SOD) is enhanced to reduce oxidative damage caused by free radicals. It can be used to prevent or treat cell and tissue damage caused by oxidative stress and is suitable for diseases related to oxidative damage.

[0032] (2) Reduce the level of malondialdehyde (MDA) in the blood;

[0033] For example, in some embodiments, malondialdehyde (MDA) is a marker of lipid peroxidation, and a decrease in MDA indicates a reduction in lipid oxidative damage, and can be used to assist in the treatment of diseases associated with oxidative stress, especially damage caused by cell membrane lipid peroxidation.

[0034] (3) Increase the level of glutathione peroxidase (GSH-Px) in the blood;

[0035] For example, in some embodiments, increasing the level of GSH-Px helps to improve the antioxidant defense in cells and reduce the harmful effects of hydrogen peroxide and lipid peroxides, and can be used to prevent and treat cell damage caused by excessive production of free radicals and oxidants.

[0036] (4) Increase the level of superoxide dismutase (SOD) in the blood;

[0037] For example, in some embodiments, SOD can remove superoxide free radicals, and increasing the level of SOD means enhancing the antioxidant capacity. It can be used to assist in antioxidant, anti-aging or to cope with oxidative stress in chronic diseases.

[0038] (5) Reduce the level of protein carbonyl (PC) in tissues;

[0039] For example, in some embodiments, protein carbonylation (PC) is a marker of protein oxidative damage, and reducing PC levels can reduce protein oxidative damage and maintain protein function. It can be used to prevent or assist in the treatment of diseases associated with protein oxidative damage, such as aging, chronic inflammation, and degenerative diseases.

[0040] (6) Products that increase the level of red blood cells in the blood;

[0041] For example, in some embodiments, increasing the level of red blood cells helps alleviate anemia symptoms and improves the oxygen supply capacity of tissues. It can be used for the adjuvant treatment or prevention of anemia, especially anemia caused by malnutrition, chronic disease or bone marrow suppression.

[0042] (7) Products that increase the level of white blood cells in the blood;

[0043] For example, in some embodiments, increasing the level of white blood cells helps to enhance the body's immune defense and prevent infection, and is particularly suitable for patients with leukopenia. It can be used as an adjuvant treatment for immunosuppression, leukopenia, and leukopenia caused by bone marrow suppression.

[0044] (8) Products that increase the level of granulocyte colony-stimulating factor (G-CSF) in the blood;

[0045] For example, in some embodiments, increasing the level of G-CSF can promote the production of neutrophils, help improve leukopenia and enhance resistance to infection. It can be used as an adjuvant treatment for leukopenia caused by chemotherapy or other drugs, especially neutropenia.

[0046] (9) Products that enhance immunity;

[0047] For example, in some embodiments, the immune system is enhanced as a whole by improving the functions of white blood cells, G-CSF, antioxidant enzymes, etc. It can be applied to individuals with low immunity to prevent infection and enhance resistance to disease.

[0048] This type of product is suitable for improving antioxidant capacity, hematopoietic function and the overall health of the immune system. It can assist in the treatment of diseases related to oxidative stress, anemia, immunosuppression and bone marrow suppression, and has broad potential for medical and health care applications.

[0049] In an embodiment of the present invention, the products include but are not limited to medicines and scientific research reagents, etc.

[0050] In a ninth aspect of the present invention, there is provided Ganoderma lucidum ( Ganoderma lingzhi ) Use of TCZ-0007, the Ganoderma lucidum rich in ganoderic acid B and ganoderic acid D as described in the second aspect, or the mycelial culture of Ganoderma lucidum as described in the third aspect, or the composition as described in the fourth aspect in the preparation of a medicine for preventing or assisting in the treatment of oxidative damage, and / or anemia, and / or immunosuppression, and / or leukopenia, and / or bone marrow suppression and other related diseases or conditions.

[0051] In some embodiments of the present invention, the anemia is: such as iron deficiency anemia, malnutrition anemia, anemia caused by bone marrow suppression or chronic diseases. The immunodeficiency is: such as immunodeficiency, immunosuppression after radiotherapy and chemotherapy, immunosuppression caused by chronic diseases, etc. The leukopenia is: such as leukopenia and bone marrow suppression caused by chemotherapy or drugs. The bone marrow suppression is: such as bone marrow hematopoietic function suppression caused by drugs, chemotherapy or other reasons.

[0052] Compared with the prior art, the present invention has the following beneficial effects:

[0053] The Ganoderma lucidum of the present invention ( Ganoderma lingzhi)TCZ-0007 is collected from Taishan oak trees. The ganoderma is rich in ganoderma polysaccharides and ganoderma triterpenes, especially with the characteristics of specific enrichment of ganoderic acid B and ganoderic acid D. The proportion of ganoderic acid B and ganoderic acid D in its total triterpenes is much higher than that of other similar strains. In addition, ganoderic acid, especially triterpenoid compounds, usually has a bitter taste. This is one of the main reasons why ganoderma itself has a bitter taste. However, ganoderic acid B and ganoderic acid D have almost no bitterness, so they are particularly suitable for products with high taste requirements.

[0054] The Ganoderma lucidum of the present invention ( Ganoderma lingzhi ) The culture of TCZ-0007 has been verified by animal experiments to be able to significantly reduce the level of malondialdehyde in the blood, increase the levels of glutathione peroxidase and superoxide dismutase in the blood, reduce the level of protein carbonyl in tissues, and increase the levels of red blood cells, white blood cells and granulocyte colony stimulating factor in the blood, indicating that it has the ability to resist oxidation, enhance immunity, improve anemia, promote bone marrow hematopoietic function, etc., and can be used to prepare related products, as well as for the prevention or adjuvant treatment of oxidative damage, and / or anemia, and / or immunodeficiency, and / or leukopenia, and / or bone marrow suppression and other related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. The embodiments of the present invention are described in detail below in conjunction with the accompanying drawings, wherein:

[0056] Picture 1 Ganoderma lucidum ( Ganoderma lingzhi ) Field growth image of the fruiting body of TCZ-0007.

[0057] Picture 2 Ganoderma lucidum ( Ganoderma lingzhi ) Colony characteristics of mycelium of TCZ-0007.

[0058] Picture 3 Ganoderma lucidum ( Ganoderma lingzhi ) Microscopic examination of the mycelium of TCZ-0007.

[0059] Picture 4 Ganoderma lucidum ( Ganoderma lingzhi ) Phylogenetic tree of ITS rDNA sequences of TCZ-0007 and related species.

[0060] Picture 5 Ganoderma lucidum ( Ganoderma lingzhi ) Liquid phase spectrum of ganoderic acid B and ganoderic acid D in the culture of TCZ-0007. DETAILED DESCRIPTION

[0061] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0062] Unless otherwise defined, all professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. The reagents or raw materials used in the present invention can be purchased through conventional channels. Unless otherwise specified, the reagents or raw materials used in the present invention are used in a conventional manner in the art or in accordance with the product instructions. In addition, any method and material similar to or equivalent to the described content can be applied to the method of the present invention. The preferred implementation methods and materials described in the text are for demonstration purposes only.

[0063] Example 1 Screening and identification of Ganoderma lucidum TCZ-0007

[0064] A Ganoderma lucidum fruiting body was collected at the foot of Mount Tai. The fruiting body is kidney-shaped, with white flesh on the edge and light yellow-brown in the middle. The stem is lateral. Picture 1 shown.

[0065] After separation and purification, the strain was temporarily named strain TCZ-0007. Its mycelium was transferred to PDA solid medium and cultured at 25℃ for 7 days. The colony diameter was 41-44mm, white, flat, velvety, light yellow on the reverse side, no exudate was produced, and no soluble pigment was produced. Picture 2 shown.

[0066] Among them, the formula of PDA solid culture medium is: 200g / L potato, 20g / L glucose, 20g / L agar, natural pH, sterilized at 115℃ for 20min.

[0067] The mycelium of TCZ-0007 was examined under a microscope. Picture 3 As shown, the hyphae are clearly septate and branched, with transparent walls, a diameter of 1.5-4.5 μm, forming lock-like unions, and some hyphae are branched to form coral-like hyphae.

[0068] Further, the mycelium of TCZ-0007 was separated and purified, and transferred to PDA solid medium (same composition as above), cultured at 25°C, and after the mycelium was fully grown, it was handed over to the China Industrial Microbiological Culture Collection (CICC) for ITSrDNA sequence analysis and identification of the strain. The ITS rDNA segment sequence (see SEQ ID NO: 1) was analyzed and compared with the professional database (20231007) based on the NCBI database. The phylogenetic tree was constructed using MEGA software and the neighbor-joining method, and the similarity was repeated 1000 times ( Picture 4 The phylogenetic tree nodes only show values ​​with Bootstrap values ​​greater than 70%). The analysis and identification results showed that strain TCZ-0007 was Ganoderma lucidum, and the strain was named Ganoderma lucidum ( Ganoderma lingzhi )TCZ-0007, the ITS rDNA segment sequence is as follows:

[0069] 1 TGCGGAAGGA TCATTATCGA GTTTTGACCG GGTTGTAGCT GGCCTTCCGA

[0070] 51 GGCATGTGCA CGCCCTGTTC ATCCACTCTA CACCTGTGCA CTTACTGTGG

[0071] 101 GCTTCAGATT GCGAGGCACG CTCTTTACCG GGCTTGCGGA GCATATCTGT

[0072] 151 GCCTGCGTTT ATCACAAACT CTATAAAGTA ACAGAATGTG TATTGCGATG

[0073] 201 TAACACATCT ATATACAACT TTCAGCAACG GATCTCTTGG CTCTCGCATC

[0074] 251 GATGAAGAAC GCAGCGAAAT GCGATAAGTA ATGTGAATTG CAGAATTCAG

[0075] 301 TGAATCATCG AATCTTTGAA CGCACCTTGC GCTCCTTGGT ATTCCGAGGA

[0076] 351 GCATGCCTGTTTGAGTGTCATGAAATCTTC AACCTACAAGCTTTTGTGGT

[0077] 401 TTGTAGGCTT GGACTTGGAG GCTTGTCGGC CGTTATCGGT CGGCTCCTCT

[0078] 451 TAAATGCATT AGCTTGGTTC CTTGCGGATC GGCTCTCGGT GTGATAATGT

[0079] 501 CTACGCCG.

[0080] Ganoderma lucidum ( Ganoderma lingzhi )TCZ-0007 is deposited in China Center for Type Culture Collection, with the deposit address being Wuhan University, Wuhan, China, with the deposit number being CCTCC NO: M 20231910, and the deposit date being October 16, 2023. In the following examples, Ganoderma lucidum ( Ganoderma lingzhi )TCZ-0007 is referred to as Lingzhi TCZ-0007 or TCZ-0007 for short.

[0081] Example 2 Preparation of mycelial culture of Ganoderma lucidum TCZ-0007

[0082] The mycelium culture of Ganoderma lucidum TCZ-0007 is prepared by the following steps:

[0083] (1) Strains: Ganoderma lucidum TCZ-0007;

[0084] (2) Activation of strains: Take the purified mycelium slant under sterile conditions, use an inoculation needle to pick up two mycelium blocks (5 mm × 5 mm), inoculate them on PDA solid culture medium, and culture at 25°C for 4 days;

[0085] (3) Preparation of strains: Take the prepared activated strain slant, pick two mycelium blocks (5 mm × 5 mm) under sterile conditions and inoculate them into PDA liquid culture medium, and culture them in a shaking incubator at 25°C and 160 rpm for 4 days to prepare mycelium strain liquid;

[0086] (4) Mycelium culture: Inoculate the bacterial culture liquid at a 2% inoculum amount into a liquid culture medium containing 20 g potato flour, 30 g bran, 10 g white sugar, 3 g potassium dihydrogen phosphate, 1.5 g magnesium sulfate and 10 mg vitamin B1 per liter of culture medium, and culture in a shaking incubator at 25°C and 160 rpm for 4 days to obtain the mycelium fermentation liquid of the strain;

[0087] (5) Mycelium sterilization: Heat the mycelium fermentation liquid to 75°C, maintain for 20 min, and then quickly cool it to 25°C for sterilization;

[0088] (6) Freeze-drying treatment: The sterilized mycelium fermentation liquid is fully beaten and passed through a 60-mesh sieve, and the filtrate is freeze-dried to obtain the mycelium culture of Ganoderma lucidum TCZ-0007.

[0089] In step (2), the formula of the PDA solid culture medium is: 200 g / L potato, 20 g / L glucose, 20 g / L agar, natural pH, and sterilized at 115°C for 20 min.

[0090] In step (3), the formula of the PDA liquid culture medium is: 200 g / L potato, 20 g / L glucose, natural pH, and sterilized at 115°C for 20 min.

[0091] Example 3 Detection of Ganoderma lucidum polysaccharide and total triterpenoid content

[0092] Referring to the polysaccharide detection method in Ganoderma lucidum in Part I of the Chinese Pharmacopoeia, polysaccharide detection was performed on the mycelium culture of Ganoderma lucidum TCZ-0007 obtained in Example 2 above.

[0093] Before the test, 2 g of Ganoderma mycelium culture was dissolved in 100 mL of water, 0.1 g of α-amylase was added, and the mixture was placed in a 60°C water bath. After 1 hour of water bath, starch indicator was used to detect starch until it was completely decomposed to eliminate the interference factor of starch, and then Ganoderma polysaccharide determination was carried out.

[0094] The total triterpene content was tested in accordance with NY / T3676-2020 "Spectrophotometric method for the determination of total triterpene content in Ganoderma lucidum". Ganoderma lingzhi ) LZ-04, LZ-05, and LZ-24 were cultured synchronously as control strains, and the contents of Ganoderma lucidum polysaccharides and total triterpenes were detected synchronously.

[0095] Table 1 Detection results of TCZ-0007 Ganoderma lucidum polysaccharide and total triterpenoid content ( , n=3)

[0096]

[0097] The results showed that compared with the control strain, Ganoderma lucidum TCZ-0007 showed a higher ability to produce Ganoderma lucidum polysaccharides and total triterpenes. The Ganoderma lucidum polysaccharides and total triterpenes in the mycelium culture of Ganoderma lucidum TCZ-0007 reached 26.04% and 2.147%, respectively.

[0098] Example 4 Detection of Ganoderic Acid B and Ganoderic Acid D Content

[0099] Take 1 g of the mycelial culture of Ganoderma lucidum TCZ-0007 obtained in Example 2, add 10 mL of pure water, ultrasonically treat for 20 min to fully dissolve, then add 40 mL of anhydrous ethanol, stir thoroughly, centrifuge to obtain the supernatant, repeat the precipitation process once, combine the two supernatants, dissolve to 100 mL, filter with a 0.45 μm microporous filter membrane, and prepare a test sample.

[0100] Detection conditions: LC-20A high performance liquid chromatograph, InertSustain AQ-C18 (4.6mm×250mm, 5μm) chromatographic column, column temperature 30°C, mobile phase of acetonitrile-0.1% acetic acid for gradient elution, flow rate 1mL / min, elution time 100min, injection volume 10μL, UV detector, detection wavelength 254nm, qualitative and quantitative analysis was performed using purchased ganoderic acid B and ganoderic acid D standards.

[0101] The liquid phase analysis spectrum of the mycelial culture of Ganoderma lucidum TCZ-0007 is shown in Picture 5 Ganoderic acid B and Ganoderic acid D can be effectively separated for qualitative and quantitative detection results as shown in Table 2.

[0102] Table 2 TCZ-0007 Ganoderic acid B and Ganoderic acid D content test results ( , n=3)

[0103]

[0104] The contents of ganoderic acid B and ganoderic acid D in the mycelium culture of Ganoderma lucidum TCZ-0007 reached 1.290% and 0.398% respectively, of which ganoderic acid B and D accounted for 78.62% of the total triterpenes, while other strains tested with the same treatment accounted for less than 30%, which is consistent with the results shown in existing related studies that ganoderic acid B and D accounted for no more than 30% of the total triterpenes in different Ganoderma lucidums, mostly between 15% and 25%. The results of this embodiment show that Ganoderma lucidum TCZ-0007 can specifically enrich ganoderic acid B and ganoderic acid D. Ganoderic acid, especially triterpenoid compounds, usually has bitter taste. This is one of the main reasons why Ganoderma lucidum itself has bitter taste. However, ganoderic acid B and ganoderic acid D have almost no bitterness, so they are particularly suitable for products with high taste requirements.

[0105] Example 5 Animal test on the anti-oxidative damage of Ganoderma lucidum TCZ-0007

[0106] SPF healthy Kunming mice, male, 18±2 g, were selected and pre-fed for one week. The experiment set up a blank control group, a model group and different sample dose groups, which were randomly divided into groups, with 10 mice in each group. The mycelial culture of Ganoderma lucidum TCZ-0007 (prepared according to the method of Example 2) was used as the sample to set up sample dose groups, with a total of 3 sample dose groups (low dose group 1.0 g / kg body weight; medium dose group 1.5 g / kg body weight; high dose group 3.0 g / kg body weight). The blank control group and the model group were given the same volume of purified water for continuous gavage for 30 days. After the last gavage, the mice were fasted for 16 hours. The model group and different sample dose groups were given 50% ethanol 12 mL / kg body weight by gavage once, and the blank control group was given the same dose of purified water. After 6 hours, the eyeballs were removed to collect blood, and the serum was collected by centrifugation. The contents of serum malondialdehyde (MDA), glutathione peroxidase (GSH-Px) and superoxide dismutase (SOD) were determined by microplate reader; at the same time, liver tissue was dissected to detect the content of protein carbonyl (PC).

[0107] Table 3 Results of the anti-oxidative damage function test of Ganoderma lucidum TCZ-0007 in vivo ( , n=10)

[0108]

[0109] Note: Compared with the model group, * represents P <0.05, ** represents P <0.01;

[0110] MDA, GSH-Px, SOD and PC are biochemical indicators that are commonly used to evaluate the oxidative stress status, antioxidant defense capacity and oxidative damage associated with various diseases or pathological processes in the body.

[0111] The results of the in vivo antioxidant damage function test of Ganoderma lucidum TCZ-0007 mycelium culture showed that the serum MDA, GSH-Px, SOD and liver PC levels of the blank control group were significantly different from those of the model group, indicating that the ethanol oxidative stress model was successfully established. The data of the model group showed that ethanol can increase the generation of free radicals by inducing oxidative stress, leading to cell membrane lipid peroxidation (increased MDA), protein oxidation (increased PC) and decreased antioxidant enzyme activity (decreased SOD and GSH-Px).

[0112] Compared with the model group, the MDA content in the low-dose TCZ-0007 group was slightly lower than that in the model group, but there was no significant difference; the MDA content in the medium- and high-dose TCZ-0007 groups was significantly lower than that in the model group, especially in the high-dose group ( P<0.05). This indicates that medium and high doses of TCZ-0007 effectively reduced lipid peroxidation and had good antioxidant and protective effects. The GSH-Px activity of the low and medium dose groups of TCZ-0007 was restored, especially in the medium dose group ( P <0.05) and high-dose group ( P <0.01), indicating that the mycelial culture of Ganoderma lucidum TCZ-0007 enhanced the activity of antioxidant enzymes and resisted oxidative stress. The SOD activity of the low-dose TCZ-0007 group increased slightly, but there was no significant change. The SOD activity of the medium- and high-dose TCZ-0007 groups increased significantly, especially the high-dose group ( P <0.05), indicating that medium and high doses of TCZ-0007 can restore SOD activity and enhance the body's antioxidant capacity. The PC content in the low-dose TCZ-0007 group decreased, but there was no significant difference. The medium and high doses of TCZ-0007 significantly reduced the PC content ( P <0.05), especially in the high-dose group, indicating that TCZ-0007 can alleviate protein oxidative damage.

[0113] The above results show that the mycelial culture of Ganoderma lucidum TCZ-0007 has a dose-dependent protective effect, among which medium and high doses can significantly reduce the oxidative stress and liver damage caused by ethanol, especially the high-dose group has the best effect, which is manifested by effectively reducing the oxidative damage of lipids and proteins and enhancing the activity of antioxidant enzymes.

[0114] Example 6 Animal test on the effect of Lingzhi TCZ-0007 on increasing white blood cells and red blood cells

[0115] SPF healthy Kunming mice, male, 18±2 g, were selected and pre-fed for one week. The experiment set up a blank control group, a model group and a test group. The test group was administered with the mycelial culture of Ganoderma lucidum TCZ-0007 (prepared according to the method of Example 2). According to the dosage, the test group was further divided into different dose groups (low dose group 1.0 g / kg body weight; medium dose group 1.5 g / kg body weight; high dose group 3.0 g / kg body weight), and the mice were randomly divided into groups, with 12 mice in each group.

[0116] The model group and the experimental group were intraperitoneally injected with 80 mg / kg body weight cyclophosphamide, and the blank control group was injected with the same dose of normal saline for three consecutive days. Then the experimental groups (low-dose group, medium-dose group and high-dose group) were treated according to the dose. After 15 days of administration, blood was collected using the canthal vein capillary (heparin sodium treatment), diluted with white blood cell and red blood cell diluent respectively, and the number of white blood cells and red blood cells was determined using a blood cell counting plate. At the same time, the eyeball was removed to collect blood, and serum was centrifuged to obtain serum, and the level of granulocyte colony stimulating factor (G-CSF) was determined using an enzyme marker. The test results are shown in Table 4.

[0117] Table 4 TCZ-0007 enhances the colony stimulating factor function of mice leukocytes, erythrocytes and granulocytes ( , n=12)

[0118]

[0119] Note: Compared with the model group, * represents P <0.05, ** represents P <0.01.

[0120] Changes in white blood cells and red blood cells can reflect the body's immune status, degree of infection, bone marrow function, and oxygen supply. G-CSF is mainly related to granulocyte production and immune defense, and changes in its level indicate bone marrow hematopoietic function and the body's ability to resist infection. Comprehensive analysis of changes in these parameters can help evaluate the body's immune function, infection status, inflammatory response, and response to different treatments.

[0121] The results of the test on the function of TCZ-0007 in improving the white blood cells, red blood cells and granulocyte colony stimulating factor in mice showed that the blank control group did not receive cyclophosphamide treatment and showed normal white blood cells, red blood cells and G-CSF levels, which can be used as a control to indicate the immune and hematopoietic function of the body under normal conditions. After the model group was modeled with cyclophosphamide, cyclophosphamide caused a significant decrease in the number of white blood cells and red blood cells, indicating that the chemotherapy drug caused immunosuppression and bone marrow suppression, affecting hematopoietic function. In addition, the level of G-CSF was also significantly reduced, indicating that the production of hematopoietic factors was inhibited. This group reflects the state of immune and hematopoietic damage caused by cyclophosphamide.

[0122] Compared with the model group, TCZ-0007 in different dose groups has the ability to promote the increase of white blood cell, red blood cell number and granulocyte colony stimulating factor level, among which the white blood cell level in the low dose group increased significantly ( P <0.05), red blood cell and G-CSF levels also recovered; the medium-dose group could significantly increase the white blood cell level ( P <0.01), significantly increased the level of red blood cells ( P <0.05), significantly increased the level of granulocyte colony stimulating factor ( P <0.05), and the above indicators were close to the blank control group, indicating that the medium-dose TCZ-0007 effectively resisted the immune and hematopoietic suppression caused by cyclophosphamide and had a good protective and restorative effect. The white blood cell level in the high-dose group increased significantly ( P <0.01), and close to the level of the blank group, significantly increasing the level of red blood cells ( P<0.05), and completely recovered to the level of the blank control group and was slightly higher than the blank group, and significantly increased the level of granulocyte colony stimulating factor ( P <0.05), and was higher than the blank control group. High-dose TCZ-0007 had a significant recovery effect on the levels of white blood cells, red blood cells, and G-CSF, almost completely reversing the immune and hematopoietic suppression caused by cyclophosphamide, and the levels of white blood cells and red blood cells were close to or reached normal. The G-CSF level was even slightly higher than that of the blank control group, indicating that the high-dose group had stronger immune regulation and hematopoietic function recovery capabilities.

[0123] The above results indicate that the mycelial culture of Ganoderma lucidum TCZ-0007 can stimulate the differentiation of bone marrow stem cells, enhance the body's immune regulation function, and increase the levels of white blood cells and red blood cells in the blood. It can be applied to the development of products with related functions such as anti-oxidation, white blood cell increase, tumor radiotherapy and chemotherapy recovery, bone marrow suppression recovery, immune regulation, and qi and blood tonification.

[0124] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A Lingzhi ( Ganoderma lingzhi )TCZ-0007, characterized in that, The Ganoderma lucidum ( Ganoderma Lingzhi )TCZ-0007 is deposited in the China Center for Type Culture Collection, the deposit address is Wuhan University, Wuhan, China, the deposit number is CCTCC NO: M 20231910, and the deposit date is October 16, 2023.

2. A mycelium culture of Ganoderma lucidum, characterized in that: The Ganoderma lucidum ( Ganoderma Lingzhi ) The mycelium of TCZ-0007 is inoculated into a liquid culture medium for cultivation, and the mycelium fermentation liquid is obtained, which is then sterilized and dried.

3. The mycelium culture of Ganoderma lucidum according to claim 2, characterized in that: The composition of the liquid culture medium is as follows: each liter of the culture medium contains 18-25 grams of potato flour, 30-35 grams of bran, 6-10 grams of white sugar, 2-5 grams of potassium dihydrogen phosphate, 1-4 grams of magnesium sulfate and 8-12 milligrams of vitamin B1.

4. A composition comprising the Ganoderma lucidum ( Ganoderma lingzhi ) the fruiting body of TCZ-0007, and / or the Ganoderma lucidum ( Ganoderma lingzhi ) TCZ-0007 spore powder, and / or the Ganoderma lucidum ( Ganoderma Lingzhi ) mycelium of TCZ-0007, and / or the mycelium culture of Ganoderma lucidum according to claim 2 or 3.

5. A method for preparing Ganoderma lucidum polysaccharide, characterized in that: From the Ganoderma lucidum according to claim 1 ( Ganoderma Lingzhi ) The method is obtained from the mycelium or fermentation broth of Ganoderma lucidum cultured with TCZ-0007.

6. A method for preparing ganoderic acid B and / or ganoderic acid D, characterized in that: From the Ganoderma lucidum according to claim 1 ( Ganoderma lingzhi ) The method is obtained from the mycelium or fermentation broth of Ganoderma lucidum cultured with TCZ-0007.

7. The Ganoderma lucidum according to claim 1 ( Ganoderma lingzhi ) Use of TCZ-0007, or the mycelium culture of Ganoderma lucidum according to claim 2 or 3, or the composition according to claim 4 in the preparation of a product with improved antioxidant capacity.

8. The Ganoderma lucidum according to claim 1 ( Ganoderma lingzhi ) Use of TCZ-0007, or the mycelial culture of Ganoderma lucidum according to claim 2 or 3, or the composition according to claim 4 in the preparation of a product having at least one of the following functions: (1) Products that reduce the level of malondialdehyde in the blood; (2) Products that increase the level of glutathione peroxidase in the blood; (3) Products that increase the level of superoxide dismutase in the blood; (4) Products that reduce the level of protein carbonyl groups in tissues; (5) Products that increase the level of red blood cells in the blood; (6) Products that increase the level of white blood cells in the blood; (7) Products that increase the level of granulocyte colony-stimulating factor in the blood; and (8) Products that enhance immunity.

9. The Ganoderma lucidum according to claim 1 ( Ganoderma lingzhi ) Use of TCZ-0007, or the mycelial culture of Ganoderma lucidum as described in claim 2 or 3, or the composition as described in claim 4 in the preparation of a medicine for preventing or assisting in the treatment of anemia, and / or immunodeficiency, and / or leukopenia, and / or bone marrow suppression.

Images