Aspergillus terreus promoter library and screening method and application thereof

Abstract

The invention provides an aspergillus terreus promoter library as well as a screening method and application thereof, and relates to the technical field of biology. The invention provides a construction method of the aspergillus terreus promoter library and a screening method of the promoters for the first time, and the promoters from aspergillus terreus with different activities obtained by screening through the method provide a new tool material for synthetic biology. The aspergillus terreus-derived promoter obtained by screening has better adaptability to aspergillus terreus engineering bacteria, and the problems of poor adaptability, low activity and the like in the process of transferring an exogenous promoter into the aspergillus terreus engineering bacteria are solved.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to an Aspergillus terreus promoter library and a screening method and application thereof. Background Art

[0002] Aspergillus terreus is an industrial filamentous fungus with important economic value. It has shown great potential in the production of primary and secondary metabolites. In actual production, it also shows good industrial properties such as short fermentation cycle, strong spore production ability, good stress resistance, and strong fermentation robustness. It has been used in the construction of itaconic acid, lovastatin, trans-aconitic acid and physcion methyl ether cell factories and has achieved industrial production.

[0003] With the development of metabolic engineering and synthetic biology, various corresponding methods have been developed for high-titer production of target products by microorganisms. Among them, promoter engineering has become a key technology for regulating gene expression and optimizing the biosynthetic pathway of target products, and is widely used in metabolic engineering transformation of microorganisms. Promoters are important elements for regulating gene expression. They are located in the non-coding region upstream of the 5' end of structural genes and are DNA fragments that are specifically recognized and bound by RNA polymerase. The activity of promoters is affected by many factors, and in heterologous expression of genes, it is often necessary to select promoters with different activities according to actual needs.

[0004] Although various promoters and promoter libraries from many sources have been reported, there is no promoter screening technology for Aspergillus terreus, and many exogenous promoters have poor adaptability in Aspergillus terreus engineered bacteria. Therefore, in order to meet the needs of subsequent metabolic engineering transformation, the present invention constructs an Aspergillus terreus own promoter library and performs screening. Summary of the invention

[0005] To solve the above problems, the purpose of the present invention is to provide a construction of an Aspergillus terreus promoter library and a method and application of promoter screening, so as to screen promoters of different strengths from Aspergillus terreus and construct a promoter library.

[0006] In one aspect, the present application provides a method for constructing an Aspergillus terreus promoter library, the method comprising the following steps:

[0007] Step 1: sequentially connect the promoter to be constructed and the reporter gene to obtain a recombinant expression cassette; the promoter to be constructed is derived from Aspergillus terreus;

[0008] Step 2: Transfer the recombinant expression cassette into the gene locus related to pigment synthesis of the engineered bacteria to construct the recombinant engineered bacteria, thus obtaining the promoter library.

[0009] Preferably, the promoter to be constructed is derived from Aspergillus terreus G2 and / or Aspergillus terreus MEFC01.

[0010] The purpose of selecting the Aspergillus terreus G2 and Aspergillus terreus MEFC01 genomes for promoter screening in the present application is to select Aspergillus terreus that produces trans-aconitic acid and Aspergillus terreus that produces itaconic acid as screening samples, so that the promoters obtained by screening can be more suitable for Aspergillus terreus engineered bacteria that produce organic acids, and suitable for subsequent organic acid production processes.

[0011] It is understandable that those skilled in the art can also select other synthetic pathway-related engineered bacterial genomes for screening according to different needs, and this is not specifically limited in the present application.

[0012] Furthermore, the recombinant expression cassette also includes homology arms of pigment synthesis related genes; preferably, the recombinant expression cassette also includes upstream homology arms of pigment synthesis related genes and downstream homology arms of pigment synthesis related genes.

[0013] Preferably, the length of the homology arm of the pigment synthesis related gene is greater than 1.0 kb.

[0014] More preferably, the length of the homology arm of the pigment synthesis related gene is 1.0-1.5 kb.

[0015] In a preferred embodiment, the sequence of the upstream homologous arm of the pigment synthesis related gene is shown as SEQ ID No.32, and the sequence of the downstream homologous arm of the pigment synthesis related gene is shown as SEQ ID No.33.

[0016] Among them, the role of the homology arm is to assist the recombinant expression cassette to be transferred into the gene site related to pigment synthesis of the engineered bacteria to ensure correct insertion into the specific site.

[0017] Furthermore, the engineered bacteria include strains of the genus Aspergillus; more preferably, one or more selected from Aspergillus terreus, Aspergillus niger, Aspergillus nidulans, Aspergillus fumigatus, and Aspergillus oryzae; preferably, the engineered bacteria is Aspergillus terreus.

[0018] In a preferred embodiment, the Aspergillus terreus is Aspergillus terreus MEFC01.

[0019] Further, the pigment synthesis-related gene includes pgmA gene, melA gene and / or tretA gene; more preferably, the pigment synthesis-related gene includes melA gene.

[0020] Among them, the gene bank number of TerA gene is ATEG_00145; the gene bank number of pgmA gene is ATEG_06206; and the gene bank number of MelA gene is ATEG_03563.

[0021] In this application, a promoter is inserted into the pigment synthesis-related gene site for the first time to achieve the site-specific knockout process of the pigment synthesis-related gene, that is, to cause the inactivation of the pigment synthesis-related gene. After the inactivation, the gene can be obviously changed by the colony color. Therefore, the operator can directly screen the recombinant engineered bacteria according to the change of colony color, which greatly improves the efficiency of library construction.

[0022] Furthermore, the reporter gene is selected from one or more of a luciferase reporter gene, a fluorescent marker gene, and a resistance gene; preferably, the reporter gene includes a luciferase reporter gene.

[0023] In a preferred embodiment, the luciferase reporter gene is the luc gene.

[0024] Preferably, the nucleotide sequence of the luciferase reporter gene is shown as SEQ ID No.29.

[0025] Furthermore, the recombinant expression cassette also includes a terminator.

[0026] In a preferred embodiment, the terminator is TpgK, and the nucleotide sequence of the terminator is shown as SEQ ID No.30.

[0027] Those skilled in the art will appreciate that any terminator may be selected to construct the above-mentioned recombinant expression cassette, as long as the terminator can function to terminate the expression of the reporter gene, and the present application does not impose too many restrictions here.

[0028] Those skilled in the art will appreciate that other commonly used expression elements can be adaptively added to the recombinant expression cassette described in the present application to assist in the expression of the target gene, such as adding tags, fluorescent protein markers, resistance screening markers, etc.

[0029] In a preferred embodiment, the recombinant expression cassette contains a resistance screening marker gene, which can be selected by a person skilled in the art according to actual conditions, and the present application does not impose mandatory restrictions on the resistance screening marker gene. The resistance screening marker gene can be the hph gene, and the nucleotide sequence of the hph gene is shown in SEQ ID No.31.

[0030] In a preferred embodiment, the recombinant expression cassette includes in sequence: a promoter to be constructed, a reporter gene, a terminator, and a resistance selection marker gene.

[0031] Furthermore, the method for introducing the recombinant expression cassette into Aspergillus terreus is selected from the group consisting of protoplast transformation, electroporation, gene gun method, and Agrobacterium-mediated method; preferably, protoplast transformation method.

[0032] It is understandable to those skilled in the art that the existing gene editing technology can be used to complete the construction of the above-mentioned expression cassette and recombinant engineered bacteria.

[0033] In a preferred embodiment, a method for constructing an Aspergillus terreus promoter library comprises:

[0034] Step 1: obtaining a promoter to be constructed from the Aspergillus terreus genome, and sequentially connecting the promoter to be constructed, a reporter gene, a terminator, and a resistance screening marker gene to obtain a recombinant expression cassette;

[0035] Step 2: Transfer the recombinant expression cassette into the gene locus related to pigment synthesis of the engineered bacteria to construct the recombinant engineered bacteria, thus obtaining the promoter library.

[0036] On the other hand, the present application also provides a method for screening an Aspergillus terreus promoter, the method comprising:

[0037] Step 1: sequentially connect the promoter to be constructed and the reporter gene to obtain a recombinant expression cassette; the promoter to be constructed is derived from Aspergillus terreus;

[0038] Step 2: transferring the recombinant expression cassette into the gene locus related to pigment synthesis of the engineered bacteria to construct the recombinant engineered bacteria;

[0039] Step 3: Detect the expression level of the reporter gene in the recombinant engineered bacteria.

[0040] In a preferred embodiment, a method for screening an Aspergillus terreus promoter comprises:

[0041] Step 1: obtaining a promoter to be constructed from the Aspergillus terreus genome, and sequentially connecting the promoter to be constructed, a luciferase reporter gene, a terminator, and a resistance screening marker gene to obtain a recombinant expression cassette;

[0042] Step 2: transferring the recombinant expression cassette into the gene locus related to pigment synthesis of the engineered bacteria to construct the recombinant engineered bacteria;

[0043] Step 3: Detect the fluorescent signal emitted by the reaction between the recombinant engineered bacteria and the substrate.

[0044] Among them, the use of an enzyme-labeled instrument to detect fluorescent signals can reflect the activity and expression level of the luciferase reporter gene, and then reflect the expression intensity of the promoter, thus achieving the screening of the promoter.

[0045] In a preferred embodiment, the reporter gene expression level of the recombinant engineered bacteria is compared with that of the control group, and is divided into low expression, medium expression and high expression groups according to the difference in expression level with the control group, so that technicians in this field can obtain the corresponding promoter according to their needs.

[0046] On the other hand, the present application also provides an Aspergillus terreus promoter obtained by the screening method.

[0047] In a preferred embodiment, the Aspergillus terreus promoter includes any one of SEQ ID No.1-SEQ ID No.27.

[0048] Among them, low expression promoters include P g7031 , P g2820 , P g8803 , P g5035 , P g2000 , the expression promoter includes P g3329 , P g1220 , P g5630 , P g8690 , P g6920 , P g1404 , P g6796 , P g3561 , P g9110 , P g6114 , P g5571 , P g4602 , P g2710 , P g10239 , P g6323 , P g1175 , P g2319 , P g7765 , P g7389 , P g6906 , P g1297 , P g6625 , high expression promoters include P g6550 , P g6756 , P g6669 .

[0049] Among them, P g5630 The nucleotide sequence is as shown in SEQ ID No.1 or has at least 98% identity with SEQ ID No.1.

[0050] P g1404 The nucleotide sequence is shown as SEQ ID No.2 or has at least 98% identity with SEQ ID No.2.

[0051] P g6114 The nucleotide sequence is shown as SEQ ID No.3 or has at least 98% identity with SEQ ID No.3.

[0052] P g6669 The nucleotide sequence is shown as SEQ ID No.4 or has at least 98% identity with SEQ ID No.4.

[0053] P g6550The nucleotide sequence is shown as SEQ ID No.5 or has at least 98% identity with SEQ ID No.5.

[0054] P g2000 The nucleotide sequence is shown as SEQ ID No.6 or has at least 98% identity with SEQ ID No.6.

[0055] P g6625 The nucleotide sequence is shown as SEQ ID No.7 or has at least 98% identity with SEQ ID No.7.

[0056] P g7765 The nucleotide sequence is shown as SEQ ID No.8 or has at least 98% identity with SEQ ID No.8.

[0057] P g6756 The nucleotide sequence is shown as SEQ ID No.9 or has at least 98% identity with SEQ ID No.9.

[0058] P g6906 The nucleotide sequence is shown as SEQ ID No.10 or has at least 98% identity with SEQ ID No.10.

[0059] P g8803 The nucleotide sequence is shown as SEQ ID No.11 or has at least 98% identity with SEQ ID No.11.

[0060] P g2399 The nucleotide sequence is shown as SEQ ID No.12 or has at least 98% identity with SEQ ID No.12.

[0061] P g7389 The nucleotide sequence is shown as SEQ ID No.13 or has at least 98% identity with SEQ ID No.13.

[0062] P g2710 The nucleotide sequence is shown as SEQ ID No.14 or has at least 98% identity with SEQ ID No.14.

[0063] P g9110 The nucleotide sequence is shown as SEQ ID No.15 or has at least 98% identity with SEQ ID No.15.

[0064] P g6920 The nucleotide sequence is shown as SEQ ID No.16 or has at least 98% identity with SEQ ID No.16.

[0065] P g1297 The nucleotide sequence is shown as SEQ ID No.17 or has at least 98% identity with SEQ ID No.17.

[0066] P g6323 The nucleotide sequence is shown as SEQ ID No.18 or has at least 98% identity with SEQ ID No.18.

[0067] P g5035 The nucleotide sequence is shown as SEQ ID No.19 or has at least 98% identity with SEQ ID No.19.

[0068] P g4602 The nucleotide sequence is shown as SEQ ID No.20 or has at least 98% identity with SEQ ID No.20.

[0069] P g7031 The nucleotide sequence is shown as SEQ ID No.21 or has at least 98% identity with SEQ ID No.21.

[0070] P g8690 The nucleotide sequence is shown as SEQ ID No.22 or has at least 98% identity with SEQ ID No.22.

[0071] P g1220 The nucleotide sequence is shown as SEQ ID No.23 or has at least 98% identity with SEQ ID No.23.

[0072] P g6796 The nucleotide sequence is shown as SEQ ID No.24 or has at least 98% identity with SEQ ID No.24.

[0073] P g3561 The nucleotide sequence is shown as SEQ ID No.25 or has at least 98% identity with SEQ ID No.25.

[0074] P g5571 The nucleotide sequence is shown as SEQ ID No.26 or has at least 98% identity with SEQ ID No.26.

[0075] P g10239 The nucleotide sequence is shown as SEQ ID No.27 or has at least 98% identity with SEQ ID No.27.

[0076] On the other hand, the present application also provides the use of the promoter in a recombinant strain of Aspergillus terreus.

[0077] The present invention has the following beneficial effects:

[0078] The present application provides for the first time a method for constructing an Aspergillus terreus promoter library and screening promoters, and the promoters derived from Aspergillus terreus with different activities screened by this method provide new tool materials for synthetic biology. In addition, the promoters derived from Aspergillus terreus have better adaptability to Aspergillus terreus engineered bacteria, which solves the problems of poor adaptability and low activity of exogenous promoters during the use of Aspergillus terreus engineered bacteria. BRIEF DESCRIPTION OF THE DRAWINGS

[0079] The drawings described herein are used to provide a further understanding of the present application and constitute a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute an improper limitation on the present application. In the drawings:

[0080] Figure 1 is a map of candidate genes expressed at different levels in the process of organic acid synthesis, where S represents the transcriptome data of Aspergillus terreus G2 strain producing trans-aconitic acid, and F represents the transcriptome data of Aspergillus terreus MEFC01 strain producing itaconic acid;

[0081] Figure 2 is a schematic diagram of the construction of the recombinant expression cassette;

[0082] Figure 3 This is a graph showing the results of electrophoresis detection of the recombinant expression cassette;

[0083] Figure 4 This is a schematic diagram of rapid screening of positive transformants based on the color of spores on the surface of plate colonies, where lighter colors are positive transformants, while darker colors are false positives;

[0084] Figure 5 This is the electrophoresis result diagram of the separation of positive transformant single cells;

[0085] Figure 6 is a statistical graph of promoter expression intensity, where gpdAt The relative strength of each type of promoter was obtained for comparison. DETAILED DESCRIPTION

[0086] In order to more clearly explain the overall concept of the present application, the following is described in detail in conjunction with the accompanying drawings of the specification by way of embodiment. In the following description, a large number of specific details are provided to provide a more thorough understanding of the present invention. However, it is obvious to those skilled in the art that the present invention can be implemented without one or more of these details. In other examples, in order to avoid confusion with the present invention, some technical features well known in the art are not described.

[0087] If no specific conditions are specified in the examples, the experiments were carried out according to conventional conditions or conditions recommended by the manufacturer.

[0088] Unless otherwise specified, in the following embodiments, the reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially. The plasmids, endonucleases, PCR enzymes, column-based DNA extraction kits and DNA gel recovery kits used in the following examples are commercial products, and the specific operations are performed according to the kit instructions.

[0089] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the field of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields, and can be specifically carried out according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0090] Example 1 Construction of Aspergillus terreus promoter library

[0091] 1) Bioinformatics prediction of promoters with different expression levels from Aspergillus terreus

[0092] In this embodiment, the promoters of Aspergillus terreus producing trans-aconitic acid and Aspergillus terreus producing itaconic acid were screened. In order to make the screened promoter more suitable for Aspergillus terreus producing organic acids, trans-aconitic acid and itaconic acid were used as examples for screening, and Aspergillus terreus producing trans-aconitic acid and Aspergillus terreus producing itaconic acid were selected as screening samples for subsequent experiments.

[0093] Specifically, the transcriptomes of the trans-aconitic acid-producing Aspergillus terreus G2 strain (application publication number: CN 112029671 A, invention patent name: A recombinant Aspergillus terreus strain with high trans-aconitic acid production, preparation method and application thereof) and the itaconic acid-producing Aspergillus terreus MEFC01 strain (purchased from the China Industrial Microbiological Culture Collection Center, strain number CICC40205) were analyzed. The data covered a total of 10,298 genes, and the coefficient of variation (CV = standard deviation / mean) was used for screening. For specific screening methods, please refer to the literature: Andersen, CL Normalization of Real-Time Quantitative Reverse Transcription-PCR Data: A Model-Based Variance Estimation Approach to Identify Genes Suited for Normalization, Applied to Bladder and Colon Cancer Data Sets [J]. Cancer Research, 2018, 2004, Vol. 64, No. 15 (15): 5245-50. DOI: 10.1158 / 0008-5472.CAN-04-0496.

[0094] Finally, 27 promoters of genes with high, medium and low expression were selected as candidates ( Figure 1 ), the promoter sequence is shown in Table 1.

[0095] Table 1

[0096]

[0097]

[0098] 2) Construction of recombinant expression cassette

[0099] Primers were designed for the promoter regions (1 kb upstream of the gene coding region) of the highly expressed, moderately expressed, and lowly expressed genes predicted in step 1) (primer sequences are shown in Table 2), and PCR amplification was performed using the Aspergillus terreus NIH2624 genome (https: / / www.ncbi.nlm.nih.gov / datasets / taxonomy / 341663 / , NCBI Taxonomy ID: 341663) as a template to obtain the P gpdA Promoter (sequence shown in SEQ ID No.28) including 28 promoter libraries P gxxxx ;

[0100] Using plasmid pFW21_8 (the plasmid comes from the article Tet-on, or Tet-off, that is the question: Advanced conditional gene expression in Aspergillus, the public can refer to the article to synthesize it by themselves) as a template, primers luc-F and luc-R were used to amplify the luciferase luc fragment (the sequence is shown in SEQ ID No. 29);

[0101] Plasmid pXH-106 (described in: Lv Xuefeng et al., A Aconitic Acid-producing Aspergillus terreus strain and its construction method and application, CN 201910649851.1.) was amplified using primers TpgK(luc)-F and TpgK(hph)-R to obtain the terminator TpgK fragment (sequence as shown in SEQ ID No. 30);

[0102] Using plasmid pXH-106 (described in: Lv Xuefeng et al., A Aconitic Acid-producing Aspergillus terreus strain and its construction method and application, CN 201910649851.1.) as a template, primers hph-F and hph-R were used for amplification to obtain the resistance tag hph fragment (sequence shown in SEQ ID No. 31);

[0103] Using the NIH2624 Aspergillus terreus genome (https: / / www.ncbi.nlm.nih.gov / datasets / taxonomy / 341663 / , NC BI Taxonomy ID: 341663) as a template, primers melA-UF / melA-UR and melA(hph)-F / melA-DR were used to amplify the upstream homologous arm melA-UP fragment of the spore pigment (the sequence is shown in SEQ ID No. 32) and the downstream homologous arm fragment melA-Down fragment (the sequence is shown in SEQ ID No. 33).

[0104] All PCR products were detected by 0.8% agarose gel electrophoresis and purified by gel excision. Using the fusion PCR method, the four fragments of luc, TpgK, hph and melA-Down were first fused at a molar ratio of 1:2:2:1 to obtain the luc-TpgK-hph-melA-Down fusion fragment; then the three fragments of melA-UP, the promoter in the 28 promoter libraries and luc-TpgK-hph-melA-Down were fused at a molar ratio of 1:2:1 to obtain the fusion fragment (the construction diagram is shown in the figure). Figure 2Finally, the fusion product was diluted 20 times and used as a template, and another round of PCR amplification was performed using primers melA-CF and melA-CR to obtain 28 recombinant expression cassettes E containing different Aspergillus terreus promoters. gXXXX ( Figure 3 ).

[0105] The primer sequences involved in the above construction process are shown in Table 3.

[0106] Table 2

[0107]

[0108]

[0109]

[0110] Table 3

[0111] Primer name Sequence (5'-3') luc-F ATGGAGGACGCCAAGAACATC luc-R TTAGACGTTGATCCTGGCGC TpgK(luc)-F GCGCCAGGATCAACGTCTAATAAATAAATGAAGAATTTTGTG TpgK(hph)-R CTTTACGCTTGCGATCCCGAAATTGCAGCGCACAAGTCAGT hph-F TTCGGGATCGCAAGCGTAAAG hph-R CAATTATCTTTGCGAACCCAGG melA-UF AGGACTGTCGCATCTCGTAG melA-UR GGTGTGGTAGAAGAAATCCCC melA(hph)-F CCTGGGTTCGCAAAGATAATTGTTCGTTTTTATTCGTCCATCG melA-DR GGAAACCGCGACGATCACTAC melA-CF ATCTAGACACCGAAGCCATG melA-CR ATGGTGTCTAGTCTACCAGTTC

[0112] 3) Construction of recombinant strains

[0113] The spores of Aspergillus terreus strain MEFC01 were inoculated into 55 mL of IPM liquid culture medium (IPM was prepared by 100 g / L glucose, 2 g / L NH4NO3, 0.2 g / L (NH4)2HPO4, 20 mg / L FeSO4, 0.4 g / L MgSO4, 40 mg / L ZnSO4, 40 mg / L CuSO4, the pH was adjusted to 3.5 with sulfuric acid, and sterilized at 115°C for 30 min), and cultured at 220 rpm and 37°C for 20 h.

[0114] The grown hyphae were collected by filtration with a sterile monolayer of 500 mesh nylon cloth, and rinsed three times with a sterile 0.6M MgSO4 solution, squeezed dry and placed in a sterile 50mL triangular flask, and an appropriate amount of enzymatic solution was added according to the weight of the hyphae (10mL of enzymatic solution was added for every 1g of hyphae), and treated at 30°C and 130rpm for 1 to 3h. The above enzymatically hydrolyzed mixed solution was filtered with a 300 mesh nylon cloth or lens paper, and the filtrate was collected. Protoplasts were collected by centrifugation at 4°C and 4000rpm, washed once with a precooled 1.2M sorbitol solution, and then washed once with a precooled STC (STC composition is 1.2M sorbitol, 50mM Tris-HCl (pH=8.0), 50mM CaCl2), and finally the protoplasts were resuspended in the precooled STC, and the protoplast concentration was adjusted to 5×10 7 / mL to obtain a protoplast suspension.

[0115] To 150 μL of the protoplast suspension, 10 μL of 28 recombinant expression cassettes containing different Aspergillus terreus promoters were added.gXXXX , then add 50μL of PSTC in ice bath (PSTC composition is 40% PEG4000, 1.2M sorbitol, 50mM Tris-HCl (pH=8.0), 50mM CaCl2), mix gently, and ice bath for 30min. Add 1mL of PSTC at room temperature, mix well, and place at room temperature for 20min. Then mix with 30mL of PDBS top agar and pour on 10 PDAS plates (PDAS plate composition is PDA+1.2M sorbitol) for regeneration screening and culture, and culture at 30℃ in the dark for 5-7 days.

[0116] Transformants with good growth conditions were selected from the transformation screening plate and transferred to the PDA plate and cultured at 30°C for 5 to 6 days. Since the recombinant expression cassette was inserted into the spore pigment melA gene site, positive transformants and false positive transformants can be quickly distinguished based on the color of the spores on the colony surface. Lighter colors are positive transformants, while darker colors are false positives. Figure 4 Schematic diagram of some colonies.

[0117] Subsequently, four positive transformants were selected for single spore isolation and purification, and two single cells were verified for each transformant. The genomic PCR was performed using primers melA-UF and melA-DR. The results were as follows: Figure 5 Thus, Aspergillus terreus strains expressing luciferase from different promoters were obtained, and an Aspergillus terreus promoter library was successfully constructed.

[0118] Example 2 Characterization of the Aspergillus terreus promoter library

[0119] The 28 recombinant strains obtained in Example 1 were inoculated into PDA medium and cultured at 30° C. for 6 to 7 days to enrich spores. After obtaining spores, the spores were plated in a 96-well plate (Perkin Elmer) 282.2 μL of IPM liquid medium (same as in Example 1) was added to a 96-well plate with a white transparent bottom, and then spores of each recombinant strain were added to the 96-well plate, with 3 parallels for each strain; finally, 1.4 mM fluorescein ( beetle luciferin, Potassium salt) and cultured in a microplate shaker at 800 rpm, 37°C in the dark for 9 hours.

[0120] LUC reporter gene, namely luciferase reporter gene, is a reporter gene widely used in molecular biology. Luciferase is an enzyme that can catalyze the oxidation of luciferin to emit biological fluorescence. Its reporter gene system is based on the reaction between firefly luciferase and luciferin. The activity and expression level of luciferase are reflected by detecting the fluorescence signal, thereby indirectly reflecting the expression of the target gene. It is based on this principle that promoters with different expression levels are connected to luciferase luc, and the strength of the chemiluminescent signal can be detected by an enzyme reader to reflect the strength of the promoter.

[0121] First, the chemiluminescence value of each well was collected using an ELISA reader; then the absorbance OD was measured. 595 The bacterial concentration was detected and the chemiluminescence values ​​were normalized to calculate the expression levels of 28 promoters. gpdAt As a positive control, the expression intensity of other promoters was based on promoter P gpdAt The relative expression intensity is expressed as Figure 6 shown.

[0122] like Figure 6 The results showed that the five promoters (P g7031 , P g2820 , P g8803 , P g5035 , P g2000 ) expression intensity was lower than that of the positive control promoter P gpdAt 1%, 16 promoters (P g3329 , P g1220 , P g5630 , P g8690 , P g6920 , P g1404 , P g6796 , P g3561 , P g9110 , P g6114 , P g5571 , P g4602 , P g2710 , P g10239 , P g6323 , P g1175 ) expression intensity was higher than that of the positive control promoter P gpdAt 1% to 20% of the six promoters (P g2319 , P g7765 , P g7389 , P g6906 , P g1297 , P g6625 ) expression intensity reached the positive control promoter P gpdAtIn the 20% to 80% range, there are three promoters (P g6550 , P g6756 , P g6669 ) expression intensity reached the positive control promoter P gpdAt The promoter P encoding the ADP / ATP carrier protein g6756 and the promoter encoding the translation elongation factor EF-1α subunit P g6669 The expression intensity of the positive control promoter P gpdAt 1.6 and 3.0 times.

[0123] The above is only an embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the scope of the claims of the present application.

Claims

1. A method for constructing an Aspergillus terreus promoter library, characterized in that: The method comprises the following steps: Step 1: sequentially connect the promoter to be constructed and the reporter gene to obtain a recombinant expression cassette; the promoter to be constructed is derived from Aspergillus terreus; Step 2: Transfer the recombinant expression cassette into the gene locus related to pigment synthesis of the engineered bacteria to construct the recombinant engineered bacteria, thus obtaining the promoter library.

2. The method according to claim 1, characterized in that The recombinant expression cassette further comprises homology arms of pigment synthesis-related genes; preferably, the recombinant expression cassette further comprises upstream homology arms of pigment synthesis-related genes and downstream homology arms of pigment synthesis-related genes.

3. The method according to claim 1, characterized in that The engineered bacteria include strains of the genus Aspergillus; more preferably, one or more strains are selected from Aspergillus terreus, Aspergillus niger, Aspergillus nidulans, Aspergillus fumigatus, and Aspergillus oryzae; preferably, the engineered bacteria is Aspergillus terreus.

4. The method according to claim 3, characterized in that The pigment synthesis-related genes include pgmA gene, melA gene and / or tretA gene; preferably, the pigment synthesis-related genes include melA gene.

5. The method according to claim 1, characterized in that The reporter gene is selected from one or more of a luciferase reporter gene, a fluorescent marker gene, and a resistance gene; preferably, the reporter gene includes a luciferase reporter gene.

6. The method according to claim 1, characterized in that The recombinant expression cassette also includes a terminator.

7. The method according to claim 1, characterized in that The method for introducing the recombinant expression cassette into Aspergillus terreus is selected from the group consisting of protoplast transformation, electroporation, gene gun method, and Agrobacterium-mediated method; preferably, protoplast transformation method.

8. A method for screening an Aspergillus terreus promoter, characterized in that: The method comprises: Step 1: sequentially connect the promoter to be constructed and the reporter gene to obtain a recombinant expression cassette; the promoter to be constructed is derived from Aspergillus terreus; Step 2: transferring the recombinant expression cassette into the gene locus related to pigment synthesis of the engineered bacteria to construct the recombinant engineered bacteria; Step 3: Detect the expression level of the reporter gene in the recombinant engineered bacteria.

9. An Aspergillus terreus promoter obtained by the screening method according to claim 8.

10. Use of the promoter according to claim 9 in a recombinant strain of Aspergillus terreus.

Images