Tomato late blight resistant gene SlLRR-RLK95 as well as cloning method and application thereof

Abstract

The invention provides a tomato late blight resistant gene SlLRR-RLK95. The nucleotide sequence of the tomato late blight resistant gene SlLRR-RLK95 is as shown in SEQ ID NO. 1; the invention provides a cloning method and application of the SlLRR-RLK95 gene. The cloning method of the SlLRR-RLK95 gene comprises the following steps: carrying out amplification by using a PCR (Polymerase Chain Reaction) technology by taking a genome of a wild tomato early pollination No.2 as a template; the method comprises the following steps of: connecting an amplified and purified PCR (Polymerase Chain Reaction) product with a pBI121 plant vector, transforming the constructed pBI121-SlLRR-RLK95 into escherichia coli DH5alpha, selecting a single colony, shaking bacteria, extracting plasmids, and sequencing; the invention further provides an application method of the gene, overexpression of the SlLRR-RLK95 can positively regulate and control SA-related disease resistance related genes in tomatoes, and the gene is used for improving the disease resistance of tomato plants. The resistance of the tomato to the late blight is enhanced through transient overexpression of the SlLRR-RLK95 gene, and the gene has important significance in cultivation of tomato varieties resisting the late blight and protection of the tomato industry.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and more specifically to a tomato late blight resistance gene S1LRR-RLK95 and a cloning method and application thereof. Background Art

[0002] As a common herb, tomato contains a variety of nutrients. It can be eaten as both a vegetable and a fruit and is widely grown around the world. Late blight caused by Phytophthora infestans (P. infestans) is considered a devastating disease in tomato agricultural production. Once it occurs, it will cause huge economic losses. At present, late blight is commonly controlled by spraying pesticides, but this method has certain disadvantages, which will lead to problems such as pesticide abuse and environmental pollution, and has a serious impact on tomato agricultural production. Therefore, through the study of the molecular mechanism of the interaction between tomatoes and Phytophthora infestans, the key disease-resistant genes are discovered using molecular biological methods, and resistant varieties are cultivated through genetic engineering, which has become an important means of late blight control and can effectively prevent and control the occurrence of tomato late blight.

[0003] As sessile organisms, plants are often threatened by adverse external environments. Therefore, plants have evolved various mechanisms to cope with external stresses by sensing and responding to different exogenous or endogenous signal molecules. Plants can perceive adverse external signals by recognizing microbial-related molecules, thereby initiating a variety of immune responses. The recognition of pathogen (or microbe)-associated molecular patterns (PAMPs or MAMPs) by pattern recognition receptors (PRRs) on the cell membrane can trigger pattern-triggered immune responses (PTI). In the PTI process, receptor-like kinases (RLKs) can act as PRRs to bind to co-receptors, receive signals in the early stages, and quickly activate multiple downstream responses, including Ca 2+ influx, reactive oxygen species burst, mitogen-activated protein kinase (MAPK) cascade activation, calcium-dependent protein kinase (CDPK) activation, induced expression of defense genes and biosynthesis of defensive plant hormones.

[0004] LRR-RLKs are the largest class of RLKs, mainly containing three domains: an extracellular domain (ECD) containing multiple LRR tandem repeats, a transmembrane domain (TM), and a relatively conserved intracellular kinase domain (KD), where LRR is a domain containing a sequence of 20-30 amino acid residues that provides a structural framework for ligand recognition. LRR-RLKs can be divided into 14 groups (I-XIV) based on the structure of LRR in their ECD, among which LRR II, III, VI, IX, X, XI, XII and XIII subgroups usually have paired cysteine ​​residues (CxnWxGVt / sC) at the amino terminus of the LRR motif, because cysteine ​​residues can form disulfide bonds, which are essential for the folding, stability and tertiary structure of mature proteins. LRR-RLKs can be divided into two categories based on the length of ECD: those with a length of more than 400 amino acids are defined as receptors, which can directly recognize ligands and cause autophosphorylation or dephosphorylation of the intracellular kinase domain; those with a length of no more than 400 amino acids are defined as co-receptors, which assist ligands in binding to receptors and can form multimers with receptors to stabilize and enhance intracellular signal transduction through phosphorylation or dephosphorylation.

[0005] LRR-RLKs play an important role in plant growth and development, stress response and signal transduction. The rice LRR-RLK gene XIK1 is upregulated by Xanthomonas infection and positively regulates rice bacterial blight resistance by positively regulating the PTI immune response mediated by rice Xa21. Tomato LRR-RLK members SlNIK1, SlNIK2 and SlNIK3 can interact with the NSP protein in Tomato Yellow Spot Virus (ToYSV) to mediate antiviral signals. Arabidopsis LRR-RLK proteins PEPR1 and PEPR2 can recognize small peptides Peps and activate SA, JA and ET-mediated defense responses. After the co-receptor BAK1 of multiple PRRs is attacked and inhibited by pathogens, PEPR-mediated signals can further resist the invasion of pathogens by stabilizing receptors and activating SA-mediated defense responses. Arabidopsis LRR-RLK protein NUT can recognize secreted peptides SCREWs by binding to the co-receptor BAK1, and reversely regulate stomatal closure induced by ABA and MAMPs through the ABI1-OST1 module, promoting water loss, destroying the aquatic environment rich in microorganisms, and inhibiting the proliferation of pathogens. The cotton LRR-RLK gene GbSOBIR1 is upregulated by Verticillium dahliae infection, and its protein can positively regulate cotton resistance to Verticillium dahliae by phosphorylating GbbHLH171. Tomato LRR-RLK protein PSKR1 can recognize PSK and can not only regulate growth through the CPK28-GS2 pathway, but also through Ca 2+Signaling and auxin pathways, as well as the ubiquitination and degradation pathway of PSKR1 regulate tomato plant immunity. So far, no article has reported the role of SlLRR-RLK95 in the interaction between tomato and late blight. Summary of the invention

[0006] The present invention provides a tomato late blight resistance gene SlLRR-RLK95 gene and a cloning method thereof, and provides an application method of the gene in tomato late blight resistance. By constructing a transient expression vector, the role of SlLRR-RLK95 in tomato disease resistance is understood, and the molecular regulation mechanism of tomato late blight resistance is revealed, which is of great significance to the cultivation of late blight resistant tomato varieties and the protection of the tomato industry.

[0007] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0008] In a first aspect of the present invention, a tomato late blight resistance gene S1LRR-RLK95 is provided, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0009] The present invention uses a bioinformatics prediction method and combines laboratory preliminary transcriptome data to preliminarily determine the target SlLRR-RLK95 gene, and detects the expression level changes of the SlLRR-RLK95 gene at various time points after late blight pathogens infect tomato plants, thereby determining the LRR-RLK95 gene that may improve the resistance of tomatoes to late blight pathogens, and its nucleotide sequence is shown in SEQ ID NO.1.

[0010] The second aspect of the present invention provides a method for cloning the tomato late blight resistance gene S1LRR-RLK95, comprising the following steps:

[0011] S1, using the genome of wild-type tomato Zaofen 2 as a template for reverse transcription, and using specific primers to amplify the tomato genome cDNA template obtained by reverse transcription;

[0012] The specific primers are:

[0013] SlLRR-RLK95-F:

[0014] ACGGGGGACTCTAGAGGATCCATGATGATAGTTCCCACAATTTTTAATTSlLRR-RLK95-R:

[0015] CGATCGGGGAAATTCGAGCTCTCATGGAATCTGATGATTGGGTG

[0016] S2, connecting the PCR product obtained in step S1 to the pBI121 vector;

[0017] S3. The ligation product pBI121-S1LRR-RLK95 obtained in step S2 is transformed into Escherichia coli DH5α competent cells, and cultured in LB solid medium containing kanamycin. After picking positive monoclonal colonies, the plasmid is extracted by shaking, and PCR verification is performed using the specific primers and then sent for sequencing. If the sequencing result is a plasmid such as SEQ ID NO.1, the plasmid is correct.

[0018] In a preferred embodiment, the genome of the wild-type tomato Zaofen 2 is susceptible to late blight.

[0019] The third aspect of the present invention provides an application of a tomato late blight resistance gene S1LRR-RLK95 prepared by any of the above-mentioned cloning methods, for improving the resistance of tomato plants to late blight pathogens.

[0020] In a preferred embodiment, the above application is implemented by the following steps:

[0021] (1) The pBI121-S1LRR-RLK95 recombinant plasmid was transformed into Agrobacterium GV3101 competent cells, cultured in YEP liquid medium, and then spread on YEP solid medium containing kanamycin, gentamicin and rifampicin, and a single colony was picked for bacterial liquid PCR verification to obtain a positive engineering bacterial liquid;

[0022] (2) Taking five-leaf tomatoes as treatment objects, the prepared positive engineered bacterial solution was introduced into the leaves of the five-leaf tomatoes by injection, thereby achieving overexpression of the tomato late blight resistance gene Sly-miR166b.

[0023] Preferably, the culture conditions of the YEP liquid culture medium are 28° C., 180 rpm shaking culture for 2 to 3 hours.

[0024] In a preferred embodiment, the preparation method of the pBI121-S1LRR-RLK95 recombinant plasmid comprises: using the genome of wild-type tomato Zaofen 2 as a template for reverse transcription, using the obtained reverse transcription product as a tomato genome cDNA template, and performing PCR amplification using specific primers, and then connecting the PCR product with the pBI121 vector to obtain;

[0025] The specific primers are:

[0026] SlLRR-RLK95-F:

[0027] ACGGGGGACTCTAGAGGATCCATGATGATAGTTCCCACAATTTTTAATTSlLRR-RLK95-R:

[0028] CGATCGGGGAAATTCGAGCTCTCATGGAATCTGATGATTGGGTG.

[0029] Beneficial effects of the present invention:

[0030] At present, there are no reports on the role of SlLRR-RLK in tomato resistance to late blight. LRR-RLK family members can participate in plant PTI immunity as immune recognition receptors. The present invention uses a bioinformatics prediction method to preliminarily analyze potential SlLRR-RLK family members in tomatoes, and preliminarily screens genes that may respond to inducible expression of late blight fungi in combination with existing transcriptome data, thereby narrowing the scope of research objects, reducing costs, and greatly reducing workload; real-time fluorescence quantitative PCR is used to measure changes in gene expression levels of each member at different time points, and finally the SlLRR-RLK95 gene that may improve the resistance of tomatoes to late blight fungi is locked; a tomato late blight resistance gene SlLRR-RLK95 is cloned from the tomato genome; a recombinant expression vector containing the tomato late blight resistance gene SlLRR-RLK95 is constructed; specifically, SlLRR-RLK95, as a PRR, can regulate immune-related reactions in plants. The present invention achieves positive regulation of tomato late blight-related resistance genes by overexpressing the SlLRR-RLK95 gene, thereby enhancing the resistance of tomato plants to late blight fungi, which is of great significance to the cultivation of late blight-resistant tomato varieties and the protection of the tomato industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 is the expression level of SlLRR-RLK95 gene at each time point of infection by late blight pathogen;

[0032] Figure 2 The expression level, relative lesion area and phenotype of overexpressed SlLRR-RLK95;

[0033] Figure 3 The expression levels of PR genes in leaves of overexpressing empty vector and SlLRR-RLK95 before and after fungus invasion. DETAILED DESCRIPTION

[0034] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0035] The present invention uses a bioinformatics prediction method to preliminarily analyze the SlLRR-RLK family members in tomatoes, uses real-time fluorescence quantitative PCR to measure the changes in the gene expression levels of each member at different time points, and further combines the laboratory's previous transcriptome data to screen out SlLRR-RLK genes that may improve tomato's resistance to late blight; a tomato late blight resistance gene SlLRR-RLK95 is cloned from the tomato genome, and its sequence is shown in SEQ ID NO.1.

[0036] The cloning method of the tomato late blight resistance gene S1LRR-RLK95 comprises the following steps:

[0037] S1. Using the wild-type tomato Zaofen 2 genome as a template, specific primers were used to perform PCR amplification. The sequences of the specific primers are:

[0038] SlLRR-RLK95-F:

[0039] ACGGGGGACTCTAGAGGATCCATGATGATAGTTCCCACAATTTTTAATTSlLRR-RLK95-R:

[0040] CGATCGGGGAAATTCGAGCTCTCATGGAATCTGATGATTGGGTG

[0041] S2. The PCR product was purified and recovered and then connected with the pBI121 vector to obtain the connection product pBI121-S1LRR-RLK95.

[0042] S3. The above ligation product is transformed into Escherichia coli DH5α competent cells, and the positive monoclonal colonies are picked after overnight culture in LB solid medium containing kanamycin, and the plasmid is extracted by shaking the bacteria. PCR verification is performed using the above specific primers and then sent for sequencing. The plasmid with sequencing results such as SEQ ID NO.1 is the desired ligation product.

[0043] The present invention also provides an application method of the tomato late blight resistance gene S1LRR-RLK95, which is used to improve the resistance of tomatoes to late blight pathogens, indicating that it plays an important role in tomato response to biological stress.

[0044] The application method of the tomato late blight resistance gene S1LRR-RLK95 comprises the following steps:

[0045] S1 The successfully connected pBI121-SlLRR-RLK95 recombinant plasmid was transformed into Agrobacterium GV3101 competent cells. After shaking culture at 28°C and 180 rpm for 2-3 hours, the bacterial solution was evenly spread on YEP solid medium containing kanamycin, gentamicin and rifampicin. After 48 hours of dark culture, a single colony was picked for bacterial solution PCR verification. If the verification was correct, the positive engineering bacterial solution was obtained;

[0046] S2 selected five-leaf tomato leaves with consistent growth as the treatment objects, and injected the positive engineered bacteria solution into the back of the leaves using a disposable syringe without a needle, taking care to avoid the leaf veins; thereby achieving overexpression of the tomato late blight resistance gene SlLRR-RLK95.

[0047] The method for constructing a recombinant expression vector of a tomato late blight resistance gene S1LRR-RLK95 comprises the following steps: designing upstream and downstream primers of a vector homology arm containing BamHI and Sac I endonuclease sites, purifying and recovering a target fragment, connecting the target fragment with a pBI121 expression vector from which a GUS gene has been removed by using a homologous recombination technique, inserting the target fragment into a 35S promoter site of the pBI121 expression vector, transforming Escherichia coli DH5α with the connection product and evenly coating the result on an LB solid culture medium containing kanamycin, picking a single colony after overnight culture, extracting a plasmid by shaking, and sending the plasmid for sequencing after PCR identification, and the recombinant expression vector pBI121-S1LRR-RLK95 is the one with the correct sequencing.

[0048] Example 1: Determination of the target tomato late blight resistance gene S1LRR-RLK95

[0049] 1. Cultivation of tomato plants: Soak the Zaofen No. 2 tomato seeds in pure water for 24 hours, place them evenly on moist filter paper and germinate them in a 28°C incubator. After 5 days, transfer them to the soil and cultivate them at 28°C, 16h light / 8h dark until the five-leaf stage.

[0050] 2. Cultivation and inoculation of late blight: Inoculate the late blight strain on fresh rye culture medium, invert and culture at 18°C ​​in the dark for 10 days, scrape off the mycelium, rinse with sterile water, and filter with gauze. After sealing the bottle mouth, place it at 4°C for 3 hours to release the late blight spores to obtain a late blight spore suspension. Count the spore colonies with the help of a hemocytometer to make the late blight spore concentration reach 1×10 6 Pieces / mL.

[0051] 3. Treatment and sampling of tomato seedlings: Five-leaf tomato plants with good and consistent growth conditions were selected as treatment objects. 20 μL of the above-mentioned late blight spore suspension was inoculated onto the back of detached tomato leaves. The leaves were cultured in the dark at 18±2°C for 3 to 5 days. The tomato leaves were cut 0h, 6h, 12h, 24h and 48h after inoculation and culture, and then ground and sampled after being frozen with liquid nitrogen.

[0052] 4. RNA extraction, reverse transcription and real-time fluorescence quantitative PCR reaction:

[0053] (1) Take an appropriate amount of fully ground powder and add it to 1 mL of pre-cooled Trizol, shake well, and let it stand at room temperature for 5 min.

[0054] (2) Take the supernatant and add 200 μL chloroform, shake to mix, and centrifuge at 4°C, 12,000 r / min for 10 min. Transfer the supernatant to a new centrifuge tube and add an equal volume of pre-cooled isopropanol, invert 8 to 10 times to mix, and centrifuge at 4°C, 12,000 r / min for 10 min.

[0055] (3) Discard the supernatant, add 1 mL of freshly prepared 75% ethanol, wash the precipitate, and centrifuge at 4°C and 12,000 rpm for 5 min.

[0056] (4) Discard the supernatant, open the lid and let it stand until the remaining ethanol is completely evaporated, then add 25 μL RNase Free dH2O to fully dissolve the precipitate.

[0057] (5) Take 3 μL RNA and use 1% agarose gel electrophoresis to detect the purity and quality of the extracted RNA. TM RT Master Mix (purchased from TaKaRa) was reverse transcribed into a cDNA template, and the real-time fluorescence quantitative reagent SYBR Green qPCR MasterMixⅡ (purchased from Seven) was used to detect the expression level of the SlLRR-RLK95 gene at the above time points.

[0058] The data obtained by real-time fluorescence quantitative PCR reaction were calculated using the 2-ΔΔCt method. The results showed that 12 hours after infection with late blight, the expression level of SlLRR-RLK95 was significantly upregulated, indicating that the expression of SlLRR-RLK95 gene was induced by late blight ( Figure 1 ); Based on the degree of expression change and the preliminary laboratory data, the SlLRR-RLK95 gene that may improve the resistance of tomatoes to late blight was preliminarily determined, and the nucleotide sequence is shown in SEQ ID NO.1.

[0059] The above reverse transcription system is:

[0060]

[0061] The reaction conditions were 37°C for 15 min and 85°C for 5 sec.

[0062] The above-mentioned real-time fluorescence quantitative PCR reaction system is:

[0063]

[0064] The reaction conditions are as follows:

[0065]

[0066] Example 2: Cloning of the tomato late blight resistance gene S1LRR-RLK95

[0067] 1. PCR amplification of S1LRR-RLK95 gene

[0068] Tomato genomic cDNA was obtained according to the method in "Example 1, Step 4", and used as a template for PCR amplification using specific primers.

[0069] The specific primers used for cloning are as follows:

[0070] SlLRR-RLK95-F:

[0071] ACGGGGGACTCTAGAGGATCCATGATGATAGTTCCCACAATTTTTAATT

[0072] SlLRR-RLK95-R:

[0073] CGATCGGGGAAATTCGAGCTCTCATGGAATCTGATGATTGGGTG

[0074] The above PCR reaction system is:

[0075]

[0076] The reaction conditions are as follows:

[0077]

[0078] 2. Recovery and purification of PCR amplification products

[0079] After the PCR product was detected by 1% agarose gel electrophoresis, the target band was determined in the gel illuminator, cut off and added to the centrifuge tube. Weigh the cut gel block, add the sol solution after conversion according to the Novozyme product purification instructions (DC301-01), and place it in a 55°C water bath and turn it upside down until the gel block is completely dissolved. Transfer the sol solution to the adsorption column and centrifuge it at 12000r / min for 60s, and pour out the liquid in the centrifuge tube. Add PW rinse solution to the adsorption column, centrifuge for 30-60s, pour out the liquid, repeat this process twice and centrifuge for 2min. Open the lid and let it stand to wait for the rinse solution to dry, then place the adsorption column on a new centrifuge tube, draw 50μL ddH2O and drop it in the middle of the adsorption membrane, place it at room temperature for 2min, then centrifuge it at 12000r / min for 2min, discard the liquid part, and recover the target fragment.

[0080] 3. Connect the target fragment to the vector

[0081] The target fragment recovered above was connected to the pBI121 vector, and the reaction system was as follows:

[0082]

[0083] After reacting in a metal bath at 50°C for 15 min, the ligation product pBI121-SlLRR-RLK95 was obtained.

[0084] 4. Transformation of E. coli with ligation products

[0085] (1) Take frozen E. coli DH5α and resuscitate it by streaking. Pick a single clone and culture it in LB liquid medium overnight. Pipette 500 μL of activated E. coli DH5α into 15 mL of LB liquid medium and shake and culture it. Wait until the OD value of the bacterial solution reaches 1. 600 When the value reaches about 0.6, ice-bathe the bacterial solution for 30 minutes, centrifuge and collect the bacteria, and resuspend them in pre-cooled 0.1M CaCl2. Ice-bathe again for 30 minutes, centrifuge and collect the bacteria, and resuspend them in 0.1M CaCl2 to obtain competent E. coli;

[0086] (2) Add 10 μL of the ligation product to the above 200 μL of E. coli competent cells, gently pipette to mix, place on ice for 30 min, immediately transfer to a 42°C water bath for heat shock for 90 s, take out and place on ice again for 2 min;

[0087] (3) Add 1000 μL of fresh LB liquid culture medium without antibiotics, and incubate at 37°C with shaking at 180 rpm for 1 h.

[0088] (4) After 1 hour, centrifuge the bacterial solution at 12,000 rpm for 30 seconds, discard the culture medium, and use the remaining small amount of liquid to resuspend the bacteria at the bottom of the centrifuge tube. Use a sterile glass spreading rod to spread the suspension on a LB solid culture medium plate containing 50 mg / L ampicillin, and place it in a 37°C incubator for overnight culture.

[0089] (5) Pick a single white colony with a regular shape, inoculate it into fresh LB liquid culture medium containing 50 mg / L kanamycin, and culture it overnight in a constant temperature shaker at 37°C and 180 rpm.

[0090] 5. Plasmid PCR Detection

[0091] The bacterial solution was taken as a template, and PCR verification was performed using SlLRR-RLK95-F and SlLRR-RLK95-R as primers. The verified bacterial solution was sent for sequencing. Correct sequencing indicated that pBI121-SlLRR-RLK95 was successfully constructed.

[0092] 6. Extraction of pBI121-S1LRR-RLK95 plasmid

[0093] According to the instructions of the plasmid mini-extraction kit (purchased from TIANGEN), the pBI121-S1LRR-RLK95 plasmid contained in the correctly sequenced bacterial solution was extracted, and 5 μL of the plasmid sample was subjected to 1% agarose gel electrophoresis.

[0094] Example 3: Application of tomato late blight resistance gene S1LRR-RLK95

[0095] 1. Preparation of pBI121-SlLRR-RLK95 Agrobacterium engineering bacteria

[0096] (1) Add 1 mL of activated Agrobacterium GV3101 bacterial suspension to fresh YEP liquid medium, shake at 180 rpm for 6-7 h at 28°C, ice bath for 30 min, centrifuge at low temperature for 10 min, discard the supernatant, gently pipette and resuspend the bacteria with pre-cooled 20 mM CaCl2, centrifuge at low temperature for 10 min, discard the supernatant and resuspend with CaCl2 again to obtain Agrobacterium competent state.

[0097] (2) Pipette 5 μL of pBI121-SlLRR-RLK95 plasmid into 100 μL of Agrobacterium competent cells, flick the tube wall to mix, place on ice for 5 min, freeze in liquid nitrogen for 5 min, heat shock at 37°C in a water bath for 5 min, and place on ice for 5 min;

[0098] (3) Add 800 μL of antibiotic-free YEP liquid culture medium to the clean bench and incubate at 28°C and 180 rpm for 3 h;

[0099] (4) The obtained bacterial solution was centrifuged at 4000 rpm for 10 min, 1 mL of the supernatant was discarded, and the bacteria were resuspended with the remaining bacterial solution. The bacteria were then evenly spread on YEP solid medium containing gentamicin, rifampicin and kanamycin using a sterilized spreading rod and incubated at 28°C for 36 h.

[0100] (5) PCR detection of Agrobacterium engineering bacteria

[0101] Pick the colonies on the antibiotic-containing solid medium, place them in 1 mL of fresh YEP liquid medium, and culture them at 28°C with shaking at 180 rpm for 16 to 17 h. Use SlLRR-RLK95-F and SlLRR-RLK95-R primers for PCR verification. The reaction conditions and reaction system are the same as those in "Example 2, Step 1". Add an equal volume of 50% glycerol to the positive clone solution and freeze it for storage.

[0102] 2. Establishment of transient infection system and related tests

[0103] (1) Preparation of transient infection fluid

[0104] ① Inoculate the pBI121 empty vector (EV) and pBI121-SlLRR-RLK95 Agrobacterium activated bacterial solution (prepared in step 1 of this example, SlLRR-RLK95 overexpression group) into 15 mL of YEP liquid culture medium containing gentamicin, rifampicin and kanamycin, respectively, and culture at 28°C and 180 rpm for 12 to 16 h;

[0105] ② Use a 2mL EP tube and centrifuge at 5000g for 10 minutes at room temperature and discard the waste liquid.

[0106] ③ Add 1 mL of infection solution (10 mM MES, 10 mM MgCl2, 100 μM As) to resuspend the bacteria, centrifuge at 4000 g for 10 min at room temperature, and discard the waste liquid.

[0107] ④ Resuspend the cells with an appropriate amount of infection solution to make OD 600 To about 0.8, place in a 25℃ shaker in the dark and culture for 1 hour.

[0108] (2) Transient transformation of tomato plants

[0109] ① Before transformation, select five-leaf tomato leaves with consistent growth and good growth conditions as experimental materials. After 1-2 hours of weak light treatment, inject the above infection solution into the back of the leaves with a disposable syringe without a needle; place the treated tomatoes in the dark at 25℃ overnight and culture them under a 16h / 8h photoperiod for 3 days. Three biological replicates were performed for each group of experiments.

[0110] ② Take the tomato leaves after overexpression for 3 days, grind them into powder in a mortar with liquid nitrogen, and extract RNA as described above in "Example 1, Step 4". Take 3 μL of the extracted RNA and use 1% agarose gel electrophoresis to detect purity and quality.

[0111] ③Use the extracted RNA for reverse transcription using the mRNA reverse transcription reagent PrimeScript TM RT Master Mix (purchased from TaKaRa) was reverse transcribed into a cDNA template, and the real-time fluorescence quantitative PCR reaction was completed using the real-time fluorescence quantitative reagent SYBR Green qPCR MasterMixⅡ (purchased from Seven). The real-time fluorescence quantitative primers of the SlLRR-RLK95 gene used in the real-time fluorescence quantitative experiment are shown in Table 1. The results showed that the expression level of SlLRR-RLK95 in the plants transiently overexpressing SlLRR-RLK95 increased by about 12 times compared with the EV group, indicating that the SlLRR-RLK95 gene was successfully overexpressed ( Figure 2 Left).

[0112] (3) Inoculation of detached leaves with late blight

[0113] ① Inoculate the late blight fungus strain on fresh oat culture medium (80 g / L oat, 20 g / L sucrose, 15 g / L agar powder, 1 g / L calcium carbonate), invert and culture in a dark environment at 20°C for 10 days, scrape off the mycelium, rinse with sterile water, and filter with gauze. After sealing the bottle mouth, place it at 4°C for 1 to 3 hours to release spores, and adjust the final concentration of the late blight fungus spore suspension to 1×10 6 Pieces / mL.

[0114] ② Pick the EV and pBI121-SlLRR-RLK95 tomato leaves after 3 days of treatment, poke a small wound in the middle of the leaf with a sterile toothpick, and place it on a sterile moist filter paper in a culture dish;

[0115] ③ 20 μL of the above spore suspension was dripped onto the wound of the leaves, sealed with plastic wrap, and cultured in the dark at 20°C for 5 days. It was observed that the diameter of the lesions on the leaves transiently overexpressing SlLRR-RLK95 was significantly smaller than that on the leaves transiently overexpressing the empty vector. The statistical results showed that the diameter of the lesions on the leaves transiently overexpressing SlLRR-RLK95 was 0.62 cm, and the diameter of the lesions on the leaves transiently overexpressing the empty vector was 0.83 cm, and the diameter of the lesions was reduced by 0.21 cm ( Figure 2 ). And using real-time fluorescence quantitative PCR experiments, it was found that after treatment with late blight, the SA-related disease-related genes SlPR1, SlPR2, and SlPR5 were significantly upregulated after overexpression of SlLRR-RLK95, and the expression level of the JA-related disease-related gene SlPR3 was significantly downregulated ( Figure 3), in the real-time fluorescence quantitative PCR experiment, the real-time fluorescence quantitative primers of the PR gene used are shown in Table 1, and the reaction system and conditions are shown in "Example 1, Step 4". The results showed that the tomato leaves in the SlLRR-RLK95 overexpression group (TOE-SlLRR-RLK95) had a lower incidence of EV than EV, and the lesion diameter was significantly smaller. And the expression level of SA-related PR genes in TOE-SlLRR-RLK95 was significantly higher than that in EV.

[0116] Table 1 Primers used for real-time quantitative PCR

[0117]

[0118] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

[0119] Gene S1LRR-RLK95 nucleotide sequence SEQ ID NO.1

[0120]

Claims

1. A tomato late blight resistance gene S1LRR-RLK95, It is characterized in that Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A method for cloning the tomato late blight resistance gene S1LRR-RLK95 according to claim 1, It is characterized in that The steps include: S1, using the genome of wild-type tomato Zaofen 2 as a template for reverse transcription, and using specific primers to amplify the tomato genome cDNA template obtained by reverse transcription; The specific primers are: SlLRR-RLK95-F: ACGGGGGACTCTAGAGGATCCATGATGATAGTTCCCACAATTTTTAATTSlLRR-RLK95-R: CGATCGGGGAAATTCGAGCTCTCATGGAATCTGATGATTGGGTG S2, connecting the PCR product obtained in step S1 to the pBI121 vector; S3. The ligation product pBI121-S1LRR-RLK95 obtained in step S2 is transformed into Escherichia coli DH5α competent cells, and cultured in LB solid medium containing kanamycin. After picking positive monoclonal colonies, the plasmid is extracted by shaking, and PCR verification is performed using the specific primers and then sent for sequencing. If the sequencing result is a plasmid such as SEQ ID NO.1, the plasmid is correct.

3. The method for cloning the tomato late blight resistance gene S1LRR-RLK95 according to claim 2, It is characterized in that The genome of the wild-type tomato Zaofen 2 is susceptible to late blight.

4. Use of the tomato late blight resistance gene S1LRR-RLK95 prepared by the cloning method according to any one of claims 2 to 3, It is characterized in that Used to improve the resistance of tomato plants to late blight.

5. The use according to claim 4, It is characterized in that This is accomplished by the following steps: (1) The pBI121-S1LRR-RLK95 recombinant plasmid was transformed into Agrobacterium GV3101 competent cells, cultured in YEP liquid medium, and then spread on YEP solid medium containing kanamycin, gentamicin and rifampicin, and a single colony was picked for bacterial liquid PCR verification to obtain a positive engineering bacterial liquid; (2) Taking five-leaf tomatoes as treatment objects, the prepared positive engineered bacterial solution was introduced into the leaves of the five-leaf tomatoes by injection, thereby achieving overexpression of the tomato late blight resistance gene Sly-miR166b.

6. The use according to claim 5, It is characterized in that The culture conditions of the YEP liquid culture medium are 28° C. and 180 rpm shaking culture for 2 to 3 hours.

7. The use according to claim 5, It is characterized in that The preparation method of the pBI121-S1LRR-RLK95 recombinant plasmid comprises: using the genome of wild-type tomato Zaofen 2 as a template for reverse transcription, using the obtained reverse transcription product tomato genome cDNA template, and performing PCR amplification using specific primers, and then connecting the PCR product with the pBI121 vector to obtain; The specific primers are: SlLRR-RLK95-F: ACGGGGGACTCTAGAGGATCCATGATGATAGTTCCCACAATTTTTAATTSlLRR-RLK95-R: CGATCGGGGAAATTCGAGCTCTCATGGAATCTGATGATTGGGTG。

Images