A triple fluorescence quantitative PCR detection method for porcine reproductive and respiratory syndrome virus American type

Abstract

The present invention provides a triple fluorescence quantitative PCR detection method for the American type of porcine reproductive and respiratory syndrome virus, that is, on the basis of screening and obtaining multiple PCR amplification primer pairs and probes, a triple fluorescence quantitative PCR detection method is established that can identify highly pathogenic strains of porcine reproductive and respiratory syndrome virus, NADC30-like strains and NADC34-like strains by one PCR. The primer pair and probe used to detect the highly pathogenic strain of the American type have an upstream primer sequence of SEQ ID NO:4, a downstream primer sequence of SEQ ID NO:5, and a probe sequence of SEQ ID NO:6. The primer pair and probe used to detect the American type NADC30-like strain have an upstream primer sequence of SEQ ID NO:7, a downstream primer sequence of SEQ ID NO:8, and a probe sequence of SEQ ID NO:9. The primer pair and probe used to detect the American type NADC34-like strain have an upstream primer sequence of SEQ ID NO:10, a downstream primer sequence of SEQ ID NO:11, and a probe sequence of SEQ ID NO:12.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection services, and in particular relates to a triple fluorescence quantitative PCR detection method for porcine reproductive and respiratory syndrome virus American type. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS) is a reproductive disorder and respiratory infectious disease of pigs caused by porcine reproductive and respiratory syndrome virus (PRRSV). It mainly causes abortion, stillbirth and mummification in pregnant sows, and respiratory disorders in piglets. PRRS has become one of the most serious diseases in the global pig industry. According to the sequence difference of the PRRSV genome, it is divided into the European genotype represented by Lelystad virus (LV) and the American genotype represented by the classic strain VR-2332. The two strains are similar in morphology and physicochemical properties, but different in antigenicity and cell tropism. There are great differences in the gene sequences of European and American strains, among which the Nsp2 gene is more different, and the corresponding amino acid homology is only about 32%. American strains are the majority in my country.

[0003] The disease was introduced into my country in 1995. In 2006, a highly pathogenic porcine reproductive and respiratory syndrome (HP-PRRS) broke out in my country. In 2013, a NADC30-like strain appeared. In 2017, my country detected a NADC34-like PRRSV for the first time, and the detection rate of this strain has increased year by year, with a trend of replacing the NADC-30 PRRSV and becoming the main epidemic strain. Compared with the Nsp2 sequence of the classic porcine reproductive and respiratory syndrome virus VR-2332, my country's highly pathogenic strain (HP-PRRSV) has a discontinuous deletion of 30 amino acids in the Nsp2 region. The Nsp2 of the NADC30-like strain has three discontinuous amino acid deletion regions, with a total of 131 amino acid deletions. The characteristic of the NADC34-like strain is the presence of a continuous deletion of 100 amino acids in the Nsp2 region.

[0004] PRRSV has caused serious economic losses to my country's pig farming industry. So far, the prevention and control of PRRS is mainly based on vaccines, and the strains used are mainly classical strains and highly pathogenic strains. However, the commercial vaccines currently available only have good protection against infection with homologous strains, and the protection effect against infection with heterologous strains is poor. This is also an important reason for the repeated outbreaks of PRRS and the emergence of new mutant strains. For this reason, in recent years, the most common PRRSV strains are lineage 1 (NADC30 and NADC34), followed by highly pathogenic strains, and classical strains are rarely encountered.

[0005] In laboratory testing, the qPCR detection method is highly favored, and this method has the advantages of good specificity, high sensitivity, accuracy, and quantification. At present, the commercial fluorescent quantitative PCR kits in clinical practice require enzymes, primers, and probes to be prepared and used immediately, which is cumbersome to operate and has a high possibility of error. A convenient and fast detection method is urgently needed.

[0006] Freeze-drying technology is a method of drying by using the sublimation properties of water under low temperature and low pressure conditions. The basic principle is to freeze the water-containing material into a solid, and then sublimate the solid ice directly into water vapor under high vacuum conditions, thereby removing the water and achieving the purpose of drying. This process is carried out at temperatures below zero or even lower, avoiding the problems of material denaturation, loss of nutrients, and inactivation of microorganisms that may be caused by high temperatures in traditional drying methods. Freeze-drying technology can not only effectively preserve the original structure and shape of the material, but also retain the biological activity and nutrients of the material to the greatest extent.

[0007] To date, there is no multiplex fluorescence quantitative PCR detection method that can simultaneously identify highly pathogenic PRRSV strains, NADC30-like strains, and NADC34-like strains. Summary of the invention

[0008] The purpose of the present invention is to provide a triple fluorescence quantitative PCR detection method for porcine reproductive and respiratory syndrome virus American type, that is, on the basis of screening and obtaining multiple PCR amplification primer pairs and probes, a triple fluorescence quantitative PCR detection method is established which can identify highly pathogenic porcine reproductive and respiratory syndrome virus strains, NADC30-like strains and NADC34-like strains by one PCR.

[0009] The present invention first provides a triple fluorescence quantitative PCR detection primer pair and probe combination for highly pathogenic strains of porcine reproductive and respiratory syndrome virus American type, NADC30 strain of American type, and NADC34 strain of American type, which comprises:

[0010] 1) Primer pairs and probes for detecting highly pathogenic strains of the American type,

[0011] Upstream primer: 5′-AGTGGGTCGGCACCAGTT-3′ (SEQ ID NO: 4),

[0012] Downstream primer: 5′-CAGACAAATCCAGAGGCT-3′ (SEQ ID NO: 5),

[0013] Probe: HEX-5′-CGTAGAACTGTGACAACAACGC-3′-BHQ1 (SEQ ID NO: 6);

[0014] 2) Primer pairs and probes for detecting American NADC30-like strains,

[0015] Upstream primer: 5′-CGGTATGTAYTGAGTAG-3′ (SEQ ID NO: 7),

[0016] Downstream primer: 5′-ACCTAAWGGCGAAGCAA-3′ (SEQ ID NO: 8),

[0017] Probe: FAM-5′-AACGCAGCCAGAGCACAGACAG-3′-BHQ1 (SEQ ID NO: 9);

[0018] 3) Primer pairs and probes for detecting American NADC34-like strains,

[0019] Upstream primer: 5′-ACGACAAATGCGTGGTT-3′ (SEQ ID NO: 10),

[0020] Downstream primer: 5′-ACCACGTTGAAAGTGTC-3′ (SEQ ID NO: 11),

[0021] Probe: ROX-5′-TTTGCCGTTATCGGATGAAA-3′-BHQ2 (SEQ ID NO: 12).

[0022] Furthermore, the probe for detecting highly pathogenic strains has fluorescein HEX linked to the 5′ end and fluorescein BHQ1 linked to the 3′ end;

[0023] The probe for detecting NADC30 has fluorescein FAM linked to its 5′ end and fluorescein BHQ1 linked to its 3′ end;

[0024] The probe for detecting NADC34 is connected to fluorescein ROX at the 5′ end and fluorescein BHQ2 at the 3′ end.

[0025] In another aspect, the present invention provides a multiplex fluorescence quantitative PCR detection kit, which comprises the above-mentioned primer pair and probe combination.

[0026] The present invention also provides a method for detecting highly pathogenic strains of porcine reproductive and respiratory syndrome virus American type, NADC30-like strains of American type, and NADC34-like strains of American type, wherein the method is to use the above-mentioned primer pairs and probes to perform multiplex PCR fluorescence quantitative detection;

[0027] The method described herein comprises 0.4 μmol / 20 μL of upstream and downstream primers for highly pathogenic strains, and 0.3 μmol / 20 μL of probe; 0.3 μmol / 20 μL of upstream and downstream primers for NADC30-like strains, and 0.2 μmol / 20 μL of probe; 0.4 μmol / 20 μL of upstream and downstream primers for NADC34-like strains, and 0.3 μmol / 20 μL of probe.

[0028] The present invention screens the dosage of primers and probes through optimization design and orthogonal experiments to determine the optimal dosage combination, thereby ensuring that the amplification efficiency of each primer pair is similar, the detection sensitivity is highest, and the purpose of minimizing the consumption of raw materials is achieved. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 : Specificity test results of triple q-PCR method, with RNA of WUH5 strain (A1), NADC34 strain (A2), and JXAI strain (A3) as positive controls, and ddH2O as negative control. A4 to A11 are DNA or cDNA of PRRSV (CH-1R strain), PCV2 (LG strain), PRV (Bartha-K61 vaccine strain), CSFV (C vaccine strain), TGEV, PEDV, PORV (weakened Chinese strain + weakened CV777 strain + NX strain), and PPV (BJ-2 vaccine strain) for specificity evaluation.

[0030] Figure 2 : The establishment diagram of the standard curve of the triple q-PCR method, where the standard curve equation of the NADC30-like strain is y=-3.9145x+40.986; the standard curve equation of the NADC34-like strain is y=-3.6801x+40.439; the standard curve equation of the highly pathogenic strain is y=-3.6251x+38.376, and the correlation coefficient (R 2 ) are all greater than 0.99.

[0031] Figure 3 :The sensitivity test results of the triple q-PCR method, where 1-7 are pUC57-NADC30-ORF6 1.0×10 8 copies / μL~1.0×10 2 copies / μL; 8-14 for pUC57-NADC34-ORF5 1.0×10 8copies / μL~1.0×10 3 copies / μL; 15-21 for pUC57-HP-PRRSV-NSP2 1.0×10 8 copies / μL~1.0×10 2 copies / μL. DETAILED DESCRIPTION

[0032] The positive control plasmid used in the embodiment of the present invention is obtained by cloning the Nsp2 gene sequences of highly pathogenic strains, NADC30 strains, and NADC34 strains into pUC57 vectors according to the sequences in GenBank, transforming them into DH5α bacterial competent cells, extracting the recombinant plasmid, and sequencing and verifying them as plasmid standards for multiplex fluorescence quantitative PCR.

[0033] The sequence of the Nsp2 gene of the NADC30 strain is as follows: CCACCGCCGGATATTATCACAGGCGGT ATGTATTGAGTAGCATCTACGCTGTCTGTGCCCTGGCTGCGTTGATTTGCTTCGCCATTAGGTT GGCGAAAAATTGCATGTCCTGGCGCTACTCATGCACCAGATATACCAAT (SEQ ID NO: 1);

[0034] The sequence of the Nsp2 gene of the NADC34 strain is as follows: GGTTGTGCTTGCTAGGCCGCAAGTACA TTCTGGCCCCTGCCCACCACGTTGAAAGTGTCGCAGGCTTTCATCCGATAACGGCAAATGATAA CCACGCATTTGTCGTCCGGCGTCCCGGCTCCACTACGGTCAACGGCACACTGGTGCCCGGGTTG AAAAGCCTCGTGTTGGGTGGC (SEQ ID NO: 2);

[0035] The sequence of the Nsp2 gene of the highly pathogenic strain is as follows: GTGCCCGCGTCGCGACGTGTCCCCA AGCTGATGACACCTTTGAGTGGGTCGGCACCAGTTCCTGCACCGCGTAGAACTGTGACAACAAC GCTGACGCACCAGGATGAGCCTCTGGATTTGTCTGCGTCCTCACAGACGGAATATGAGGCTTTC CCCCTAGCACCATCG (SEQ ID NO: 3).

[0036] The corresponding plasmid standards were named pUC57-HP-PRRSV, pUC57-NADC30, and pUC57-NADC34. The OD260 value was measured by UV spectrophotometer, and the molar concentration was calculated according to the formula ([X (g / μL) DNA / DNA length (bp) × 660] × 6.02 × 1023 = Y (copies / μL)) and diluted to 10 8 copies / μL, stored at -20℃, diluted before use.

[0037] The present invention is further described with reference to the following examples and accompanying drawings.

[0038] Example 1: Design, screening and synthesis of primers and probes

[0039] The NSP2 gene sequences of highly pathogenic strains (EU860248, EF112445, and EU864233), ORF5 gene sequences of NADC30-like strains (MG847440.1, MG847427.1, and MG847426.1), and ORF5 gene sequences of NADC34-like strains (MN648057.1 and MN648056.1) were compared. Based on the conserved regions of these gene sequences, two sets of primers and probes were designed for each type of strain using Primer Plex software, and the concentrations of the primers and probes after synthesis were diluted to 10 μmol / L for use.

[0040] Table 1: Designed primers and probes

[0041]

[0042]

[0043] After designing primers and probes for detecting highly pathogenic strains, NADC30-like strains and NADC34-like strains, it is necessary to screen the primer-probe combinations to screen primer sets with similar amplification efficiencies, thereby avoiding mutual influence between primers, which may lead to low amplification efficiency of some primer sets and false negatives.

[0044] The primer and probe sequences designed in Table 1 were combined to obtain a total of 8 groups. ①: αⅠA; ②: αⅠB; ③: αⅡA; ④: αⅡB; ⑤: βⅠA; ⑥: βⅠB; ⑦: βⅡA; ⑧: βⅡB. Highly pathogenic strains, NADC30 strains, and NADC34 strain plasmid standards were selected as positive controls, and ddH2O was used as a negative control to verify the specificity and sensitivity of the 6 pairs of primer probes.

[0045] The results showed that all six pairs of primer probes could produce specific amplification for the corresponding strains, and had no amplification effect on other types of strains, and the negative controls were all established. It was proved that none of the six pairs of primers would have false negative results. Moreover, compared with the α and β primer probes, the amplification efficiency of α was better, and the amplification efficiency of β primer probe decreased in the combination, so the α primer probe group was selected for highly pathogenic strains. The amplification effect of Ⅰ and Ⅱ primer probes was good, but there was a phenomenon of amplification failure of some strains. Therefore, the 10th position of the upstream primer of group Ⅱ was changed to Y, and the 7th position of the downstream primer was changed to W, so more NADC30-like sequences could be amplified. Compared with the Ⅰ group probe primers, the Ⅱ group probe primers had higher amplification efficiency after optimization, so the Ⅱ primer probe group was selected for the NADC30-like strain. There was no significant difference in the single comparison between A and B primer probes. When used in combination, the amplification efficiency of B primer probe was better, so the B primer probe group was selected for the NADC34-like strain.

[0046] The final combination was determined to be ④: αⅡB. After the sequences of the final primer probes (see Table 2) were determined, they were handed over to Shanghai Sangon Biotechnology Co., Ltd. for synthesis.

[0047] Table 2: Primers and probes used in triple fluorescence quantitative PCR detection method

[0048]

[0049] Example 2: Construction of a detection kit and a detection method

[0050] The primer probe set screened in Example 1 is used to prepare a detection kit, the components of which are shown in Table 3.

[0051] Table 3: Kit composition

[0052]

[0053]

[0054] The vial (25T) contains 10 μL of upstream and downstream primers for highly pathogenic strains and 7.5 μL of probes; 7.5 μL of upstream and downstream primers for NADC30-like strains and 5 μL of probes; 10 μL of upstream and downstream primers for NADC30-like strains and 7.5 μL of probes. The concentrations of primers and probes are diluted to 10 μmol / L for use. The amplification enzyme uses 250 μL of the finished reverse transcriptase and amplification enzyme produced by Qingdao Batefel Technology Development Co., Ltd. The above components are combined to make a fluorescent RT-PCR Mix and freeze-dried, and reconstituted with water before use.

[0055] For the preparation of positive control, three plasmids (pUC57-HP-PRRSV, pUC57-NADC30, and pUC57-NADC34) were mixed into a 1.0×10 4copies / μL. Lyophilized.

[0056] The detection method of the provided kit comprises the following steps:

[0057] 1) Extracting total RNA from the sample to be tested;

[0058] 2) Preparation of amplification system

[0059] Reconstitution: Take 400μL of reconstitution buffer RB and add it to a bottle of fluorescent RT-PCR Mix (lyophilized) vial, and shake gently during reconstitution. The reconstituted reagents should be dispensed into PCR reaction tubes, 15μL per tube, and stored at -20℃ for future use to reduce repeated freezing and thawing.

[0060] How to use the positive control: The positive control is freeze-dried particles. After diluting each tube with 100 μL of PCR-grade water, take 5 μL directly as a control sample. Each tube can also be used as a sample for nucleic acid extraction and then take 5 μL for sample addition.

[0061] Preparation of amplification reagents: prepare the reconstituted test sample (15 μL) according to the number of samples to be tested; take 5 μL of the nucleic acid to be tested and finally take 5 μL of the positive control and add them to different PCR reaction tubes. After adding samples, the PCR reaction tubes should be tightly covered. The total volume in each tube is 20 μL.

[0062] 3) PCR reaction

[0063] After adding the sample, the PCR reaction tube was centrifuged instantly to remove bubbles, and then placed in a fluorescent PCR instrument. The reaction program was reverse transcription at 48°C for 10 minutes; pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 10 seconds, extension at 60°C for 30 seconds, for a total of 45 cycles. The fluorescence signals of the FAM, HEX, and ROX channels were collected.

[0064] After the test is completed, the test results are read. The threshold setting principle is that the threshold line just exceeds the highest point of the normal negative control amplification curve. Different instruments can be adjusted according to the instrument noise.

[0065] The testing standards are as follows:

[0066] 1. The negative control has no Ct value and no amplification curve.

[0067] Negative judgment has no Ct value or Ct value>40, and there is no specific amplification curve, indicating that the virus does not contain highly pathogenic strains, NADC30-like strains, and NADC34-like strains.

[0068] 2. The Ct value of the positive control should be less than 35, and a specific S-shaped amplification curve should appear.

[0069] Positive judgment: FAM channel Ct value <40, and a specific S-shaped amplification curve appears, indicating that the nucleic acid of the American NADC30-like virus is positive. HEX channel Ct value <40, and a specific S-shaped amplification curve appears, indicating that the nucleic acid of the American highly pathogenic strain virus is positive. ROX channel Ct value <40, and a specific S-shaped amplification curve appears, indicating that the nucleic acid of the American NADC34-like virus is positive.

[0070] 3) If the negative control and positive control do not meet the above conditions at the same time, the experiment will be considered invalid.

[0071] Example 3: Optimization of detection method

[0072] The recombinant plasmid was used as a template and the concentration of primers and probes was optimized by matrix method. The reaction system was 20 μL. The primers (10 μmol / L) were 0.2, 0.4 and 0.6 μL, the probes (10 μmol / L) were 0.1, 0.2 and 0.3 μL, the template was 5 μL, and RNase free d H2O was added to 20 μL. Four annealing temperatures were set at 56, 58, 60 and 62°C.

[0073] The results determined that the fluorescence quantitative PCR reaction system was: All-ready one-step RT-PCR Mix 10μL, including 0.3μmol / 20μL of upstream and downstream NADC30-like primers, and 0.2μmol / 20μL of probe; 0.4μmol / 20μL of upstream and downstream NADC34-like primers, and 0.3μmol / 20μL of probe; 0.4μmol / 20μL of upstream and downstream highly pathogenic strain primers, and 0.3μmol / 20μL of probe; 3μL / 20μL of ddH2O.

[0074] The concentration of primers and probes were diluted to 10 μmol / L before use. The mixed reagents were freeze-dried to prepare premixed freeze-dried reagents. The amplification program of PCR was 48°C reverse transcription for 10 min; 95°C pre-denaturation for 3 min; 95°C denaturation for 10 s, 60°C extension for 30 s, for a total of 45 cycles.

[0075] Example 4: Specificity Experiment

[0076] According to the detection method of Example 3, RNA of WUH5 strain, NADC34 strain and JXAI strain were used as positive controls, and ddH2O was used as negative control. DNA or cDNA of PRRSV (CH-1R strain), PCV2 (LG strain), PRV (Bartha-K61 vaccine strain), CSFV (C vaccine strain), TGEV, PEDV, PORV (weakened Chinese strain + weakened CV777 strain + NX strain), and PPV (BJ-2 vaccine strain) were used for specific evaluation.

[0077] The results showed that only three positive controls had amplification curves, while other samples did not show obvious fluorescence curves. The triple fluorescence quantitative PCR detection method has high specificity, no non-specific reaction, and the positive standard has a good reaction effect (see Figure 1 ).

[0078] Example 5: Drawing of standard curve and sensitivity test

[0079] 1.0×10 8 ~1.0×10 0 Use the NADC30-like, NADC34-like, and HP-PRRSV positive reference plasmids at 100 copies / μL as templates, add the corresponding primers and probes, and make up to 20 μL with dd H2O. Perform fluorescence quantitative PCR sensitivity tests on three different pathogens in the same reaction tube according to the optimal reaction system and optimal reaction procedure described in 1.4. Determine the minimum detection amount of this method. Draw a standard curve with the logarithm of the copy number as the horizontal and vertical scale and the corresponding Ct value as the vertical coordinate (see Figure 2 ).

[0080] From the test results of different dilution standards, it can be seen that the minimum amount of viral genes detected for highly pathogenic strains is 1.0×10 2 copies / μL; the minimum amount of viral genes detected for NADC30-like strains is 1.0×10 2 copies / μL; the minimum amount of viral genes detected for NADC34-like strains is 1.0×10 3 copies / μL. There is a good relationship between the ploidy amplification of the templates at each dilution (see Figure 3 ).

[0081] Example 6: Repeatability test

[0082] Select 1.0×10 6 ~1.0×10 4 The inter-group and intra-group repeatability tests were performed with NADC30-like, NADC34-like, and highly pathogenic strain positive reference plasmids at 100 copies / μL. ddH2O was used as a negative control, and the above detection method was used to repeat the test three times at different times to determine the repeatability of the detection method. The intra-group and inter-group coefficients of variation were calculated. Calculation formula: coefficient of variation (CV) = standard deviation SD / mean × 100%.

[0083] The results showed that the results of the three repeated tests were basically consistent. The intra-group coefficient of variation was less than 1%, and the inter-group coefficient of variation was less than 3%, indicating that the established triple fluorescence quantitative PCR method has good repeatability (see Table 4).

[0084] Table 4: Repeatability test results

[0085]

[0086]

[0087] Example 7: Clinical sample testing

[0088] For 30 inactivated clinical samples known to be PRRSV positive, identification primers (application number: 201610192662.2) were used, which can distinguish the NADC30 strain, NADC34 strain and HP-PRRSV strain by the length of the amplified fragment. The triple fluorescence quantitative PCR established in this study was then used for detection. The results are shown in Table 5.

[0089] Table 5: Clinical sample test results

[0090]

[0091] The above results show that the triple fluorescence quantitative PCR detection method established by the present invention is more sensitive than the common PCR method and is more suitable for clinical detection.

Claims

1. A triple fluorescent quantitative PCR detection primer pair and probe combination for detecting highly pathogenic strains of porcine reproductive and respiratory syndrome virus American type, American type NADC30 strains, and American type NADC34 strains, characterized in that: The primer pair and probe combination includes: 1) A primer pair and a probe for detecting highly pathogenic strains of the American type, wherein the sequence of the upstream primer is SEQ ID NO: 4, the sequence of the downstream primer is SEQ ID NO: 5, and the sequence of the probe is SEQ ID NO: 6; 2) A primer pair and a probe for detecting the American-type NADC30-like strain, wherein the sequence of the upstream primer is SEQ ID NO: 7, the sequence of the downstream primer is SEQ ID NO: 8, and the sequence of the probe is SEQ ID NO: 9; 3) A primer pair and a probe for detecting the American-type NADC34-like strain, wherein the sequence of the upstream primer is SEQ ID NO: 10, the sequence of the downstream primer is SEQ ID NO: 11, and the sequence of the probe is SEQ ID NO:

12.

2. The primer pair and probe combination according to claim 1, characterized in that: The 5' end of the probe for detecting highly pathogenic strains is connected to fluorescein HEX, and the 3' end is connected to a fluorescence quencher BHQ1.

3. The primer pair and probe combination according to claim 1, characterized in that: The 5' end of the probe for detecting NADC30 is connected to the fluorescein FAM, and the 3' end is connected to the fluorescence quencher BHQ1.

4. The primer pair and probe combination according to claim 1, characterized in that: The 5' end of the probe for detecting NADC34 is connected to the fluorescein ROX, and the 3' end is connected to the fluorescence quencher BHQ2.

5. A multiplex fluorescence quantitative PCR detection kit, characterized in that: The kit comprises the primer pair and probe combination according to claim 1.

Images