Yarrowia lipolytica genetically engineered bacterium with high yield of retinol and application thereof

Abstract

The invention belongs to the technical field of genetic engineering and fermentation engineering, discloses a yarrowia lipolytica genetically engineered bacterium capable of realizing high yield of retinol and application of the yarrowia lipolytica genetically engineered bacterium, and particularly discloses a yarrowia lipolytica genetically engineered bacterium capable of realizing high yield of retinol. In the engineering strain, hyphae gene and lipid peroxidation gene knockout is carried out to construct a retinol synthesis pathway, and / or strengthen a yarrowia lipolytica endogenous mevalonic acid pathway, and / or strengthen key gene expression of a yarrowia lipolytica exogenous carotenoid synthesis pathway at the same time, so that high yield of retinol can be effectively realized.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and fermentation engineering, and specifically relates to a genetically engineered Yarrowia lipolytica bacteria with high retinol production and application thereof. Background Art

[0002] Vitamin A is a fat-soluble vitamin, known as the "beauty vitamin" and "anti-dry eye vitamin", and is widely used in feed, pharmaceutical cosmetics and food. The biologically active forms are retinol, retinal and retinoic acid, which can be converted into each other in the body. In terms of physiological function, retinol and retinal can maintain normal vision, promote the formation of photosensitive pigments in visual cells, adjust the ability of the eyes to adapt to the intensity of external light, reduce the occurrence of night blindness and vision loss, and help treat a variety of eye diseases (such as dry eyes and conjunctivitis, etc.); retinol also has similar effects to steroid hormones, which can promote the synthesis of glycoproteins, promote body growth and development, strengthen bones, and maintain the health of hair, teeth and gums; retinoic acid can regulate gene expression, weaken the differentiation of epithelial cells into scales, increase the number of epithelial growth factors, and maintain the integrity and soundness of the epithelium; vitamin A also has a certain antioxidant effect and can remove some harmful free radicals. In the human body, vitamin A is stored in the liver in the form of palmitate, linoleate or oleate.

[0003] Vitamin A can be extracted from animal tissues, but the process is cumbersome, the extraction rate is low, and the cost is high. Currently, commercial vitamin A is chemically synthesized. The synthesis methods are divided into Roche method and BASF method, both of which use citral as an intermediate. Citral is controlled by international vitamin intermediate suppliers such as BASF and Daiichi Pharmaceutical. In addition, the chemical synthesis method has high energy consumption and requires complex purification steps and is prone to produce toxic isomers and a series of pollutants. Microorganisms convert renewable biological resources such as sugars into vitamin A. Mild reaction conditions and strong selectivity enable it to achieve green and clean production, which can get rid of dependence on petroleum resources.

[0004] Yarrowia lipolytica is a well-recognized safe aerobic oleaginous yeast, commonly found in high-fat and high-protein substances such as cheese, dairy products and meat sausages. It can grow in a wide range of salt concentrations and pH values, has a large number of liposomes in the cell, and lipid accumulation can be as high as 70% of the cell dry weight, which can provide sufficient storage space for lipophilic products such as terpenoids. It also has an endogenous mevalonate pathway, which can synthesize geranyl pyrophosphate GGPP, a key precursor of carotenoids, and has a huge acetyl-CoA pool and a high-flow TCA cycle in the cytoplasm, which can provide a large amount of precursors, ATP and reducing power NADPH for the synthesis of terpenoids. It has no alcohol fermentation production pathway and is an ideal strain for the production of terpenoids such as β-carotene. In organisms, β-carotene can be cleaved into two molecules of retinal by enzymes such as monooxygenase Blh, and then reversed into retinol by retinol dehydrogenase or desaturase or other alcohol dehydrogenases.

[0005] The biggest bottleneck of microbial fermentation for producing vitamin A is how to increase the yield to reach the industrial level. Although there are many reports on the use of genetically modified microbial engineering bacteria to synthesize vitamin A, there are few reports on the modification of Yarrowia lipolytica to produce vitamin A. In addition, the only reports on the production of vitamin A by Yarrowia lipolytica only strengthen the gene expression of the metabolic pathway from acetyl-CoA to mevalonate to vitamin A, without considering the selection of rate-limiting enzymes related to the synthesis pathway of exogenous carotenoids, the effects of mycelium and oil accumulation on vitamin A production, resulting in the inability to break through the yield to meet the requirements of industrial production. The present invention aims to construct a strain that efficiently produces retinol through a biosynthetic method, making it more valuable for industrialization. Summary of the invention

[0006] The present invention aims to provide a high-yield retinol-producing Yarrowia lipolytica engineered bacterium and its application, in view of the defects of the prior art such as low activity of the rate-limiting enzymes in the carotenoid synthesis pathway, easy mycelium formation of the host, and easy oxidation and degradation of oils, etc., wherein the engineered bacterium contains genes related to the β-carotene synthesis pathway and genes related to the cleavage of β-carotene into retinal; and genes related to mycelium formation and lipid β-oxidation are knocked out. It can effectively achieve high retinol production (see the synthesis pathway of retinol for details) Figure 1 ).

[0007] The first aspect of the present invention aims to provide a genetically engineered Yarrowia lipolytica strain capable of achieving high production of retinol.

[0008] The second aspect of the present invention aims to provide a sgRNA.

[0009] The third aspect of the present invention is to provide a method for preparing retinol.

[0010] The fourth aspect of the present invention aims to provide the application of the genetically engineered Yarrowia lipolytica of the first aspect of the present invention in the fields of food, chemical industry or pharmaceuticals.

[0011] In order to achieve the above object, the technical solution adopted by the present invention is:

[0012] In a first aspect of the present invention, a genetically engineered strain of Yarrowia lipolytica that can achieve high retinol production is provided. The genetically engineered strain uses Yarrowia lipolytica as a starting strain, and the mycelialization gene and lipid peroxidation gene are knocked out in the engineered strain to construct a retinol synthesis pathway, and / or strengthen the endogenous mevalonate pathway of Yarrowia lipolytica, and / or simultaneously strengthen the expression of key genes in the exogenous carotenoid synthesis pathway of Yarrowia lipolytica.

[0013] In some embodiments of the present invention, the knocked-out mycelialization-related gene is MYH1 and the lipid β-oxidation-related gene is ALL8

[0014] In some embodiments of the present invention, the retinol biosynthesis pathway-related genes constructed in yeast cells include the β-carotene 15,15'-monooxygenase gene Blh, and the optimized sequence of the Blh gene is shown in SEQ ID NO:59.

[0015] In some embodiments of the present invention, the endogenous mevalonate pathway-related genes constructed in yeast cells include one or more of the gene AtoB (CP001509.3: 2216470-2217654) that catalyzes the condensation of acetyl-CoA to acetoacetyl-CoA, the gene HMGS (CP028459.1: 3780129-3781469) that catalyzes the condensation of acetoacetyl-CoA and acetyl-CoA to HMG-CoA, and the gene HMGR (CP028452.1: 571078-572577) that catalyzes the reduction of HMG-CoA to mevalonate.

[0016] In some embodiments of the present invention, the carotene synthesis pathway-related genes constructed in the yeast cell include: gene ERG12 (CP028449.1: 2082357-2083706) that catalyzes the phosphorylation of mevalonate to mevalonate-5-phosphate, gene ERG8 (CP028452.1: 748052-746796) that catalyzes the generation of mevalonate-5-pyrophosphate, gene ERG19 (CP028453.1: 818770-819933) that catalyzes the decarboxylation of mevalonate-5-pyrophosphate to generate isoprene pyrophosphate, and gene IDI (CP028454.1: 818771-819933) that catalyzes the isomerization of isoprene pyrophosphate to dimethylallyl pyrophosphate. 8453.1:585662-584850), ERG20 (CP028452.1:673068-672034), GGS1 (CP028451.1:2085775-2084792), CarB (CarB), a gene that catalyzes the dehydrogenation of exogenous lycopene to produce lycopene, CarRP (CarB), a gene that catalyzes two molecules of digeranyl pyrophosphate to produce lycopene, and wherein the optimized sequence of CarB gene is shown in SEQ ID NO:57, and the optimized sequence of CarRP gene is shown in SEQ ID NO:58.

[0017] In some embodiments of the present invention, the genetically engineered bacteria uses Yarrowia lipolytica ZTQ5320 (disclosed in invention patent with authorization number ZL202011341160.4 and deposit number CCTCC NO: M2020606) as the starting strain.

[0018] In some embodiments of the present invention, the gene Blh is derived from the marine bacterium 66A03; the genes CarB and CarRP are derived from Rhizomucor circinelloides.

[0019] In some embodiments of the present invention, the Blh is derived from the marine bacterium 66A03.

[0020] In some embodiments of the present invention, the AtoB is derived from Escherichia coli BL21 (DE3).

[0021] In some embodiments of the present invention, the HMGS, tHMGR, ERG12, ERG8, ERG19, ERG20 and GGS1 are derived from Yarrowia lipolytica polf.

[0022] In some embodiments of the present invention, in order to ensure that each gene can be efficiently expressed in the recombinant plasmid, a promoter sequence is connected upstream of each gene, and a terminator sequence is connected downstream.

[0023] In some embodiments of the present invention, the promoter sequence includes but is not limited to: pTEF, pEXP, pFBA and pGPD.

[0024] In some embodiments of the present invention, the terminator sequence includes but is not limited to: tICL, tLIP, tIDI, tXPR2, tCYC1, mig1t.

[0025] In some embodiments of the present invention, the sgRNA with a nucleotide sequence such as SEQ ID NO: 1 or SEQ ID NO: 2 is used to knock out the gene of Yarrowia lipolytica ZTQ5320, that is, the Yarrowia lipolytica ZTQ5320ΔALL8ΔMYH1 with double knockout of ALL8 and MYH1 genes is obtained.

[0026] In a second aspect, the present invention provides an sgRNA, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0027] In some embodiments of the present invention, the sgRNA shown in SEQ ID NO: 1 targets and knocks out the ALL8 gene.

[0028] In some embodiments of the present invention, the sgRNA shown in SEQ ID NO: 2 targets and knocks out the MHY1 gene.

[0029] The third aspect of the present invention provides a method for preparing retinol, comprising inoculating the genetically engineered Yarrowia lipolytica of the first aspect of the present invention into a culture medium for fermentation.

[0030] In some embodiments of the present invention, the method comprises the following steps:

[0031] Cultivation of primary seed solution;

[0032] Cultivation of secondary seed solution;

[0033] Fermentation tank culture.

[0034] More specifically, the method comprises the following steps:

[0035] Cultivation of primary seed solution: inoculate a single colony of the recombinant strain on the solid YPD plate into a conical flask containing a liquid culture medium, culture at 28-32°C and a shaking speed of 180-200 rpm for 24-50 hours to obtain a primary seed solution.

[0036] Cultivation of secondary seed solution: transfer the primary seed solution to a conical flask containing liquid culture medium at a 1% to 5% (v / v) inoculation volume, and culture at 28 to 32°C with a shaking speed of 180 to 200 rpm until OD 600 When it reaches 10, the secondary seed liquid is obtained.

[0037] Fermentation in a fermenter: The secondary seed solution is transferred to a fermentation tank containing a fermentation medium at an inoculation rate of 7% to 10% (wt) for fermentation. The fermentation is carried out at a fermentation temperature of 28 to 32° C., a stirring speed of 300 to 800 rpm, a ventilation volume of 2 to 5 L / min, a pH of 6.5 to 7.0, and a dissolved oxygen content of more than 25%. After culturing for 10 to 13 hours, the fermentation is continued with 60% glucose stock solution and dodecane for 260 to 300 hours.

[0038] In some embodiments of the present invention, the components of the seed culture medium include: 10 g / L yeast extract, 20 g / L peptone and 60 g / L glucose.

[0039] In some embodiments of the present invention, the fermentation tank culture medium comprises: 30 g / L yeast extract, 60 g / L peptone and 100 g / L glucose.

[0040] In some embodiments of the present invention, dodecane is added to the fermentation medium, and the volume ratio of the medium to dodecane is 1:10 to 1:1. The product retinol is a lipophilic substance, and excessive accumulation is toxic to cells. The intracellular retinol will be extracted into dodecane, which is conducive to the continuous synthesis, secretion and accumulation of the product.

[0041] The fourth aspect of the present invention provides the use of the engineered Yarrowia lipolytica of the first aspect of the present invention in the fields of food, chemical industry or pharmaceuticals.

[0042] The beneficial effects of the present invention are:

[0043] The invention provides a genetic engineering bacterium for improving the high yield of retinol and a construction method thereof. The construction method is to use the patented strain Yarrowia lipolytica (preservation number CCTCC NO: M2020606) with the authorization number of 113151340 as the starting yeast, integrate the exogenous gene CarB for catalyzing the dehydrogenation of lycopene to generate lycopene, the gene CarRP for catalyzing two molecules of digeranyl pyrophosphate to generate lycopene and the gene encoding β-carotene 15,15'-monooxygenase BCMO into the yeast genome, and overexpress the acetyl-CoA synthetase gene AtoB, the HMG-CoA synthetase gene HMGS, and the HMG-CoA reductase gene tHMGR in the mevalonate pathway. Overexpression of the endogenous carotenoid biosynthesis pathway includes the gene ERG12 that catalyzes the phosphorylation of mevalonate to mevalonate-5-phosphate, the gene ERG8 that catalyzes the generation of mevalonate-5-pyrophosphate, the gene ERG19 that catalyzes the decarboxylation of mevalonate-5-pyrophosphate to generate isoprene pyrophosphate, the gene IDI that catalyzes the isomerization of isoprene pyrophosphate to dimethylallyl pyrophosphate, the gene ERG20 that catalyzes the generation of farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate, and the gene GGS1 that catalyzes the generation of digeranyl pyrophosphate from farnesyl pyrophosphate. Knockout of the mycelialization gene MHY1 and the lipid oxidation gene ALL8. The retinol yield in a 5L fermenter reached 6g / L, which can significantly achieve high retinol production. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a diagram of the synthesis pathway of retinol.

[0045] Figure 2 This is a microscopic comparison of the ΔMYH1 single mutant (right picture) and the original bacteria (left picture).

[0046] Figure 3 This is a microscopic comparison of the ΔMYH1ΔALL8 double mutant (right picture) and the single mutant ΔMYH1 (left picture).

[0047] Figure 4 This is the p-Z1 plasmid map.

[0048] Figure 5 This is the p-Z2 plasmid map.

[0049] Figure 6 This is the plasmid map of pZ25B. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below through specific examples.

[0051] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0052] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0053] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0054] The starting strain of Yarrowia lipolytica is the strain of the invention patent with authorization number ZL202011341160.4, which was deposited in CCTCC-China Center for Type Culture Collection on October 19, 2020; address: Wuhan University, Wuhan, China (Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Postal Code: 430072), the deposit number is CCTCC NO: M2020606, and the classification name is Yarrowia lipolytica ZTQ5320 (Yarrowia lipolytica ZTQ5320).

[0055] The kits used for plasmid extraction and gel recovery were purchased from OMEGA, USA.

[0056] Plasmids pUC19URA3, pUC19TRP1, pUC19LEU2, pCAS1yl, Y-Cre, reagents used for PCR and Gibson ligation, and Escherichia coli (DH5α) for molecular cloning were purchased from Nanjing Novozymes Biotechnology Co., Ltd. The operation steps were carried out according to the product instructions, and gene and primer synthesis was entrusted to Beijing Qingke Biotechnology Co., Ltd.

[0057] Retinol extractant: Acetone was used to extract intracellular products, and dodecane was used to extract extracellular products.

[0058] Fermentation broth treatment: Take 1mL of yeast broth fermented for 7 days and centrifuge at 12000r / min for 10min. Take the supernatant and pass it through the membrane with dodecane and put it in a liquid phase bottle for determination of extracellular products. Collect the bacteria after centrifugation, resuspend and centrifuge twice with the same volume of sterile ultrapure water as the fermentation broth, and resuspend the precipitate in 0.7mL DMSO. Incubate at 55℃ for 10min, then add 0.7mL of acetone of the same volume. Incubate at 50℃ for 15min, centrifuge at 12000rpm for 5min. Transfer the supernatant to a new EP tube.

[0059] HPLC detection of vitamin A production: Agilent ZORBAX EclipseXDB-C18 separation column (5 μm, 250×4.6 mm) was used, the detection temperature was 40°C, the mobile phase used methanol:acetonitrile = 95:5, the flow rate was 1 mL / min, the detection wavelength was 325 nm, and the injection volume was 10 μL.

[0060] Detection of strain growth: Use a UV-visible spectrophotometer to regularly measure the absorbance value of the fermentation liquid.

[0061] Example 1 Gene knockout

[0062] Two target sequences ALL8-target sequence (TACTTGTGGTACAGCT GGGC, SEQ ID NO: 1) and MYH1-target sequence (GTGAGATGGAAACGGCGTCC, SEQ ID NO: 2) were constructed into the plasmid pCAS1yl, and the knockout plasmids were sequentially transformed into the Yarrowia lipolytica strain (accession number: CCTCC NO: M2020606) by lithium acetate transformation method. After transformation, all the bacterial liquid was added to SD-Leu liquid culture medium, cultured at 30°C, 220rpm shaking for 3 days, 100 μL was spread on YPD plates, cultured at 30°C for 2 days, and sequenced to verify whether the gene knockout was achieved.

[0063] Sequencing revealed two gene shift mutations in the strain, achieving gene knockout, and repeated culture without sterile filamentation and accumulation of a large amount of lipids in the cells ( Figure 2 and Figure 3 ), that is, a Yarrowia lipolytica strain with double knockout of ALL8 and MYH1 genes was obtained, which was recorded as yeast strain ZTQ5320ΔALL8ΔMYH1.

[0064] Example 2 Vector Construction

[0065] This example is used to construct plasmid p-Z1, plasmid p-Z2 and plasmid pZ25B.

[0066] Plasmid p-Z1 uses pUC19 URA3 as a backbone vector, contains AtoB, HMGS, ERG12 and HMGR genes, promoters are pEXP, pFBA, pGPD and pTEF, and terminators are tICL, tLIP, tXPR2 and CYC1. The sequence of plasmid p-Z1 without the backbone vector is shown in SEQ ID NO: 57, and the plasmid map is shown in the attached Figure 4 shown.

[0067] Plasmid p-Z2 uses pUC19 TRP1 as the backbone vector, contains the nutritional label TRP1, ERG19, ERG8, ERG20 and IDI genes, the promoters are pGPD pTEF, pEXP and pFBA, and the terminators are tXPR2, CYC1, tICL and tLIP. The sequence of p-Z2 without the backbone vector is shown in SEQ ID NO:58, and the plasmid map is shown in the attached Figure 5 shown.

[0068] Plasmid pZ25B uses pUC19 LEU2 as the backbone vector, contains CarB (SEQ ID NO: 60), CarRP (SEQ ID NO: 61), GGS1, Blh (SEQ ID NO: 62) and ERG20 genes, promoters are pEXP, pTEF, pFBA, pTEF and pGPD, and terminators are tICL, CYC1, tLIP, mig1t and tXPR2. The sequence of pZ25B without the backbone vector is shown in SEQ ID NO: 59, and the plasmid map is shown in the attached Figure 6 shown.

[0069] Primers were designed to clone the above genes, and the primer sequences are shown in Table 1.

[0070] Table 1 Primer sequences

[0071]

[0072]

[0073]

[0074] Specifically, plasmid p-Z1 was constructed

[0075] Use primers pUC19-pEXP-F / pEXP-R, pFBA-F / pFBA-R, pGPD-F / pGPD-R, pTEF-F / pTEF-R, tICL-F / pFBA-tICL-R, tLIP-F / pGPD respectively. -tLIP-R, tXPR2-F / pTEF-tXPR2-R, pFBA-HMGS-F / tLIP-HMGS-R, pGPD-ERG12-F / tXPR2-ERG12-R and pTEF-HMGR-F / CYC1- HMGR-R used the genomic DNA of Yarrowia lipolytica Polf as a template to amplify the pEXP, pFBA, pGPD, pTEF, tICL, tLIP, tXPR2, ERG12, HMGR and HMGS fragments; the primers CYC1-F / pUC19-CYC1-R used the genomic DNA of Saccharomyces cerevisiae CEN.PK2-1C as a template to amplify the CYC1 fragment; the primers pEXP-AtoB-F / tICL-AtoB-R used the genomic DNA of Escherichia coli BL21 (DE3) as a template to amplify the AtoB fragment.

[0076] The promoter, gene and terminator were spliced ​​into four expression cassettes, pEXP-AtoB-tICL, pFBA-HMGS-tLIP, pGPD-ERG12-tXPR2 and pTEF-HMGR-CYC1, by overlap PCR. The plasmid backbone pUC19URA3 was purified and recovered by double restriction digestion with BamHⅠ and HindⅢ. Then, the restriction-digested plasmid backbone and the four expression cassettes were assembled by Gibson ligation (ClonExpress Ultra One Step Cloning Kit) to obtain plasmid p-Z1.

[0077] Construction of plasmid p-Z2

[0078] Use primers pUC19-pGPD-F / pGPD-R, pTEF-F / pTEF-R, pEXP-F / pEXP-R, pFBA-F / pFBA-R, tXPR2-F / pTEF-tXPR2-R, tI respectively. CL-F / pFBA-tICL-R, tLIP-F / pUC19-tLIP-R, pGPD-ERG19-F / tXPR2-ERG19-R, pTEF-ERG8-F / CYC1-ERG8-R, pE XP-ERG20-F / tICL-ERG20-R, pFBA-IDI-F / tLIP-IDI-R, used the Yarrowia lipolytica Polf genomic DNA as template to amplify the pGPD, pTEF, pEXP, pFBA, tXPR2, tICL, tLIP, ERG19, ERG8, ERG20 and IDI fragments; primers CYC1-F / pEXP-CYC1-R were used to amplify the CYC1 fragment using the Saccharomyces cerevisiae CEN.PK2-1C genomic DNA as a template.

[0079] The promoter, gene and terminator were spliced ​​into four expression cassettes, pGPD-ERG19-tXPR2, pTEF-ERG8-CYC1pEXP-ERG20-tICL and pFBA-IDI-tLIP, by overlap PCR. The plasmid backbone pUC19TRP1 was purified and recovered by double restriction digestion with BamHⅠ and HindⅢ. Then, the restriction-digested plasmid backbone and the four expression cassettes were assembled by Gibson ligation (ClonExpress Ultra One Step Cloning Kit) to construct the plasmid p-Z2.

[0080] Construction of plasmid pZ25B

[0081] Use primers pUC19-pTEF-F / pTEF-R, pEXP-F / pEXP-R, pFBA-F / pFBA-R, pGPD-F / pGPD-R, tICL-F / pTEF-tICL-R, mi respectively. g1t-F / pGPD-mig1t-R, CYC1-F / pFBA-CYC1-R, tLIP-F / pEXP-tLIP-R, tXPR2-F / pUC19-tXPR2-R, pFBA-GGS1 -F / tLIP-GGS1-R, pGPD-ERG20-F / tXPR2-ERG20-R used the genomic DNA of Yarrowia lipolytica Polf as template to amplify the pTEF, pEXP, pFBA, pGPD, tICL, mig1t, CYC1, tLIP, tXPR2, GGS1 and ERG20 fragments; primers CYC1-F / pEXP-CYC1-R were used to amplify the CYC1 fragment using the genomic DNA of Saccharomyces cerevisiae CEN.PK2-1C as template. The CarB gene and CarRP gene derived from Mucor circinelloides were synthesized by Beijing Qingke Biotechnology Co., Ltd. after codon optimization, and the CarB and CarRP fragments were amplified using primers pEXP-CarB-F / tICL-CarB-R and pTEF-CarRP-F / CYC1-CarRP-R, respectively; the Blh gene derived from the marine bacterium 66A03 was synthesized by Beijing Qingke Biotechnology Co., Ltd. after codon optimization, and the synthesized gene was amplified using primers pTEF-Blh-F / mig1t-Blh-R, respectively.

[0082] The promoter, gene and terminator were spliced ​​into five expression cassettes, pTEF-CarRP-CYC1, pEXP-CarB-tICL, pFBA-GGS1-tLIP, pTEF-Blh-mig1t and pGPD-ERG20-tXPR2, by overlap PCR. The plasmid backbone pUC19LEU2 was purified and recovered by double restriction digestion with BamHⅠ and HindⅢ. The restriction-digested plasmid backbone and the five expression cassettes were assembled by Gibson ligation (ClonExpressUltra One Step Cloning Kit) to obtain the plasmid pZ25B.

[0083] Example 3 Construction of a high-yield retinol recombinant strain

[0084] The recombinant engineered bacteria randomly integrate plasmid p-Z1, plasmid p-Z2 and plasmid pZ25B into the Yarrowia lipolytica genome by non-homologous recombination. It can be understood by those skilled in the art that the insertion into the genome of the cell by non-homologous recombinant biological means is to obtain more strains that are likely to be stably inherited, and only transforming the above expression system can also achieve the purpose of the present invention. Compared with the method of fixed-site insertion, non-homologous recombination has a probability of obtaining more efficient recombinant cells or recombinant bacteria that are inserted multiple times, thereby further improving the production efficiency of recombinant cells or recombinant bacteria.

[0085] The specific steps include:

[0086] The recombinant plasmids p-Z1, p-Z2 and pZ25B were linearized by cutting out the original pUC19 backbone part with NotⅠ and then introduced into the yeast strain ZTQ5320ΔALL8ΔMYH1 obtained in Example 1 by the lithium acetate method, spread on SD-URE-LEU-TRP plates, and cultured for 3 days. The orange-yellow colonies were picked and cultured on YPD medium for 3 days. The strain with the highest retinol content was detected to complete the first round of recombination.

[0087] The circular plasmid Y-Cre expressing Cre enzyme was introduced to remove the URA3, TRP1 and LEU2 screening tag genes to restore the screening markers of the first-generation retinol-producing engineering strain, and then the linearized plasmid p-Z1, plasmid p-Z2 and plasmid pZ25B plasmids were introduced again and high-yield retinol was screened to complete the second round of recombination iterations. The high-yield retinol recombinant strain was screened and recorded as genetically engineered bacteria C1322-3.

[0088] Example 4 Industrial fermentation test

[0089] The genetically engineered bacteria C1322-3 obtained in Example 3 was subjected to high-density fermentation in a 5 L fermentation tank, and the unit yield of retinol was detected.

[0090] The fermentation method comprises the following steps:

[0091] Cultivation of primary seed solution: A single colony of the recombinant strain C1322-3 on a solid YPD plate was inoculated into a 30 ml conical flask containing 10 ml YPD liquid culture medium and cultured at 30°C and a shaking speed of 200 rpm for 48 hours.

[0092] The obtained primary seed solution was transferred to a 300 mL conical flask containing 100 mL YPD liquid culture medium at a 1% (wt) inoculation rate, and cultured at 30°C, with a shaker speed of 200 rpm for 18 h until the cell OD600 reached 10 to obtain the secondary seed solution.

[0093] The secondary seed liquid was transferred to a 5L fermentation tank containing 1L fermentation medium at an inoculation rate of 10% (wt) for fermentation. The initial medium composition was 30g / L yeast extract, 60g / L peptone and 100g / L glucose. The fermentation temperature was 30°C, the stirring speed was 300-800rpm, the ventilation volume was 2L / min, the pH value was 6.8 and the dissolved oxygen content was more than 25%. After 12h of cultivation, the fed-batch fermentation was continued with 60% glucose stock solution and dodecane for 264 hours.

[0094] The highest retinol yield in C1322-3 reached 6g / L, which is the highest yield reported in the current biological production of retinol.

[0095] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A genetically engineered strain of Yarrowia lipolytica capable of achieving high production of retinol, characterized in that: The genetically engineered bacteria uses Yarrowia lipolytica as a starting strain, and knocks out mycelialization genes and lipid peroxidation genes in the engineered strain to construct a retinol synthesis pathway, and / or strengthen the endogenous mevalonate pathway of Yarrowia lipolytica, and / or simultaneously strengthen the expression of key genes in the exogenous carotenoid synthesis pathway of Yarrowia lipolytica.

2. The genetically engineered Yarrowia lipolytica according to claim 1, characterized in that The knocked-out mycelium-related gene is MYH1 and the knocked-out lipid β-oxidation-related gene is ALL8.

3. The genetically engineered Yarrowia lipolytica according to claim 1, characterized in that The retinol synthesis pathway-related genes constructed in the yeast cell include the β-carotene 15,15'-monooxygenase gene Blh, and the optimized sequence of the Blh gene is shown in SEQ ID NO:

59.

4. The genetically engineered Yarrowia lipolytica according to claim 1, characterized in that The endogenous mevalonate pathway-related genes constructed in the yeast cell include one or more of the gene AtoB that catalyzes the condensation of acetyl-CoA to acetoacetyl-CoA, the gene HMGS that catalyzes the condensation of acetoacetyl-CoA and acetyl-CoA to HMG-CoA, and the gene HMGR that catalyzes the reduction of HMG-CoA to mevalonate.

5. The genetically engineered Yarrowia lipolytica according to claim 1, characterized in that The carotene synthesis pathway related genes constructed in the yeast cell include: gene ERG12 that catalyzes the phosphorylation of mevalonate to mevalonate-5-phosphate, gene ERG8 that catalyzes mevalonate-5-phosphate to generate mevalonate-5-pyrophosphate, gene ERG19 that catalyzes the decarboxylation of mevalonate-5-pyrophosphate to generate isoprene pyrophosphate, gene IDI that catalyzes the isomerization of isoprene pyrophosphate to dimethylallyl pyrophosphate, gene ERG20 that catalyzes isopentenyl pyrophosphate and dimethylallyl pyrophosphate to generate farnesyl pyrophosphate, gene GGS1 that catalyzes the combination of farnesyl pyrophosphate with a molecule of isoprene pyrophosphate to generate digeranyl pyrophosphate, gene CarB that catalyzes the dehydrogenation of exogenous lycopene to generate lycopene, gene CarRP that catalyzes two molecules of digeranyl pyrophosphate to generate lycopene, and gene CarRP that catalyzes the cyclization of lycopene to generate β-carotene, wherein the optimized sequence of the CarB gene is shown in SEQ ID NO: 57, and the optimized sequence of the CarRP gene is shown in SEQ ID NO: Shown in NO:

58.

6. The engineered Yarrowia lipolytica according to any one of claims 1 to 5, characterized in that The genetically engineered bacteria uses Yarrowia lipolytica ZTQ5320 as a starting strain.

7. The engineered Yarrowia lipolytica according to claims 3 and 5, characterized in that: The gene Blh is derived from the marine bacterium 66A03; the genes CarB and CarRP are derived from Rhizomucor circinelloides.

8. An sgRNA, the nucleotide sequence of which is shown in SEQ ID NO: 1 or SEQ ID NO:

2.

9. A method for producing retinol, comprising inoculating the recombinant engineered bacteria according to claims 2-6 into a culture medium for fermentation and extracting retinol.

10. Use of the engineered Yarrowia lipolytica according to any one of claims 1 to 6 in the fields of food, chemical industry or pharmaceuticals.

Images