Method for modifying endogenous CD5 gene of cell and application thereof

Abstract

The invention relates to a method for modifying an endogenous CD5 gene of a cell, the endogenous CD5 gene modified cell prepared by using the method and application of the endogenous CD5 gene modified cell. The gene modified cell prepared by the method for modifying the endogenous CD5 gene of the cell can be applied to immunotherapy so as to avoid the off-target problem, and when the prepared endogenous CD5 gene modified CAR-T cell is applied to cell therapy, the proliferation level, the duration and the killing ability of the CAR-T cell of a targeted CD5 antigen can be ensured, and the cell endogenous CD5 gene modified CAR-T cell can be applied to immunotherapy. The treatment effect is realized. The invention also provides the gRNA which can effectively reduce the CD5 antigen expression of the cell and is used for preparing the cell with reduced CD5 antigen expression.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and more specifically, to a method for modifying endogenous CD5 gene of cells, endogenous CD5 gene-modified cells prepared by the method, and applications thereof. Background Art

[0002] At present, disease is still the primary obstacle to human life and health. To this end, researchers have made great efforts to develop immunotherapy methods including cell therapy, which work by targeting disease targets to achieve safe and effective treatment goals. However, when immunotherapy targeting antigens associated with diseases or conditions (such as CAR-T cell therapy) is administered to subjects, the therapy can not only deplete the pathological cells intended to be targeted, but also has the risk of depleting non-pathological cells that can express targeted antigens. Some CAR-T cell therapies (such as therapies targeting targets CD19 or CD33) have reported this situation. If the targeted antigen is expressed on the surface of normal cells required for the survival of the subject, or on the surface of cells that will significantly damage the health of the subject if consumed, the subject may not be able to accept the immunotherapy, or need to bear the serious side effects that may occur once the therapy is administered. In another case, when the same antigen is also expressed on the immune effector cells used in the immunotherapy to be administered, for example, when the target antigen is also expressed on the cell surface of CAR-T cells, it may cause the immune effector cells to kill each other and make the corresponding therapy unable to achieve the expected effect or have no effect at all.

[0003] Solutions such as gene editing can be used to prepare cells that lack expression of relevant antigens to reduce or compensate for the adverse consequences of these problems. For example, if the healthy hematopoietic cells of the subject express antigens, engineered hematopoietic cells can be prepared to make the expression of the relevant antigens of the cells lack, and then such engineered hematopoietic cells (such as hematopoietic stem cells or progenitor cells) are administered to the subject. These hematopoietic stem cells or progenitor cells can re-reinforce the hematopoietic capacity in the subject's body and reconstruct various hematopoietic lineages through proliferation, including hematopoietic lineages that may have been eliminated by targeted therapeutic drugs.

[0004] CD5, also known as Lyt-1, belongs to type I transmembrane glycosylated proteins. CD5 is considered to be a pan-T cell marker, which is expressed at various developmental and activation stages of T cells, thymocytes, and B cell subsets (called B-1a cells). CD5 plays an important role in the negative regulation of T cell receptor signaling, and is also believed to play a role in immune tolerance and negative regulation of B cell receptor signaling. CD5 is also one of the characteristic surface markers of malignant T cell tumors. About 80% of T cell malignancies express CD5. For example, CD5 is highly expressed in 80% of T-ALL patients and about 75% of peripheral T cell lymphoma patients. In addition, CD5 is also expressed in some malignant B cell tumors. For example, CD5 is also expressed in tumor cells of mantle cell lymphoma, chronic lymphocytic leukemia (B-CLL), and hairy cell leukemia (HCL). Therefore, it is an attractive target for the treatment of such diseases.

[0005] To this end, the present invention provides cells modified to reduce endogenous CD5 gene expression, which will not become the target of targeted immunotherapy drugs, and will not cause the problem of "accidental" clearance by drugs. The cells can be administered to subjects receiving targeted antigen therapy, for example, by administering the cells to replace healthy cells that may have been targeted and killed by targeted therapeutic drugs, or to provide a healthy cell population resistant to targeted therapeutic drugs.

[0006] Commonly used gene editing systems in the field of cell gene editing (modification) include, for example, ZFNs, TALENs, CRISPR / Cas systems, etc. The CRISPR gene editing system is a fast and effective gene editing method, among which the CRISPR / Cas9 system is one of the most widely used CRISPR / Cas systems, which can efficiently and accurately modify, replace and insert target DNA sequences, and has shown great potential in many biological applications. The mechanism of gene editing by the CRISPR / Cas9 system includes: the CRISPR array homologous to the specific target sequence (protospacer sequence) is transcribed into many pre-CRISPR RNAs (pre-crRNAs), which form complexes with smaller trans-activating crRNAs (tracrRNAs) through base pairing. This complex can bind to the Cas9 protein, resulting in the longer pre-crRNA being cut by RNase III and separated into separate crRNA / tracrRNA complexes. When crRNA / tracrRNA guides the Cas9 complex to the target sequence, crRNA binds to the target sequence after the protospacer adjacent motif (PAM), the target sequence unwinds, and is cut by the nuclease domain (RuvC and HNH) of the Cas9 protein, causing a double-strand break. This then activates the cell's non-homologous end joining (NHEJ) or homology directed repair (HDR) repair mechanisms, thereby achieving gene knockout, insertion or modification. By bioengineering crRNA and tracrRNA, they are combined into a guide RNA (gRNA) molecule with crRNA and tracrRNA functions. The gRNA molecule complements the target DNA sequence and determines the specificity of the directional cutting of the Cas9 protein. Part of the sequence of the gRNA molecule can bind to the Cas nuclease, and another part of the sequence can be complementary to part of the sequence of the target gene. With the help of the recognition of the gRNA molecule, the Cas nuclease can form a single-stranded or double-stranded cut at a specific site of the target gene, thereby editing the target gene.

[0007] In recent years, based on the efficient and precise gene editing function of the CRISPR / Cas9 gene editing system, it has been widely used in gene editing of mammalian cells, which has also greatly promoted the progress of tumor immunotherapy, especially greatly promoted the preparation and application of chimeric antigen receptor T cells (CAR-T cells).

[0008] Chimeric Antigen Receptor (CAR) modified T cells are widely used as an immunotherapy strategy in the treatment of many solid tumors, hematological tumors, especially lymphocytic tumors. Chimeric antigen receptor is a recombinant polypeptide construct, and its representative structure consists of four parts: extracellular antigen binding domain (usually a single-chain antibody with antigen recognition function), hinge region, transmembrane domain and intracellular signal transduction domain. Usually, according to whether the intracellular signal transduction domain adds co-stimulatory molecules and the number of added, the classic chimeric antigen receptor structure is divided into the first generation (no co-stimulatory molecules), the second generation (containing one co-stimulatory molecule) and the third generation (containing two co-stimulatory molecules). So far, the second-generation chimeric antigen receptor structure design is most widely used in marketed products and clinical research stages. The principle of chimeric antigen receptors is to modify T cells through genetic engineering so that they express a receptor structure (for example, a single-chain antibody) that can specifically recognize tumor cell surface antigens. After the receptor specifically binds to the tumor cell surface antigen, it activates its downstream immune co-stimulatory molecules and T cells, breaking through the restriction of the major histocompatibility complex (MHC), directly and specifically identifying and killing tumor cells, and achieving the purpose of targeted elimination of malignant tumors.

[0009] Since CD5 antigen is expressed on the surface of mature T cells, there is a phenomenon in the process of preparing CAR-T cells targeting CD5 that CAR-T cells recognize their own antigens and kill each other, which significantly reduces the survival time and killing ability of CAR-T cells. In order to solve the problem caused by this "suicide" phenomenon, the present invention uses the CRISPR / Cas9 gene editing system to pre-genetically modify T cells so that the expression of CD5 gene is reduced. Summary of the invention

[0010] The present invention provides a method for modifying the endogenous CD5 gene and cells prepared by the method, such as hematopoietic cells, immune cells, lymphocytes (e.g., T cells). The cell has a reduced expression of the CD5 antigen so that it can not be recognized by CD5-specific immunotherapy. The present invention also provides a method for applying the cell or a composition comprising it to a subject to solve the off-target problem in immunotherapy, and the cell or a composition comprising it is resistant to the killing of CD5-specific immunotherapy. The endogenous CD5 gene-modified cells provided by the present invention can also solve the problem of cannibalism of immune effector cells targeting CD5, for example, when the cell is a CAR-T cell targeting CD5, it has a reduced expression of the CD5 antigen, so the cannibalism of CAR-T cells targeting CD5 can be weakened or not occur, thereby improving the biological activity of the corresponding cells and ensuring the effectiveness of treatment.

[0011] According to the first aspect of the present disclosure, the present invention provides a method for modifying the endogenous CD5 gene of a cell, the method comprising:

[0012] providing a cell to be genetically modified;

[0013] Introducing an agent into a cell to be genetically modified, the agent comprising: (i) a gRNA targeting an endogenous CD5 gene of the cell or an expression vector for expressing the gRNA, wherein the gRNA comprises a spacer sequence selected from

[0014] SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 or SEQ ID

[0015] NO: 18 any one of the nucleic acid sequences shown, and (ii) Cas9 protein or its functional variant, or an expression vector expressing the Cas9 protein or its functional variant;

[0016] harvesting the genetically modified cells;

[0017] The expression of CD5 antigen in the genetically modified cells is reduced.

[0018] In some embodiments, the present invention provides a method for modifying the endogenous CD5 gene of a cell, the method comprising:

[0019] providing a cell to be genetically modified;

[0020] Introducing an agent into a cell to be genetically modified, the agent comprising: (i) a gRNA targeting an endogenous CD5 gene of the cell or an expression vector for expressing the gRNA, wherein the gRNA comprises a spacer sequence selected from

[0021] A nucleic acid sequence as shown in any one of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:17, and (ii) a Cas9 protein or a functional variant thereof, or an expression vector expressing the Cas9 protein or a functional variant thereof;

[0022] harvesting the genetically modified cells;

[0023] The expression of CD5 antigen in the genetically modified cells is reduced.

[0024] In some embodiments, the methods provided herein result in at least a 50% reduction, at least a 60% reduction, or at least a 70% reduction in the expression of the CD5 antigen in the genetically modified cell.

[0025] In some embodiments, the methods provided herein reduce the expression of the CD5 antigen in the genetically modified cells by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0026] In some embodiments, the method provided by the present invention introduces the agent into the cell to be genetically modified by electroporation, nuclear transfection, viral transduction or transfection, lipid nanoparticle transduction. In some embodiments, the method of introducing the agent into the cell to be genetically modified is electroporation.

[0027] The gRNA molecules described in the method provided by the present invention are used together with the Cas9 protein to achieve gene editing of the endogenous CD5 gene of the cell. The Cas9 protein exhibits nuclease activity, which introduces double-stranded DNA breaks in the target site or directly adjacent to the target site. Various Cas nucleases (such as Cas9) are known in the art and can be obtained from various sources and / or transformed / modified to regulate one or more activities or specificities of the enzyme. The PAM sequence and specificity of suitable Cas9 nucleases (such as spCas9 and saCas9) are known in the art.

[0028] In some embodiments, the cells to be genetically modified in the methods provided by the present invention are stem cells. In some embodiments, the stem cells in the methods provided by the present invention can be selected from embryonic stem cells (ESC), induced pluripotent stem cells (iPSC), mesenchymal stem cells or tissue-specific stem cells or any combination thereof.

[0029] In some embodiments, the cells to be genetically modified in the methods provided by the present invention are hematopoietic cells.

[0030] In some embodiments, the hematopoietic cells in the methods provided herein are hematopoietic stem cells or hematopoietic progenitor cells.

[0031] In some embodiments, the cells to be genetically modified in the methods provided by the present invention are immune effector cells.

[0032] In some embodiments, the immune effector cells in the methods provided by the present invention can be selected from T cells, B cells, NK cells, macrophages, dendritic cells, immune effector cells differentiated from induced pluripotent stem cells (iPSCs), or any combination thereof.

[0033] In some embodiments, the immune effector cell described in the method provided by the present invention is a T cell. In some embodiments, the T cell described in the method provided by the present invention can be selected from CD4+ / CD8+T cells, CD4+ / CD8-T cells, CD4- / CD8+T cells, CD4- / CD8-T cells, CD4+ helper T cells (such as Th1 and Th2 cells), CD8+T cells (for example, cytotoxic T cells), tumor infiltrating cells, memory T cells, naive T cells, γδ-T cells, αβ-T cells, NKT cells, DNT cells (double negative T cells).

[0034] In some embodiments, the T cells in the methods provided herein are CD4+ / CD8- T cells, CD4- / CD8+ T cells, CD4+ / CD8+ T cells, CD4- / CD8- T cells, or any combination thereof.

[0035] In some embodiments, the method for modifying the endogenous CD5 gene of a cell provided by the present invention further includes the following steps: preparing a reagent before introducing the reagent into the cell to be genetically modified, the step comprising: mixing crRNA and tracrRNA to form a gRNA complex, and mixing the gRNA complex with Cas9 protein to obtain the reagent.

[0036] In some embodiments, the method for modifying the endogenous CD5 gene of a cell provided by the present invention further includes the following steps: a step of preparing a reagent before introducing the reagent into the cell to be genetically modified, the step comprising: adding crRNA and tracrRNA in a ratio of 1:1 to Nuclease-Free Duplex Buffer with a total volume of 100 μL, annealing at 95°C for 5 minutes to obtain a gRNA complex, and mixing the gRNA complex with the Cas9 protein to obtain the reagent.

[0037] In some embodiments, the method for modifying the endogenous CD5 gene of a cell provided by the present invention further includes the following steps: a step of preparing a reagent before introducing the reagent into the cell to be genetically modified, the step comprising: adding crRNA and tracrRNA in a ratio of 1:1 to Nuclease-Free Duplex Buffer with a total volume of 100 μL, annealing at 95°C for 5 min to obtain a gRNA complex, and respectively adding the gRNA complex, Cas9 protein and 1 μM electroporation enhancer to Opti-MEM to obtain the reagent.

[0038] In some embodiments, the method for modifying the endogenous CD5 gene of a cell provided by the present invention further comprises activating the cell before introducing the agent into the cell to be genetically modified.

[0039] In some embodiments, the method for modifying the endogenous CD5 gene of a cell provided by the present invention further comprises amplifying the obtained cells after harvesting the genetically modified cells.

[0040] According to the second aspect of the present disclosure, the present invention provides a method for transducing a vector comprising a nucleic acid molecule expressing a targeting ligand capable of specifically recognizing an antigen into the cell prepared according to the first aspect of the present disclosure.

[0041] In some embodiments, the method provided by the present invention for transducing a vector comprising a nucleic acid molecule expressing a targeting ligand capable of specifically recognizing an antigen into a cell prepared in the first aspect of the present disclosure comprises: before introducing an agent into the cell to be genetically modified, transducing a vector comprising a nucleic acid molecule expressing a targeting ligand capable of specifically recognizing an antigen into the cell. In some embodiments, the method provided by the present invention for transducing a vector comprising a nucleic acid molecule expressing a targeting ligand capable of specifically recognizing an antigen into a cell prepared in the first aspect of the present disclosure comprises: after introducing an agent into the cell to be genetically modified, transducing a vector comprising a nucleic acid molecule expressing a targeting ligand capable of specifically recognizing an antigen into the cell.

[0042] In some embodiments, the targeting ligand capable of specifically recognizing an antigen described in the method provided by the present invention can be selected from a chimeric antigen receptor (CAR), a T cell antigen receptor (TCR) or a B cell antigen receptor (BCR). In some embodiments, the targeting ligand capable of specifically recognizing an antigen described in the method provided by the present invention is a chimeric antigen receptor (CAR).

[0043] In some embodiments, the vector described in the method provided by the present invention is a viral vector or a non-viral vector. In some embodiments, the viral vector described in the method provided by the present invention can be selected from a lentiviral vector, a retroviral vector, an adenoviral vector or an adeno-associated viral vector. In some embodiments, the viral vector described in the method provided by the present invention is a lentiviral vector.

[0044] In some embodiments, the method provided by the present invention for transducing a vector comprising a nucleic acid molecule expressing a targeting ligand capable of specifically recognizing an antigen into the cells prepared in the first aspect comprises the following steps: preparing endogenous CD5 gene-modified cells according to the method described in the first aspect of the present disclosure; transducing a vector comprising a nucleic acid molecule expressing a targeting ligand capable of specifically recognizing an antigen into the cells.

[0045] In some embodiments, the present invention provides a method for transducing a vector comprising a nucleic acid molecule expressing a chimeric antigen receptor capable of specifically recognizing a CD5 antigen into a cell prepared according to the method of the first aspect of the present disclosure.

[0046] In some embodiments, the present invention provides a method for preparing chimeric antigen receptor T cells with modified endogenous CD5 gene, wherein the method comprises the cell preparation method as described above, and the cells are human T cells.

[0047] According to the third aspect of the present disclosure, the present invention provides a gRNA targeting endogenous CD5 gene in cells, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in any one of SEQ ID NOs: 1-18.

[0048] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in any one of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:17.

[0049] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:1.

[0050] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:2.

[0051] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:3.

[0052] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:4.

[0053] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:5.

[0054] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:6.

[0055] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:7.

[0056] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:8.

[0057] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:9.

[0058] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:10.

[0059] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:11.

[0060] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:12.

[0061] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:13.

[0062] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:14.

[0063] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:15.

[0064] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:16.

[0065] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:17.

[0066] In some embodiments, the present invention provides a gRNA targeting an endogenous CD5 gene in a cell, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in SEQ ID NO:18.

[0067] The technical solution disclosed by the present invention, wherein the specific nucleic acid sequence information shown in SEQ ID NO: 1-18 is as shown in Table 1.

[0068] Table 1

[0069]

[0070] The gRNA provided by the present invention can bind to the target site in the endogenous CD5 genome of the cell, and can achieve effective and even more efficient modification of the genome, resulting in reduced expression of the cell's CD5 antigen, or non-recognition by immunotherapy drugs targeting CD5, thereby making the genetically modified cells have medical application prospects.

[0071] According to a fourth aspect of the present disclosure, the present invention provides a reagent for preparing cells modified with an endogenous CD5 gene, the reagent comprising:

[0072] (i) a gRNA targeting the endogenous CD5 gene of a cell or an expression vector for expressing the gRNA, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence selected from any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 or SEQ ID NO: 18, and (ii) a Cas9 protein or a functional variant thereof, or an expression vector expressing the Cas9 protein or a functional variant thereof.

[0073] In some embodiments, the present invention provides a reagent for preparing a cell modified with an endogenous CD5 gene, the reagent comprising:

[0074] (i) a gRNA targeting the endogenous CD5 gene of a cell or an expression vector for expressing the gRNA, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence selected from any one of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 17, and (ii) a Cas9 protein or a functional variant thereof, or an expression vector expressing the Cas9 protein or a functional variant thereof.

[0075] According to a fifth aspect of the present disclosure, the present invention provides an endogenous CD5 gene-modified cell, wherein the cell is prepared by the method described in the first aspect of the present disclosure.

[0076] In some embodiments, the expression of CD5 antigen in the endogenous CD5 gene-modified cells provided by the present invention is reduced by at least 50%, at least 60%, or at least 70%.

[0077] In some embodiments, the expression of CD5 antigen in the endogenous CD5 gene modified cells provided by the present invention is reduced by at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0078] In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention further include a targeting ligand capable of specifically recognizing an antigen. In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention further include a targeting ligand capable of specifically recognizing an antigen, which may be selected from a chimeric antigen receptor (CAR), a T cell antigen receptor (TCR), and a B cell antigen receptor (BCR). In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention further include a targeting ligand capable of specifically recognizing an antigen as a chimeric antigen receptor (CAR).

[0079] In some embodiments, the endogenous CD5 gene modified cells provided by the present invention, wherein the chimeric antigen receptor (CAR) comprises an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain capable of specifically recognizing the CD5 antigen. In some embodiments, the endogenous CD5 gene modified cells provided by the present invention, wherein the chimeric antigen receptor further comprises a costimulatory domain.

[0080] In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention, wherein the extracellular antigen-binding domain capable of specifically recognizing the CD5 antigen comprises a single-chain antibody (scFv), a single-domain antibody (sdAb) or a heavy-chain antibody (HCAb). In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention, wherein the extracellular antigen-binding domain capable of specifically recognizing the CD5 antigen comprises a single-chain antibody (scFv). In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention, wherein the extracellular antigen-binding domain capable of specifically recognizing the CD5 antigen comprises a single-domain antibody (sdAb).

[0081] In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention, wherein the transmembrane domain is derived from CD8α and / or CD28. In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention, wherein the intracellular signaling domain is derived from CD3ζ. In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention, wherein the costimulatory signaling domain is derived from CD28, CD27, 4-1BB (CD137), OX40 and / or CD278 (ICOS).

[0082] In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention, wherein the chimeric antigen receptor further comprises a hinge region located between the C-terminus of the extracellular antigen binding domain and the N-terminus of the transmembrane domain. In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention, wherein the hinge region is derived from CD8α.

[0083] In some embodiments, the endogenous CD5 gene modified cells provided by the present invention, wherein the chimeric antigen receptor further comprises a signal peptide located at the N-terminus of the chimeric antigen receptor polypeptide. In some embodiments, the endogenous CD5 gene modified cells provided by the present invention, wherein the signal peptide is derived from HLA-A and / or CD8α.

[0084] In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention are hematopoietic cells.

[0085] In some embodiments, the endogenous CD5 gene-modified hematopoietic cells provided by the present invention are hematopoietic stem cells or hematopoietic progenitor cells.

[0086] In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention are immune effector cells.

[0087] In some embodiments, the endogenous CD5 gene-modified immune effector cells provided by the present invention can be selected from T cells, B cells, NK cells, macrophages, dendritic cells, immune effector cells differentiated from induced pluripotent stem cells (iPSCs), or any combination thereof.

[0088] In some embodiments, the immune effector cells of endogenous CD5 gene modification provided by the present invention are T cells. In some embodiments, the T cells of endogenous CD5 gene modification provided by the present invention can be selected from CD4+ / CD8+T cells, CD4+ / CD8-T cells, CD4- / CD8+T cells, CD4- / CD8-T cells, CD4+ helper T cells (such as Th1 and Th2 cells), CD8+T cells (for example, cytotoxic T cells), tumor infiltrating cells, memory T cells, naive T cells, γδ-T cells, αβ-T cells, NKT cells, DNT cells (double negative T cells).

[0089] In some embodiments, the endogenous CD5 gene-modified T cells provided by the present invention can be selected from CD4+ / CD8-T cells, CD4- / CD8+T cells, CD4+ / CD8+T cells, CD4- / CD8-T cells, or any combination thereof.

[0090] According to the sixth aspect of the present disclosure, the present invention provides a gene editing system, which comprises the gRNA described in the third aspect of the present disclosure or the reagent described in the fourth aspect.

[0091] The gene editing system of the present invention is selected from the CRISPR / Cas system. The CRISPR / Cas system includes type I, type II, type III, type IV, type V or type VI CRISPR / Cas systems. Cas proteins include, for example, Cas1, Cas2, Cas3, Cas4, Csn2, Cas7, Cas8, Cas9, Cas10, Cas11, Cas12, Cas12a (Cpf1), Cas13 or Cas14 proteins. In some embodiments, the CRISPR / Cas system used in the present invention is a CRISPR / Cas9 system belonging to a type II system. The CRISPR / Cas9 system is used in gene editing, in which the targeting sequence specifically binds to the DNA sequence of the target gene, guides the Cas9 nuclease to cut the DNA double strand, and activates non-homologous end connection to achieve the purpose of gene modification.

[0092] According to the prior art, there is a certain degree of fratricide in CAR-T cells targeting CD5, and the fratricide of T cells limits the viability of CAR-T cells, resulting in a limited duration of survival in the patient. In order to solve this problem, the present invention uses CRISPR / Cas9 gene editing technology to reduce the expression of CD5 antigen on CAR-T cells. The reagents used in the CRISPR / Cas9 gene editing system provided by the present invention include gRNA targeting the endogenous CD5 gene of the cell or an expression vector for expressing the gRNA. In some embodiments, the reagents used in the CRISPR / Cas9 system provided by the present invention include gRNA targeting the endogenous CD5 gene of the cell or an expression vector for expressing the gRNA, and Cas9 protein or its functional variant, or an expression vector expressing the Cas9 protein or its functional variant.

[0093] In some embodiments, the gRNA provided by the present invention includes crRNA and tracrRNA, wherein the crRNA is composed of a spacer sequence and an additional sequence. The additional sequence and tracrRNA sequence included in the gRNA provided by the present invention are well known in the art, such as the sequence described in WO2017093969A. For example, the additional sequence is

[0094] The tracrRNA sequence is GUUUUAGAGCUAUGCU.

[0095] AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUU.

[0096] The PAM sequence includes NGG, NAG, NGN, NNGRRT, NNNRRT, NNAGAAW, NGGNG, NNNNGATT, NNNNACAC, NNNNRYAC, NGAN, NGNG, NGAG, TTN, TTTN or NGCG, wherein N is any nucleic acid base, R is purine, and Y is pyrimidine. In some embodiments, the PAM sequence involved in the CRISPR / Cas9 system used in the present invention is shown in Table 1.

[0097] The CRISPR / Cas9 gene editing system provided by the present invention, when combined with a suitable gRNA, has a good knockout efficiency of the endogenous CD5 gene in cells, and can reduce the suicide rate of CAR-T cells targeting CD5 to a minimum, while not affecting the proliferation of CAR-T cells, maintaining their survival time and killing ability in the patient's body.

[0098] According to the seventh aspect of the present disclosure, the present invention provides a pharmaceutical composition, which comprises the endogenous CD5 gene-modified cells disclosed in the fifth aspect of the present invention, and one or more pharmaceutically acceptable excipients and / or carriers.

[0099] Excipients and / or carriers are also commonly referred to as adjuvants. A pharmaceutically acceptable carrier refers to a pharmaceutically acceptable carrier, which is not usually the same substance as a carrier used to insert nucleic acids in genetic engineering. Those skilled in the art will appreciate that pharmaceutically acceptable excipients and / or carriers are nontoxic or substantially nontoxic to the recipient at the dosage and concentration used, and are pharmacologically and / or physiologically compatible with the active ingredients of the present invention, such as not affecting their viability or efficacy. In some embodiments, the pharmaceutical composition may contain substances for improving, maintaining or retaining, for example, the pH, permeability, viscosity, clarity, color, isotonicity, odor, sterility, stability, release rate, absorption or penetration of the composition. The optimal pharmaceutical composition can be determined based on the expected route of administration, delivery mode and required dosage. Examples of pharmaceutically acceptable excipients and / or carriers are described in Remington and Gennaro, Remington's Pharmaceutical Sciences (18th edition, 1990). Pharmaceutically acceptable excipients and / or carriers refer to any excipients, fillers, salts, stabilizers, solubilizers, oils, lipids, lipid-containing vesicles, microspheres, liposome encapsulation, adsorbents, antioxidants, solvents, co-solvents, buffers, chelating agents, surfactants, wetting agents, emulsifiers, coating agents, isotonic agents, absorption delay agents, tension regulators, diluents, preservatives and / or adjuvants. In some embodiments, the excipients and / or carriers that can be used in the present invention include, but are not limited to, one or more of water, saline solution, buffer, glucose, glycerol, ethanol, and polyols.

[0100] The pharmaceutical composition of the present invention can be provided in the form of, for example, a sterile preparation. The form of a sterile preparation is, for example, an isotonic aqueous solution, a suspension, an emulsion, a dispersion, etc. The solvent or medium of the pharmaceutical composition can be one or more of water, ethanol or a polyol. The present invention can sterilize the pharmaceutical composition by, for example, filtering with a sterile filtration membrane. When the composition is freeze-dried, this method can be used for sterilization before or after freeze-drying, reconstitution, dilution. The composition for parenteral administration can be stored in a freeze-dried form or in a solution. It can be prepared by conventional methods, for example, with physiological saline or an aqueous solution containing glucose and other adjuvants. The pharmaceutical composition of the present invention can be provided in other forms that are obvious to those skilled in the art, for example, it can be provided as a sustained-release or controlled-release composition. The techniques for preparing sustained-release or controlled-release drugs (such as liposome carriers, bio-erodible microparticles, porous beads or accumulated injections) are also well known to those skilled in the art. For example, prolonged absorption of an injectable composition can be achieved by including an adjuvant such as monostearic acid or gelatin in the composition that delays absorption. The pharmaceutical composition can be stored in a sterile vial in the form of a solution, suspension, gel, emulsion, viscous composition, solid, crystal or lyophilized powder. The pharmaceutical composition can be stored in a ready-to-use form or in a form that is reconstituted and processed for use before administration. The preparation method of the pharmaceutical composition of the present invention is obvious to those skilled in the art.

[0101] Pharmaceutical composition of the present invention can be used in any convenient way, including by spraying, injection, swallowing, infusion, implantation or transplantation. Pharmaceutical composition of the present invention can be injected by intravenous, intraperitoneal, intracerebral (in the brain parenchyma), intraventricular, intramuscular, intraocular, intraarterial, portal vein or intralesional approach, and can also be used by sustained release system or by implantation device. In some embodiments, pharmaceutical composition of the present invention is used by parenteral. Parenteral delivery method includes local, intraarterial, intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular, intravenous, intraperitoneal, intrauterine, intravaginal, sublingual or intranasal administration.

[0102] The therapeutically effective amount of the pharmaceutical composition comprising the cells modified by the endogenous CD5 gene of the present invention will depend on, for example, the extent and goal of the treatment. It is known to those skilled in the art that the appropriate dosage level for treatment will depend in part on the delivered molecule, indication, route of administration, and patient condition (body weight, body surface or organ size) and / or condition (age and general health). In some embodiments, the clinician may adjust the dosage and change the route of administration to obtain the best therapeutic effect.

[0103] The frequency of administration will depend on the pharmacokinetic parameters of the pharmaceutical composition of the present invention. Clinicians usually administer the pharmaceutical composition until the dosage for achieving the desired effect is reached. Therefore, the pharmaceutical composition can be administered as a single dose, or administered over time in two or more doses (which may or may not contain the same amount of the desired molecule), or administered in a continuous infusion via an implantable device or catheter.

[0104] According to the eighth aspect of the present disclosure, the present invention provides a use of an endogenous CD5 gene-modified cell as described in the fifth aspect of the present disclosure or a pharmaceutical composition as described in the seventh aspect of the present disclosure in the preparation of a medicament for diagnosing, preventing and / or treating a disease or condition.

[0105] In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention or pharmaceutical compositions comprising the cells are used in the preparation of drugs for diagnosing, preventing and / or treating diseases or conditions, wherein the diseases or conditions include diseases or conditions associated with CD5 expression.

[0106] In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention or pharmaceutical compositions comprising the cells are used in the preparation of drugs for diagnosing, preventing and / or treating diseases or conditions, wherein the diseases or conditions include cancers or tumors associated with CD5 expression.

[0107] In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention or pharmaceutical compositions comprising the cells are used in the preparation of drugs for diagnosing, preventing and / or treating diseases or conditions, wherein the diseases or conditions include malignant T cell tumors or malignant B cell tumors associated with CD5 expression.

[0108] In some embodiments, the endogenous CD5 gene-modified cells provided by the present invention or pharmaceutical compositions comprising the cells are used in the preparation of drugs for diagnosing, preventing and / or treating diseases or conditions, wherein the diseases or conditions include T-cell leukemia, T-cell lymphoma or B-cell lymphoma.

[0109] In some embodiments, the endogenous CD5 gene modified cells provided by the present invention or the pharmaceutical composition comprising the cells are used in the preparation of a medicament for diagnosing, preventing and / or treating a disease or condition, wherein the disease or condition includes acute T lymphocytic leukemia, acute T lymphocytic lymphoma, T lymphoblastoma, peripheral T cell lymphoma, cutaneous T cell lymphoma, chronic lymphocytic leukemia, mantle cell lymphoma or diffuse large B cell lymphoma.

[0110] The endogenous CD5 gene modified cells of the present invention can be used in combination with other drugs. In the combination of drugs, the cells and other drugs can be administered simultaneously or at different times, such as in a short period of time. Cells and reagents can be mixed or present in separate packaging or dosage forms. Combination drugs can be administered in the same treatment process, such as in the process of treating a subject with anti-CD5 immunotherapy, an effective amount of cells of the present invention can be administered to the subject simultaneously or sequentially (e.g., before, during or after treatment with anti-CD5 immunotherapy).

[0111] In the CRISPR / Cas system used in the present invention, the design of gRNA needs to consider many factors, such as length, base composition, binding position of target gene, binding rate with non-target site, whether SNP, secondary structure, etc. are included. At present, gRNA can be designed by various online tools. However, since Cas protein can cut any target sequence adjacent to PAM site, for a specific target gene, the editing efficiency of a large number of gRNAs designed by online tools is not the same, and even very different. Therefore, screening gRNA with high specificity is crucial for improving the editing efficiency of CRISPR / Cas system. The gRNA of the present invention has good gene editing efficiency after a large number of screenings and verification of endogenous gene knockout rate of cells, and the expression rate of CD5 antigen is significantly reduced compared with wild-type cells (control cells in which endogenous CD5 gene is not genetically modified and normally expresses CD5 antigen).

[0112] The endogenous CD5 gene-modified cells disclosed in the present invention or pharmaceutical compositions comprising these cells can be administered to patients with malignant tumor diseases expressing CD5 antigen on tumor cells. These patients are suitable subjects for immunotherapy targeting CD5 antigen, but due to the adverse off-target risk of immunotherapy, the risk of taking the medicine is greater than the benefit, making it impossible for patients to take the medicine normally. The gene modification method of the present invention can reduce the expression of CD5 antigen on the relevant administered cells. Therefore, the administration of the endogenous CD5 gene-modified cells of the present invention or pharmaceutical compositions comprising these cells can improve the off-target risk of immunotherapy, because the immunotherapy drugs targeting CD5 cannot effectively target the cells of the present invention.

[0113] When a cell therapy targeting CD5, such as CAR-T cell therapy, is administered to a subject, since the surface of the CAR-T cells expresses a CAR targeting CD5, and a portion of the CAR-T cells also express CD5 antigens, the "fratricide" between the CAR-T cells will affect the effectiveness of the therapy, so there may be such a risk: before achieving the desired clinical results (such as the elimination of malignant cells expressing CD5 in the patient's body), most or all of the CAR-T effector cells have been eliminated due to "fratricide". The administration of endogenous CD5 gene-modified cells of the present invention, such as CAR-T cells with reduced CD5 antigen expression as immune effector cells in cell therapy, can eliminate this "fratricide" phenomenon and its negative impact on the therapeutic effect.

[0114] The CRISPR / Cas system can be delivered into cells by any method known in the art, for example, by applying the system directly to human cells by transfection with a plasmid encoding the Cas protein and gRNA, using a viral vector for delivery, or physically delivering the system. Adenovirus vectors (AAV) are often selected for in vivo gene delivery in somatic cell gene therapy. The viral vector for delivery of the CRISPR / Cas system can be selected from adenovirus, lentivirus, and bacteriophage; non-viral vectors can be selected from liposomes such as Lipofectamine TM , polymers and gold nanoparticles. The physical method of delivering the CRISPR / Cas gene editing system can be selected from electroporation, microinjection, etc. Electroporation technology can increase the permeability of the cell membrane by applying an electric field to the cell, thereby allowing chemicals, drugs, DNA, RNA or proteins to be introduced into the cell. And because viruses (including lentiviruses, retroviruses or adenoviruses) have low efficiency in transducing T cells, and they have toxicity associated with the prolonged expression of CRISPR / Cas, electroporation has been used as a high-efficiency, low-toxicity delivery method in the delivery of the CRISPR / Cas system.

[0115] gRNA can be synthesized chemically and / or enzymatically. For example, gRNA can be synthesized using a standard solid phase synthesis method based on phosphoramidite. Alternatively, gRNA can be synthesized in vitro by operably linking the DNA encoding the gRNA to a promoter control sequence recognized by a bacteriophage or RNA polymerase. Examples of suitable phage promoter sequences include T7, T3, SP6 promoter sequences, or variants thereof.

[0116] gRNA can be amplified by PCR or constructed plasmid expression. Using plasmid expression, the nucleic acid pair encoding the gRNA can be annealed and connected to the plasmid and transformed into competent cells. For example, the gRNA is cloned into a plasmid such as pSpCas9 (BB) and then transformed into a competent Escherichia coli strain.

[0117] gRNA can be introduced into the cell as an RNA molecule. For example, the RNA molecule can be in vitro transcribed and / or can be chemically synthesized; RNA can be transcribed from a synthetic DNA molecule (e.g., a gene fragment), and then, the gRNA can be introduced into the cell as an RNA molecule. gRNA can also be introduced into the cell in the form of a non-RNA nucleic acid molecule (e.g., a DNA molecule). For example, the DNA encoding the gRNA can be operably linked to a promoter control sequence to express the gRNA in the target cell. The RNA coding sequence can be operably linked to a promoter sequence recognized by RNA polymerase III (Pol III). Plasmid vectors that can be used to express gRNA include, but are not limited to, px330 vectors and px333 vectors. In some embodiments, a plasmid vector (e.g., a px333 vector) may include at least two DNA sequences encoding gRNA.

[0118] The gRNA of the present invention can be delivered to cells in any suitable manner.Including methods for delivering CRISPR / Cas systems, for example, by electroporation, gRNA complexes are introduced into cells, mRNA electroporation of encoding Cas nucleases and gRNAs is delivered into cells, or RNA or DNA is delivered by viral vectors, for example, by retrovirus (e.g., lentivirus) vector delivery. In some embodiments, target cells are contacted with Cas nucleases and gRNAs, respectively, and gRNA complexes are formed in cells. In some embodiments, target cells are contacted with nucleic acids encoding Cas nucleases and / or gRNAs, such as DNA or RNA. In some embodiments, target cells are contacted with gRNA complexes.

[0119] Cas9 nucleases recognize short motifs or protospacer adjacent motifs (PAMs) in CRISPR repeat sequences to help distinguish self from non-self. Cas9 nuclease sequences and structures are well known to those skilled in the art. Cas9 orthologs have been described in a variety of species, including, for example, Streptococcus pyogenes and Streptococcus thermophilus. Based on this disclosure, other suitable Cas9 nucleases and sequences will be apparent to those skilled in the art.

[0120] The single-chain antibody, single-domain antibody or heavy-chain antibody of the present invention can be prepared by conventional methods in the art, such as phage display technology well known in the art. Alternatively, various antibodies of the present invention can be expressed in other cell lines. Suitable mammalian host cells can be transformed with sequences encoding each antibody of the present invention. Transformation can be carried out by any known method, for example, including packaging the polynucleotide in a virus (or a viral vector) and transducing the host cell with the virus (or vector). The transformation procedure used depends on the host to be transformed. Methods for introducing heterologous polynucleotides into mammalian cells are well known in the art, including dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of polynucleotides in liposomes, and direct microinjection of DNA into the nucleus. Host mammalian cell lines that can be used for expression are well known in the art, such as the various immortalized cell lines available from the American Type Culture Collection (ATCC), including but not limited to Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma (HepG2) cells, etc.

[0121] The chimeric antigen receptor of the present invention can be prepared by conventional methods in the art, see, for example, Park et al, Trends Biotechnol., 29:550-557, 2011; Grupp et al, N Engl J Med., 368:1509-1518, 2013; Han et al, J. Hematol. Oncol., 6:47, 2013.

[0122] The nucleic acid full-length sequence or fragment thereof of the single-chain antibody, single-domain antibody, heavy-chain antibody or chimeric antigen receptor of the present invention can be obtained by conventional techniques, for example, it can be obtained by PCR amplification, recombination or artificial synthesis. It is a feasible method to synthesize the relevant sequence by artificial synthesis, especially for sequences with shorter fragment lengths. Generally, multiple small fragments can be synthesized first and then connected to obtain fragments with longer sequences. In addition, the coding sequence of the heavy chain and the expression tag (such as 6His) can be fused together to form a fusion protein.

[0123] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods. The biomolecules (nucleic acids, polypeptides, etc.) involved in the present invention include biomolecules in isolated form. At present, the DNA sequence encoding the polypeptide of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the polypeptide sequence of the present invention by chemical synthesis.

[0124] Viral vector technology is well known in the art and is described in Sambrook et al., Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. (2001), and other virology and molecular biology manuals.

[0125] Many virus-based systems have been developed in the prior art for transferring genes into mammalian cells. Heterologous nucleic acids can be inserted into vectors and packaged in retroviral particles using techniques known in the art. Recombinant viruses can then be isolated in vitro or in vitro and delivered to engineered mammalian cells. Many retroviral systems are known in the art. In some embodiments, adenoviral vectors are used. Many adenoviral vectors are known in the art. In some embodiments, lentiviral vectors are used. Using methods known in the art, the resulting lentiviral vector can be used to transduce mammalian cells (e.g., primary human T cells). In some embodiments, self-inactivating lentiviral vectors are used. For example, self-inactivating lentiviral vectors carrying immunomodulator (e.g., immune checkpoint inhibitor) coding sequences and / or self-inactivating lentiviral vectors carrying chimeric antigen receptors can be packaged with schemes known in the art.

[0126] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl2 method, the steps used are well known in the art. Another method is to use MgCl2. In addition, transformation can also be carried out using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome transfection, etc.

[0127] The transformant obtained can be cultivated by conventional methods to express the polypeptide encoded by the nucleic acid molecule of the present invention. According to the host cell used, the culture medium used in the cultivation can be selected from various conventional culture media. Cultivate under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, induce the promoter selected by a suitable method (such as temperature conversion or chemical induction), and the cells are cultivated for a period of time.

[0128] The polypeptide or protein in the above method can be expressed in the cell, on the cell membrane, or secreted outside the cell. If necessary, the recombinant polypeptide or protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with protein precipitants (salting out method), centrifugation, osmotic sterilization, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0129] The nucleic acid sequence encoding the chimeric antigen receptor can be introduced into immune effector cells using conventional methods known in the art (such as by transfection, transduction, transformation, etc.).

[0130] Methods for introducing vectors or isolated nucleic acids into immune effector cells are known in the art. The described vectors can be transferred into immune effector cells by physical, chemical or biological methods.

[0131] Physical methods for introducing vectors into immune effector cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. Methods for preparing cells containing vectors and / or exogenous nucleic acids are well known in the art and are described in, for example, Sambrook, J., Fritsch, EF and Maniatis, T. (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor. and other virology and molecular biology manuals. In some embodiments, the vector is introduced into immune effector cells by electroporation.

[0132] Biological methods for introducing vectors into immune effector cells include the use of DNA and RNA vectors. Viral vectors have become the most widely used method for inserting genes into mammalian cells (e.g., human cells).

[0133] Chemical methods for introducing vectors into immune effector cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, such as oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system used as an in vitro delivery vehicle is a liposome.

[0134] In some embodiments, nucleic acid molecules encoding any chimeric antigen receptor described herein can be prepared by conventional methods (e.g., in vitro transcription) and then introduced into immune effector cells by known methods such as mRNA electroporation (see Peter M Rabinovich. Human Gene Therapy, 17: 1027-1035 (2006)).

[0135] In some embodiments, the transduced or transfected immune effector cells are cultured in vitro and proliferated after the introduction of a vector or isolated nucleic acid. In some embodiments, the transduced or transfected immune effector cells are cultured to proliferate for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, or 14 days.

[0136] Explanation of terms

[0137] Unless otherwise defined, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0138] The term "gene editing" used in the present invention refers to the use of a gene editing system as a tool in a living gene to modify the gene at a fixed point, thereby achieving shearing, deletion, insertion or mutation of a single base of a specific gene sequence. The gene editing system refers to a system of at least one or more molecules comprising a nuclease (or a nuclease domain) and a codable nucleic acid binding domain, wherein the nuclease and the codable nucleic acid binding domain are necessary and sufficient to guide and achieve modification of nucleic acids (e.g., single-strand or double-strand breaks on a targeting sequence) by a nuclease (or a nuclease domain). Traditional gene editing can be summarized as three steps: positioning of gene editing tools, DNA damage mediated by nucleases (generally producing DNA double-strand breaks), and DNA repair mediated by intracellular DNA damage repair mechanisms such as homology-directed repair (HDR) or non-homologous end joining (NHEJ), to achieve the purpose of genome deletion, insertion, and gene point mutation. Gene editing systems include, for example, zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), clustered regularly interspaced short palindromic repeats / CRISPR-associated proteins, which can efficiently target and modify the genome by adding, removing or changing genetic material at a specific location in the genome. Gene editing is the process of modifying the nucleotide sequence of the genome. In some embodiments, the gene editing method of the present invention reduces or eliminates the expression of one or more antigens on the cell by modifying the endogenous genes of the cell using the CRISPR / Cas system. Gene editing using the CRISPR / Cas9 system is well known in the art, such as Ran, F., Hsu, P., Wright, J. et al. Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281–2308 (2013).

[0139] The terms "CRISPR system", "Cas system" or "CRISPR / Cas system" used in the present invention include guide RNA molecules (gRNA) and gRNA-guided nucleases or other effector molecules. The CRISPR system may include gRNA and Cas proteins, such as Cas9 proteins. gRNA and Cas proteins can form a ribonucleic acid protein (RNP) complex. Among them, the Cas protein has the function of cutting double-stranded DNA, and the gRNA plays a guiding role. In the presence of the protospacer adjacent motif (PAM), the Cas9 protein can reach different target sites under the guidance of the gRNA, cut the target gene, achieve DNA double-strand breaks, and activate non-homologous end joining (NHEJ), or create sites where exogenous donor DNA may be inserted through the homology-directed repair (HDR) mechanism. The NHEJ repair pathway is the most active repair pathway, which can frequently cause small nucleotide insertions or deletions (indels) at double-strand breaks (DSB) sites. The randomness of NHEJ-mediated DSB repair has important practical significance. In most cases, NHEJ produces small indels in the targeted DNA, which in turn leads to amino acid deletions, insertions or frameshift mutations. The desired effect is loss-of-function or mutation of the targeted gene.

[0140] There are two types of CRISPR-Cas systems. The first type can use a complex formed by multiple Cas proteins to cut the effector of exogenous nucleic acids, and the second type can use a single large Cas protein to cut the effector of exogenous nucleic acids. Type 1 can be divided into type I, type III and type IV, and type 2 can be divided into type II, type V and type VI. These six system types can be further divided into 19 subtypes.

[0141] Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 or Csx12), Cas10, Csy1, Csy2, Csy3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2 2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx1S, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csa1, Csa2, Csa3, Csa4, Csa5, Cas12a / Cpf1, Cas12b / C2c1, Cas12c / C2c3, Cas12d / CasY, Cas12e / CasX, Cas12g, Cas12h, Cas12i, and Cas12j / CasΦ, CARF, DinG, homologs thereof, or modified versions thereof. Unmodified Cas proteins may have DNA cleavage activity. The Cas protein can guide the cutting of one or both chains of the targeting sequence, such as within the targeting sequence and / or within the complementary sequence of the targeting sequence. For example, the Cas protein can guide the cutting of one or both chains within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500 or more base pairs from the first or last nucleotide of the targeting sequence. In some embodiments, Cas9 is a modified Cas9. Cas9 generates DSBs through the combined activity of two nuclease domains, RuvC and HNH.

[0142] The Cas protein can be a corresponding Cas protein isolated from Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus Cas9 (StCas9), Neisseria meningitidis Cas9 (NmCas9), Francisella novicida Cas9 (FnCas9) or Campylobacter jejuni Cas9 (CjCas9). In some embodiments, the Cas protein is a Cas variant derived from a wild-type Cas protein. An exemplary Cas variant can be a high-fidelity Cas9 protein. In some embodiments, Cas9 is a variant Cas9 protein. The amino acid sequence of the variant Cas9 polypeptide is different from the amino acid sequence of the wild-type Cas9 protein by at least one amino acid (e.g., having a deletion, insertion, substitution, or fusion). In some embodiments, the Cas protein variant has at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 amino acids different from the amino acid sequence of the wild-type Cas9 protein. In some examples, the variant Cas9 protein has an amino acid change (e.g., a deletion, insertion, or substitution) that reduces the nuclease activity of the Cas9 protein. For example, in some examples, the variant Cas9 protein has less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nuclease activity of the corresponding wild-type Cas9 protein. In some embodiments, the variant Cas9 protein has substantially no nuclease activity. When the Cas9 protein is a variant Cas9 protein that has substantially no nuclease activity, it can be referred to as "dCas9". In some embodiments, the Cas variant can be fused to another enzyme, such as activation-induced cytidine deaminase (AID). In nature, DNA binding and cutting usually require proteins and two RNAs. However, a single guide RNA can be engineered to incorporate multiple crRNAs and tracrRNAs into a single RNA substance. See, for example, Jinek M. et al., Science 337:816-821 (2012). In some embodiments, the Cas protein or gRNA complex can be applied together with a template for homology-directed repair (HDR). In some embodiments, the Cas protein or gRNA complex is applied without an HDR template.

[0143] "gRNA" or "guide RNA" refers to a synthetic or recombinant polynucleotide that is specific for the sequence of a target domain. The gRNA can target any exon or intron of the domain. In some embodiments, the gRNA may include modifications. The modifications can be at any position of the gRNA. More than one modification can be made to a single gRNA. The modification of the gRNA can be a substitution, insertion, deletion, chemical modification, physical modification, stabilization, purification, or any combination thereof. The gRNA can be quality controlled after modification. In some embodiments, quality control can include PAGE, HPLC, MS, or any combination thereof.

[0144] The term "protospacer adjacent motif (PAM)" or "PAM-like motif" used in the present invention refers to 2 to 6 base pairs immediately downstream of the targeting sequence targeted by the Cas protein in the CRISPR system. The PAM sequence can be located 3-4 nucleic acids downstream of the cleavage site. The PAM sequence is essential for target binding, and the Cas protein requires a PAM sequence to recognize the targeting sequence. After the gRNA is paired with the targeting sequence, the Cas protein mediates a double-strand break of about 3nt upstream of the PAM. The PAM sequence can be any PAM sequence known in the art. Suitable PAM sequences include, but are not limited to, NGG, NGA, NGC, NAG, NGN, NGT, NGTT, NGCG, NGAG, NGAN, NGNG, NGCN, NGTN, NNGRRT, NNNRRT, NGGNG, NNGRR (N), TTTV, TYCV, TATV, NNNNGATT, NNAGAAW or NAAAA, wherein N is any nucleic acid base, R is purine, Y is pyrimidine, and W is A or T. For example, the PAM sequence of Cas9 can be NGG, for example, the Cas9 protein from Streptococcus pyogenes (spCas9), which requires a standard NGG sequence as a PAM sequence to bind to a specific nucleic acid region, and the "N" in "NGG" can be adenine (A), thymine (T), guanine (G) or cytosine (C), and G is guanine. In some embodiments, the Cas protein is engineered / modified to recognize one or more PAM sequences. In some embodiments, the Cas protein is engineered / modified to recognize one or more PAM sequences that are different from the PAM sequence recognized when the Cas protein is not engineered / modified, for example, a Cas variant can recognize a modified PAM sequence such as NGG, NGAN, NGNG, NGAG, NGCG, NNG, TTTN, YTN or YG.

[0145] "Immune effector cell" refers to an immune cell that can perform immune effector functions (e.g., cytotoxic cell killing activity, secretion of cytokines, induction of ADCC and / or CDC). For example, immune effector cells can be T cells, macrophages, dendritic cells, monocytes, NK cells and / or NKT cells, or are derived from stem cells, such as adult stem cells, embryonic stem cells, cord blood stem cells, progenitor cells, bone marrow stem cells, induced pluripotent stem cells, totipotent stem cells or hematopoietic stem cells. When the immune effector cell is a T cell, the T cell can be any T cell, such as a T cell cultured in vitro, such as a primary T cell, or a T cell from a T cell line cultured in vitro such as Jurkat, SupT1, etc., or a T cell obtained from a subject. Examples of subjects include humans, dogs, cats, mice, rats and transgenic species thereof. T cells can be obtained from a variety of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from infection sites, ascites, pleural effusion, spleen tissue and tumors. T cells can also be concentrated or purified. T cells can be at any developmental stage, including but not limited to, CD4+ / CD8+ T cells, CD4+ helper T cells (e.g., Th1 and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), CD4- / CD8-T cells, tumor infiltrating cells, memory T cells, naive T cells, γδ-T cells, αβ-T cells, etc.

[0146] As used herein, the term "derived from" indicates a relationship between the two, and generally refers to the structural similarity between the two. For example, in the case of an intracellular signaling domain derived from CD3ζ, the intracellular signaling domain retains sufficient CD3ζ structure so that it has the desired function, i.e., the ability to generate a signal under appropriate conditions. It does not imply or include a limitation on a specific process for generating an intracellular signaling domain, for example, it does not mean that in order to provide an intracellular signaling domain, one must start with a CD3ζ sequence and delete unwanted sequences, or impose mutations, to arrive at the intracellular signaling domain.

[0147] The term "antibody" used in the present invention refers to a protein or polypeptide sequence derived from an immunoglobulin molecule, which specifically binds to an antigen (such as a target antigen). The antibody can be a complete immunoglobulin derived from a natural source or a recombinant source, or it can be an immunoreactive portion of a complete immunoglobulin. Non-limiting examples of antibodies include monoclonal antibodies (including complete antibodies), single domain antibodies (SdAb), single chain antibodies (scFv), heavy chain antibodies (HCAb), heavy chain single domain antibodies (VHH), light chain antibodies (LCAb), monovalent antibodies, and "antibodies" also include antibody fragments or synthetic polypeptides carrying one or more CDR sequences that can exhibit the desired biological activity, especially antigen binding fragments, such as Fab, F(ab')2 and Fv. In some embodiments of the present invention, the terms "immunoglobulin (Ig)" and "antibody" are used interchangeably. The "variable region" or "variable domain" of an antibody refers to the amino terminal domain of the heavy chain or light chain of an antibody. The variable domains of the heavy chain and light chain can be referred to as "VH" and "VL", respectively. These domains are generally the most variable parts of the antibody (relative to other antibodies of the same type) and contain the antigen binding site.

[0148] The term "antigen" or "Ag" as used herein refers to a molecule that causes an immune response. An immune response may involve the production of antibodies or the activation of specific immunocompetent cells, or both. Those skilled in the art will appreciate that virtually any macromolecule, including all proteins or peptides, may serve as an antigen. In addition, antigens may be derived from recombinant or genomic DNA. Those skilled in the art will appreciate that any DNA comprising a nucleotide sequence or a partial nucleotide sequence encoding a protein that causes an immune response therefore encodes an "antigen". Antigens may be produced synthetically, or may be derived from a biological sample, or may be a macromolecule other than a polypeptide. Such biological samples may include, but are not limited to, tissue samples, tumor samples, cells, or cells or fluids having other biological components.

[0149] The term "antigen-binding fragment" or "antibody fragment" used in the present invention refers to at least a portion of a complete antibody or a recombinant variant thereof, generally comprising the antigen-binding site of the complete antibody and thus retaining the ability to bind to the antigen. Examples of antibody fragments include, but are not limited to: Fab, single-chain antibody (scFv), single-domain antibody (SdAb), heavy chain variable region (VH) of an antibody, heavy chain antibody (HCAb), heavy chain single domain antibody (VHH), light chain antibody (LCAb), linear antibody, natural ligand of an antigen or a functional fragment thereof, etc.

[0150] The term "functional fragment" or "functional variant" used in the present invention refers to a variant that substantially comprises the amino acid sequence of the parent but contains at least one amino acid modification (e.g., substitution, deletion or insertion) compared to the parent amino acid sequence, provided that the variant retains the biological activity of the parent amino acid sequence. In some embodiments, the amino acid modification is a conservative modification.

[0151] The term "heavy chain antibody" used in the present invention is an antibody derived from a camelid or cartilaginous fish. Compared with a 4-chain antibody, a heavy chain antibody lacks a light chain and a heavy chain constant region 1 (CH1), and only contains 2 heavy chains consisting of a variable region (VHH) and other constant regions, and the variable region is connected to the constant region by a structure similar to the hinge region. Each heavy chain of a camelid heavy chain antibody contains 1 variable region (VHH) and 2 constant regions (CH2 and CH3), and each heavy chain of a cartilaginous fish heavy chain antibody contains 1 variable region and 5 constant regions (CH1-CH5). The antigen-binding fragment of a heavy chain antibody includes VHH and a single-chain heavy chain antibody. By fusion with the constant region of human IgG Fc, a heavy chain antibody can have CH2 and CH3 of human IgG Fc.

[0152] Single domain antibodies (sdAb) can have the same or different sources and have the same or different sizes. Exemplary sdAbs include, but are not limited to, heavy chain variable domains (e.g., VHH) from heavy chain antibodies only, binding molecules without light chains in nature, single domains (e.g., VH or VL) derived from conventional 4-chain antibodies, human single domain antibodies produced by transgenic mice or rats expressing human heavy chain fragments, and non-derived engineering domains and single domain scaffolds from antibodies. Any sdAb known in the art or disclosed by the present invention, including single domain antibodies disclosed by the present invention, can be used as cellular antigen binding domains in chimeric antigen receptors described in the present invention. sdAbs can be derived from any species, including but not limited to mice, rats, humans, camels, llamas, lampreys, sharks, goats, rabbits, and cattle. The single domain antibodies of the present invention also include naturally occurring single domain antibody molecules from species other than camelids and sharks.

[0153] "Antigen binding domain" refers to the part of the chimeric antigen receptor that specifically binds to the target antigen. The chimeric antigen receptor can use its antigen binding properties to direct T cells and / or other immune cells to the selected target. The antigen binding domain can typically include an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH), but it does not have to include both variable regions. For example, it can include a Fab fragment with antigen binding activity, a Fab' fragment, a single Fv fragment such as scFv, a single domain antibody, etc.

[0154] "Transmembrane domain" is used to connect the extracellular domain and intracellular domain of chimeric antigen receptor. Transmembrane domain can be natural or synthetic, and can also be derived from any membrane-bound protein or transmembrane protein. Non-limiting examples of transmembrane domain include, TCRα, TCRβ, TCRγ, TCRδ, TCRζ, CD28, CD3ζ, CD3ε, CD3γ, CD3δ, CD45, CD4, CD5, CD8α, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD152, CD154, OX40, ICOS, LAG-3, 2B4, BTLA, CTLA-4, PD-1.

[0155] "Intracellular signaling domain" refers to a functional part of a protein, i.e., a functional part of an intracellular signaling domain that is sufficient to transduce effector function signals. The intracellular signaling domain is responsible for the intracellular primary signaling after the antigen binding region binds to the antigen, thereby causing the activation of immune cells and immune responses. In other words, the intracellular signaling domain is responsible for activating at least one of the normal effector functions of immune cells expressing CAR. For example, the effector function of T cells can be cytolytic activity or auxiliary activity, including the secretion of cytokines. In one embodiment, the intracellular signaling domain included in the chimeric antigen receptor of the present invention can be a cytoplasmic sequence of a T cell receptor and a co-receptor, which works together to induce signal transduction after antigen receptor binding, as well as any derivatives or variants of these sequences and any synthetic sequences with the same or similar functions. The intracellular signaling domain can include many immunoreceptor tyrosine-based activation motifs (ITAMs). Non-limiting examples of intracellular signaling domains include, but are not limited to, FcRγ, FcRβ, TCRζ, CD3γ, CD3δ, CD3ε, CD3ζ, CD5, CD22, CD79a, CD79b, CD278 (ICOS), FcεRI, DAP10, DAP12, or CD66d.

[0156] "Hinge region" refers to any oligopeptide or polypeptide used to connect the transmembrane domain and the antigen binding domain. Specifically, the hinge region is used to provide greater flexibility and accessibility for the antigen binding domain. The hinge region can contain up to 300 amino acids, preferably 10 to 100 amino acids and most preferably 25 to 50 amino acids. The hinge region can be derived in whole or in part from natural molecules, such as in whole or in part from the extracellular region of CD8 or CD28, or in whole or in part from an antibody constant region. Alternatively, the hinge region can be a synthetic sequence corresponding to a naturally occurring hinge sequence, or can be a fully synthetic hinge sequence.

[0157] Different domains of CAR can also be fused to each other through peptide linkers. Depending on the structural and / or functional characteristics of the single domain antibody and / or various domains, each peptide linker in CAR can have the same or different lengths and / or sequences. Those skilled in the art can independently select and optimize each peptide linker.

[0158] The peptide linker can have any suitable length. In some embodiments, the length of the peptide linker is about 1 amino acid to about 10 amino acids, about 1 amino acid to about 20 amino acids, about 1 amino acid to about 30 amino acids, about 5 amino acids to about 15 amino acids, about 10 amino acids to about 25 amino acids, about 5 amino acids to about 30 amino acids, about 10 amino acids to about 30 amino acids, about 30 amino acids to about 50 amino acids, about 50 amino acids to about 100 amino acids, or about 1 amino acid to about 100 amino acids.

[0159] The peptide linker can have a naturally occurring sequence or a non-naturally occurring sequence. For example, a sequence derived from the hinge region of only a heavy chain antibody can be used as a linker. See, for example, WO1996 / 34103. In some embodiments, the peptide linker is a flexible linker. Exemplary flexible linkers include, but are not limited to, glycine polymers (G) n, glycine-serine polymers (e.g., (GS) n, (GSG) n, (GGGS) n, and (GGGGS) n, wherein n is an integer of at least 1), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art.

[0160] "Costimulatory signal domain" can be a functional intracellular signal transduction domain from a costimulatory molecule, which includes the entire intracellular portion of the costimulatory molecule, or a functional fragment thereof."Costimulatory molecule" refers to a cognate binding partner that specifically binds to a costimulatory ligand on a T cell, thereby mediating a costimulatory response (e.g., proliferation) of a T cell. Non-limiting examples of costimulatory domains include, but are not limited to, intracellular regions of the following proteins: MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), activating NK cell receptors, TLR1-10, CARD11, CD134 (OX40), CD2, CD3, CD7, CD27, CD28, CD30, CD40, CD83, CDS, ICAM, CD137 (4-1BB), CD276 (B7-H3), CD278 (ICOS), or any combination thereof.

[0161] "Signal peptide" can make the chimeric antigen receptor be expressed in cells (such as T cells) so that the nascent protein is directed to the endoplasmic reticulum and then to the cell surface. Generally, the core of the signal peptide can contain a long hydrophobic amino acid segment, which has a tendency to form a single α-helix. The signal peptide guides the transport and / or secretion of the translated protein across the membrane. At the end of the signal peptide, there is usually an amino acid segment that is recognized and cut by a signal peptidase. The signal peptidase can cut during or after the translocation to produce a free signal peptide and a mature protein. Then, the free signal peptide is digested by a specific protease. The signal peptide can also be referred to as a targeting signal, a transit peptide, a positioning signal or a signal sequence. For example, a signal sequence can be a co-translational or post-translational signal peptide.

[0162] The terms "patient", "subject", "individual" and "object" used in the present invention are used interchangeably herein and include any organism, preferably an animal, more preferably a mammal (e.g., rats, mice, dogs, cats, rabbits, etc.), and most preferably a human.

[0163] "Treatment" refers to the use of the treatment methods described herein to achieve at least one positive therapeutic effect (e.g., a decrease in the number of cancer cells, a decrease in tumor volume, a decrease in the rate of cancer cell infiltration into peripheral organs, or a decrease in the rate of tumor metastasis or tumor growth) in a subject. Treatment methods that effectively treat a patient can be adjusted based on a variety of factors (e.g., the patient's disease state, age, weight, and the ability of the therapy to stimulate an anti-cancer response in the subject). BRIEF DESCRIPTION OF THE DRAWINGS

[0164] Figure 1 The figure shows the percentage of CD5-negative cells in each group of CD4+T cells after modifying the CD5 gene of T cells using a gRNA designed to target the endogenous CD5 gene of cells.

[0165] Figure 2 The figure shows the percentage of CD5-negative cells in each group of CD8+T cells after modifying the CD5 gene of T cells using a gRNA designed to target the endogenous CD5 gene of cells. DETAILED DESCRIPTION

[0166] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0167] Example 1. Recovery and activation of T cells

[0168] The frozen cord blood was taken out and thawed in a 37°C water bath. The cord blood was transferred to a 50 mL centrifuge tube, and an appropriate amount of RPMI1640 medium was added. After mixing, the samples were counted and centrifuged at 300 g for 5 min. After centrifugation, the lower layer of cells was collected and resuspended in complete medium (RPMI1640 medium containing 10% FBS, supplemented with glutamine, 2-mercaptoethanol, IL-7 (10 ng / mL), IL-15 (10 ng / mL), IL-2 (200 U / mL)) to a T lymphocyte density of 1×10 6 / mL, add activation antibodies Anti-human CD3 antibody and Anti-human CD28 antibody according to the resuspension volume, where the concentration of Anti-human CD3antibody is 0.15μg / mL, and the concentration of Anti-human CD28 antibody is 0.625μg / mL, and culture the T cells in a 37℃, 5% CO2 incubator.

[0169] Example 2. Sorting and purification of T cells

[0170] According to Example 1, after activating T cells for 2 days, 20 μL of mixed samples were taken, 10 μL of diluted fluorescent labeled antibodies were added, and the samples were stained for 10 min. After adding PBS and diluting 10 times, the flow cytometer was used to detect the counts, and the density of CD45+, CD3+, CD4+, and CD8+ T cells was recorded, and the expression of activation markers CD69 and CD25 molecules was observed. The cell volume was recorded to confirm the total number of T cells. The cell suspension was transferred to a centrifuge tube and centrifuged (500g, 5min), and the supernatant was discarded to collect the lower cells; MACS Buffer was added for washing, and the lower cells were collected after centrifugation again (500g, 5min), and the cells were resuspended with an appropriate amount of MACS Buffer. The amount of CD4+ magnetic beads (Miltenyi Biotec, 130-045-101) and CD8+ magnetic beads (Miltenyi Biotec, 130-045-201) used was calculated according to the number of cells and the magnetic beads manual, and CD4+ magnetic beads and CD8+ magnetic beads were used for sorting according to the instructions of the magnetic beads manual to obtain sorted T cells.

[0171] Example 3. Design and screening of gRNA

[0172] 18 gRNAs were designed to modify the endogenous CD5 gene on T cells, and these gRNAs were numbered and named: gRNA-CD5-1, gRNA-CD5-2, gRNA-CD5-3, gRNA-CD5-4, gRNA-CD5-5, gRNA-CD5-6, gRNA-CD5-7, gRNA-CD5-8, gRNA-CD5-9, gRNA-CD5-10, gRNA-CD5-11, gRNA-CD5-12, gRNA-CD5-13, gRNA-CD5-14, gRNA-CD5-15, gRNA-CD5-16, gRNA-CD5-17 and gRNA-CD5-18, and the corresponding spacer sequences (sequences complementary to the target gene) are shown in Table 1, corresponding to sequences SEQ ID NO: 1-18, respectively. The crRNA:tracrRNA complexes were prepared separately, wherein the crRNA consisted of a spacer sequence (SEQ ID NO: 1-18) and an additional sequence GUUUUAGAGCUAUGCU. For example, the crRNA sequence corresponding to gRNA-CD5-1 was: T of the corresponding sequence of gRNA-CD5-1 in Table 1 was changed to U, and then connected with the additional sequence, so that the crRNA sequence was:

[0173] CGUUCCAACUCGAAGUGCCAGUUUUAGAGCUAUGCU;

[0174] And, the tracrRNA sequence is:

[0175] AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGA GUCGGUGCUUU;

[0176] The spacer sequences of the gRNA are respectively as follows:

[0177] (1) gRNA-CD5-1: CGTTCCAACTCGAAGTGCCA (SEQ ID NO: 1), PAM: GGG;

[0178] (2) gRNA-CD5-2: AATCATCTGCTACGGACAAC (SEQ ID NO: 2), PAM: TGG;

[0179] (3) gRNA-CD5-3: GCTGTAGAACTCCACCACGC (SEQ ID NO: 3), PAM: CGG;

[0180] <h2 style=";text-align:left;direction:ltr">(4)gRNA-CD5-4:GCTGGCCACCTTGTACCTGC(SEQ ID NO:4),PAM:TGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0181] <h2 style=";text-align:left;direction:ltr"> (5)gRNA-CD5-5:GTCTGCCAGCGGCTGAACTG(SEQ ID NO:5),PAM:TGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0182] <h2 style=";text-align:left;direction:ltr"> (6)gRNA-CD5-6:GGTTCTGCAATGAGACACTC(SEQ ID NO:6),PAM:TGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0183] <h2 style=";text-align:left;direction:ltr"> (7)gRNA-CD5-7:GGCGTGGTGGAGTTCTACAG(SEQ ID NO:7),PAM:CGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0184] <h2 style=";text-align:left;direction:ltr"> (8)gRNA-CD5-8:GGAGTTCTACAGCGGCAGCC(SEQ ID NO:8),PAM:TGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0185] <h2 style=";text-align:left;direction:ltr"> (9)gRNA-CD5-9:GATGCTTGCCACCGTGCCTG(SEQ ID NO:9),PAM:CGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0186] <h2 style=";text-align:left;direction:ltr"> (10)gRNA-CD5-10:GTTCAGAATCCTCTTACCTG(SEQ ID NO:10),PAM:TGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0187] <h2 style=";text-align:left;direction:ltr"> (11)gRNA-CD5-11:GGAGTTGTCAGGCTGCATGG(SEQ ID NO:11),PAM:AGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0188] <h2 style=";text-align:left;direction:ltr"> (12)gRNA-CD5-12:GCCAGAAGAAGCAGCGCCAG(SEQ ID NO:12),PAM:TGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0189] <h2 style=";text-align:left;direction:ltr"> (13)gRNA-CD5-13:CAGCATCTGTGAAGGCACCG(SEQ ID NO:13),PAM:TGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0190] <h2 style=";text-align:left;direction:ltr"> (14)gRNA-CD5-14:AGGTGCAGAGCCGTCTGGTG(SEQ ID NO:14),PAM:GGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0191] <h2 style=";text-align:left;direction:ltr"> (15)gRNA-CD5-15:CATAGCTGATGGTACCCCCC(SEQ ID NO:15),PAM:AGG;<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0192] (16) gRNA-CD5-16: CTGGCCCTGGCACTTCGAGT (SEQ ID NO: 16), PAM: TGG;

[0193] (17) gRNA-CD5-17: TGGCTGAAGGCTGTCACAC (SEQ ID NO: 17), PAM: AGG;

[0194] (18) gRNA-CD5-18: AAGCGTCAAAAGTCTGCCAG (SEQ ID NO: 18), PAM: CGG.

[0195] Add crRNA and tracrRNA to Nuclease-Free Duplex Buffer (IDT) at a ratio of 1:1, with a total volume of 100 μL. Anneal at 95°C for 5 min, take out and let stand at room temperature, wait until the temperature returns to 20-25°C, add crRNA:tracrRNA complex, Cas9 protein and 1 μM electroporation enhancer (IDT, Cat#1075916) to Opti-MEM (Gibco, Cat#A4124802) to prepare a ribonucleoprotein (RNP) complex with a total volume of 25 μL. Let stand at room temperature for 5 min to obtain the RNP complex for use.

[0196] Take the activated T cells and divide them into 19 parts on average, of which one part of T cells without endogenous CD5 gene modification is recorded as NoEp group, and each T cell group with endogenous CD5 gene modification is named according to the number of gRNA in the RNP complex used. Centrifuge the cells, discard the supernatant to retain the cell pellet, and add a fresh amount of Opti-MEM buffer to resuspend the cell pellet. After centrifugation of the cell suspension, discard the supernatant, add a fresh amount of Opti-MEM buffer to resuspend the cell pellet, add the prepared RNP complex, gently blow and mix, and then add it to the electrode cup. Use Celetrix electroporator and set the voltage to 500V. After electroporation, transfer the cells to the culture medium, let it stand in a 37°C incubator for 30 minutes, and then transfer it to a culture dish for culture to obtain endogenous CD5 gene-modified T cells.

[0197] The cell density of the endogenous CD5 gene-modified T cells was adjusted to 400 cells / μL for plating, and the volume of each well was 500 μL. After mixing, the cells were cultured in a 37°C, 5% CO2 incubator. After 3 days of culture, FITC anti-human CD5 antibody (FITC anti-human CD5 Antibody, Biolegend, B327127) was used to detect the expression of CD5 molecules on CD4+ and CD8+ T cells. After plating, the T cell proliferation was regularly observed and fresh complete culture medium was added. After 8 days of continuous culture, the expression rate of CD5 molecules on CD4+ and CD8+ T cells was detected using FITC anti-human CD5 antibody (FITC anti-human CD5 Antibody, Biolegend, B327127) to characterize the knockout rate of CD5. The test results are shown in Figure 2. Figure 1 and 2 Example 4. Preparation of CAR-T cells modified with endogenous CD5 gene

[0198] (1) Construction of CD5-CAR

[0199] A CAR nucleotide sequence encoding targeting CD5 (SEQ ID NO: 26) was designed and artificially synthesized, and the sequence contained HLA-A signal peptide (SEQ ID NO: 19), an extracellular antigen binding domain targeting CD5 (SEQ ID NO: 20), a CD8α hinge region (SEQ ID NO: 21), a CD8α transmembrane domain (SEQ ID NO: 22), a 4-1BB (CD137) co-stimulatory signal domain (SEQ ID NO: 23) and a CD3ζ intracellular signal transduction domain (SEQ ID NO: 24) encoding nucleotide sequence for expressing a complete CD5-CAR polypeptide molecule (SEQ ID NO: 25). The nucleotide sequence of CD5-CAR was inserted into the multiple cloning site of the lentiviral expression vector pK1 by homologous recombination to obtain pK1-CD5-CAR, and the lentiviral expression vector sequence was successfully constructed by electrophoresis and sequencing results. The specific amino acid or nucleotide sequence information shown in SEQ ID NO: 19-26 is shown in Table 2.

[0200] Table 2

[0201]

[0202]

[0203]

[0204] (2) Packaging of lentiviral vectors

[0205] 293T cells were revived and cultured in DMEM medium containing 10% FBS. After 2-3 generations of cell expansion, 4×10 4 Pieces / cm 2 The density was inoculated into the 2-layer cell factory. Plasmid transfection was performed on the third day after cell inoculation. After adding 40 mL of Opti-MEM to a 50 mL sterile centrifuge tube for plasmid transfection, the viral packaging vector and viral envelope vector were added according to the ratio of pK1-CD5-CAR:pLP1:pLP2:pLP-VSVG=5:4:3:1, and 800 μL of PEI transfection reagent was added, mixed immediately, and incubated at room temperature for 15 min. Then the plasmid / vector / transfection reagent complex was added dropwise to the culture flask of 293T cells. After 24 h, the viral supernatant was collected into a 50 mL centrifuge tube, centrifuged at 250 g for 5 min, and the supernatant was filtered with a 0.45 μm filter after centrifugation. The filtered supernatant was ultracentrifuged (25000 g, 4 ° C, 3 h) to obtain a concentrated CD5-CAR lentiviral solution. After centrifugation, the supernatant was discarded, and the lentivirus was resuspended with PBS precooled at 4°C. The resuspended CD5-CAR lentivirus solution was aliquoted and stored at -80°C for later use.

[0206] (3) CD5-CAR lentiviral transduction and detection of CAR-T cells

[0207] The endogenous CD5 gene of the T cells obtained in Example 2 was modified with the gRNA obtained in Example 3. The cell density of the genetically modified T cells was adjusted to 400 cells / μL for plating, and the volume of each well was 500 μL. After culturing for 24 hours, the CD5-CAR lentiviral solution was added according to the actual number of cells in each well, mixed and cultured in a 37°C, 5% CO2 incubator. After 3 days of culture, the expression rate of CD5-CAR molecules on the surface of T cells and the proliferation of T cells were detected respectively. PE-labeled human CD5 protein (PE-Labeled Human CD5 Protein, His Tag (Site-specific conjugation), Acrobiosystems) was used to detect the expression rate of CAR molecules in each experimental group. After plating, the proliferation of CAR-T cells was regularly detected and fresh complete culture medium was added. After regular culture, the cumulative proliferation of T cells was detected and counted, and the proliferation of T cells in CAR-T cells was detected. SCM +T CM The phenotype and proportion of CAR-T cells expressing Tim3 were measured, and the in vitro killing ability of the harvested CAR-T cells was detected.

Claims

1. A method for modifying endogenous CD5 gene in cells, characterized in that: The method comprises: providing a cell to be genetically modified; Introducing an agent into a cell to be genetically modified, the agent comprising: (i) a gRNA targeting an endogenous CD5 gene of the cell or an expression vector for expressing the gRNA, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in any one of SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 17, and (ii) a Cas9 protein or a functional variant thereof, or an expression vector expressing the Cas9 protein or a functional variant thereof; harvesting the genetically modified cells; The expression of CD5 antigen in the genetically modified cells is reduced.

2. The method according to claim 1, characterized in that The expression of the CD5 antigen is reduced by at least 50%, by at least 60%, or by at least 70% in the genetically modified cells.

3. The method according to claim 1, characterized in that: Wherein the cells are immune effector cells; preferably, the immune effector cells can be selected from T cells, B cells, NK cells, macrophages, dendritic cells, immune effector cells differentiated from induced pluripotent stem cells (iPSCs), or any combination thereof.

4. The method according to claim 1, characterized in that: The method also includes a step of preparing the reagent before introducing the reagent into the cell to be genetically modified, the step comprising: mixing crRNA and tracrRNA to form a gRNA complex, and mixing the gRNA complex with Cas9 protein to obtain the reagent.

5. The method according to claim 1, characterized in that The method further comprises the step of transducing a vector comprising a nucleic acid molecule expressing a targeting ligand capable of specifically recognizing an antigen into the cell before or after introducing the agent into the cell to be genetically modified; preferably, the targeting ligand capable of specifically recognizing an antigen may be selected from a chimeric antigen receptor (CAR), a T cell antigen receptor (TCR) or a B cell antigen receptor (BCR); or preferably, the vector may be selected from a lentiviral vector, a retroviral vector, an adenoviral vector or an adeno-associated viral vector.

6. A gRNA targeting endogenous CD5 gene in cells, characterized in that: The gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence as shown in any one of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQ ID NO:

17.

7. A reagent for preparing cells modified with endogenous CD5 gene, characterized in that: The reagent comprises: (i) a gRNA targeting an endogenous CD5 gene in a cell or an expression vector for expressing the gRNA, wherein the gRNA comprises a spacer sequence, and the spacer sequence is a nucleic acid sequence selected from any one of SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12 or SEQID NO:17, and (ii) a Cas9 protein or a functional variant thereof, or an expression vector expressing the Cas9 protein or a functional variant thereof.

8. A cell modified with an endogenous CD5 gene, characterized in that: The cell is prepared by the method according to any one of claims 1 to 5, so that the expression of CD5 antigen in the cell is reduced by at least 50%, at least 60% or at least 70%; preferably, the cell further comprises a targeting ligand capable of specifically recognizing an antigen, and the targeting ligand capable of specifically recognizing an antigen can be selected from a chimeric antigen receptor (CAR), a T cell antigen receptor (TCR) or a B cell antigen receptor (BCR), and further preferably, the chimeric antigen receptor (CAR) comprises an extracellular antigen binding domain, a transmembrane domain, a co-stimulatory domain and an intracellular signal transduction domain capable of specifically recognizing the CD5 antigen, and further preferably, the extracellular antigen binding domain capable of specifically recognizing the CD5 antigen comprises a single chain antibody (scFv), a single domain antibody (sdAb) or a heavy chain antibody (HCAb) that specifically recognizes the CD5 antigen; or preferably, the cell is an immune effector cell, and the immune effector cell can be selected from T cells, B cells, NK cells, macrophages, dendritic cells, immune effector cells differentiated from induced pluripotent stem cells (iPSC), or any combination thereof.

9. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the cell according to claim 8, and one or more pharmaceutically acceptable excipients and / or carriers.

10. Use of the cell according to claim 8 or the pharmaceutical composition according to claim 9 in the preparation of a medicament for diagnosing, preventing and / or treating a disease or condition associated with CD5 expression; preferably, the disease or condition associated with CD5 expression comprises T-cell leukemia, T-cell lymphoma or B-cell lymphoma; or preferably, the disease or condition associated with CD5 expression comprises acute T-lymphocytic leukemia, acute T-lymphocytic lymphoma, T-lymphoblastoma, peripheral T-cell lymphoma, cutaneous T-cell lymphoma, chronic lymphocytic leukemia, mantle cell lymphoma or diffuse large B-cell lymphoma.

Images