Marker, primer pair and kit for evaluating hematopoietic injury level and application of marker, primer pair and kit

Abstract

The invention relates to a marker, a primer pair and a kit for evaluating the hematopoietic injury level and application of the marker, the primer pair and the kit, and belongs to the technical field of biomedicine. The marker for evaluating the hematopoietic injury level is cystatin A; the nucleotide sequence of the cystatin A is as shown in SEQ ID NO. 1. The cystatin A can be used as a marker for evaluating hematopoietic injury caused by long-term contact with toxic substances such as benzene, and has good sensitivity, specificity and accuracy.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a marker, a primer pair, a kit and applications thereof for evaluating the level of hematopoietic damage. Background Art

[0002] Blood system diseases are mainly caused by hematopoietic system dysfunction, including aplastic anemia, myelodysplastic syndrome (MDS), leukemia, lymphoma, etc. Among them, leukemia is a major burden on global public health and one of the most common childhood cancers. The predisposing factors of leukemia mainly include long-term exposure to chemicals and toxic substances, ionizing radiation, genetic susceptibility, etc. Among chemicals and toxic substances, benzene, as an occupational and environmental toxic substance, has become the main predisposing factor for childhood leukemia and occupational leukemia.

[0003] The protein encoded by cystatin A (CSTA) is one of the precursor proteins of the corneocyte envelope in keratinocytes, and plays an important role in the maintenance of epidermal development and intercellular adhesion mediated by desmosomes in the subepidermal layer. Studies have found that CSTA is associated with the prognosis of various solid tumors such as colorectal cancer, pancreatic cancer, nasopharyngeal carcinoma, and breast cancer. On the one hand, increased CSTA levels can promote the progression of advanced colorectal cancer by regulating epithelial-mesenchymal transition, and are overexpressed in pancreatic cancer cells and metastatic tumors; on the other hand, CSTA inhibits AKT signaling by promoting METTL13 degradation, thereby inhibiting nasopharyngeal carcinoma signal transfer, and is also an inhibitor of early breast cancer invasion.

[0004] However, the research results on the key regulatory targets and mechanisms of hematopoietic damage in the existing technology are still unclear, and the role of CSTA in blood system diseases is also unclear. Currently, no research has reported the relationship between CSTA expression and hematopoietic damage and leukemia, and there is no biomarker that can detect and prevent hematopoietic damage at an early stage. Summary of the invention

[0005] The purpose of the present invention is to provide a marker, a primer pair, a kit and their application for evaluating the level of hematopoietic damage in view of the defects in the above-mentioned prior art.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a marker for evaluating the level of hematopoietic damage, wherein the marker is cystatin A;

[0008] The nucleotide sequence of cystatin A is shown in SEQ ID NO.1.

[0009] The present invention also provides the use of the marker in preparing a product for evaluating the level of hematopoietic damage.

[0010] The present invention also provides a kit for evaluating the level of hematopoietic damage, wherein the kit comprises a reagent for detecting the marker.

[0011] The present invention also provides a primer pair for detecting the marker, wherein the upstream primer of the primer pair is shown as SEQ ID NO.2;

[0012] The downstream primer of the primer pair is shown as SEQ ID NO.3.

[0013] The present invention also provides the use of the primer pair in preparing a product for detecting the marker.

[0014] The present invention also provides the use of the primer pair in preparing a product for evaluating the level of hematopoietic damage.

[0015] The present invention also provides a kit for detecting the marker, which comprises the primer pair.

[0016] The present invention has the following technical effects and advantages:

[0017] The cystatin A of the present invention can be used as a marker for evaluating hematopoietic damage caused by long-term exposure to toxic substances such as benzene, and has good sensitivity, specificity and accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 CSTA test results of the control group and benzene exposure group;

[0019] Figure 2 The CSTA test results of the control group and leukemia group;

[0020] Figure 3 The ROC curve is drawn according to the CSTA expression levels in the control group and the leukemia group. The yellow line in the figure represents the baseline, the green line represents the ROC curve, and the dark blue line represents the line with a slope of 1. The intersection of the line and the ROC curve is the critical point, at which the sensitivity and specificity are the highest. DETAILED DESCRIPTION

[0021] The present invention provides a marker for evaluating the level of hematopoietic damage, wherein the marker is cystatin A (CSTA);

[0022] The nucleotide sequence of cystatin A is shown in SEQ ID NO.1.

[0023] The present invention also provides the use of the marker in preparing a product for evaluating the level of hematopoietic damage.

[0024] The present invention also provides a kit for evaluating the level of hematopoietic damage, wherein the kit comprises a reagent for detecting the marker.

[0025] The present invention also provides a primer pair for detecting the marker, wherein the upstream primer of the primer pair is shown as SEQ ID NO.2;

[0026] The downstream primer of the primer pair is shown as SEQ ID NO.3.

[0027] In the present invention, the method for detecting the marker is qRT-PCR.

[0028] The present invention also provides the use of the primer pair in preparing a product for detecting the marker.

[0029] The present invention also provides the use of the primer pair in preparing a product for evaluating the level of hematopoietic damage.

[0030] The present invention also provides a kit for detecting the marker, which comprises the primer pair.

[0031] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0032] In the present invention, the column-type whole blood RNAout kit was purchased from Beijing Tianenze Gene Technology Co., Ltd., and AllinOne RT Mixture IV (item number AM1804A) was purchased from Beijing Aomei Biotechnology Co., Ltd.

[0033] Example 1: Synthesis of primer pair nucleotide sequences for detecting CSTA

[0034] The primer pair for detecting the CSTA gene was designed based on the complete sequence of CSTA mRNA obtained from NCBI (as shown in SEQ ID NO.1, see NCBI ID: NM_005213.4), wherein the upstream primer is shown in SEQ ID NO.2 and the downstream primer is shown in SEQ ID NO.3, and was commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd. The nucleotide sequence of the primer pair is shown in Table 1.

[0035] Table 1 Nucleotide sequences of primer pairs for detecting CSTA

[0036] name Sequence (5'~3') SEQ ID NO. Upstream primer F:AAACCCGCCACTCCAGAAATC 2 Downstream primer R:CACCTGCTCGTACCTTAATGTAG 3

[0037] SEQ ID NO.1:

[0038] ACTTTGGTTCCAGCATCCTGTCCAGCAAAGAAGCAATCAGCCAAAATGATACCTGGAGGCTTATCTGAGGCCAAACCCGCCACTCCAGAAATCCAGGAGATTGTTGATAAGGTTAAACCACAGCTTGAAGAAAAAACAAATGAGACTTACGGAAAATTGGAAGCTGTGCAGTATAAAACTCAAGTTGTT.

[0039] Example 2: CSTA detection of benzene exposed population

[0040] (1) Group recruitment: From December 2018 to February 2019, 86 volunteers who were spray painters in auto repair shops were recruited from the occupational medical examination center of a hospital as the benzene exposure group, and 73 volunteers who were office workers in the same factory were recruited as the control group, including:

[0041] Inclusion criteria for the benzene exposure group: occupational benzene exposure for 2 years or more; undiagnosed or suspected cases of benzene poisoning; age range 20 to 50 years;

[0042] Inclusion criteria for the control group: no history of occupational benzene exposure, normal blood routine examination; no home decoration in the past 5 years; age range 20 to 50 years old;

[0043] Exclusion criteria for the benzene exposure group and the control group: recent or long-term exposure to radiation, CO, formaldehyde, etc.; blood system damage, hyperthyroidism, hypersplenism, etc. caused by taking cytotoxic drugs such as cyclophosphamide; long-term daily smoking or drinking for ≥10 years; history of infectious diseases such as influenza or history of taking anti-inflammatory drugs one month before recruitment; autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis, polymyositis, dermatomyositis, compensatory diseases, etc.;

[0044] The population study was approved by the Ethics Committee of Capital Medical University (Approval ID: 2016SY11);

[0045] (2) Peripheral blood sample collection: 5 mL of fasting venous blood was collected from each benzene exposure group and control group volunteer using an EDTA anticoagulant tube filled with EDTA-K2 anticoagulant. The EDTA anticoagulant tube was then slowly inverted 10 times to fully mix, to obtain peripheral blood samples of each volunteer;

[0046] (3) cDNA acquisition: The total RNA of each volunteer's peripheral blood sample was extracted using a column-based whole blood RNAout kit. The extraction steps were referred to the instructions of the column-based whole blood RNAout kit. The total RNA of each volunteer was then reverse transcribed into cDNA using AllinOne RT Mixture IV. The reverse transcription steps were referred to the instructions of AllinOne RT Mixture IV.

[0047] (4) Real-time fluorescence quantitative PCR (qRT-PCR) detection: The detection system is based on 10 μL, including 2.6 μL of PCR-grade sterile nuclease-free water, 5 μL of KAPA SYBR FAST qPCR MasterMix, 0.2 μL of each upstream primer and downstream primer of Example 1, 2 μL of each cDNA obtained in step (3), and β-Actin as an internal reference (the sequence of the internal reference primer is shown in Table 2); the qRT-PCR conditions are set as follows: the initial stage is 95°C, 3 min, the amplification stage is 95°C, 10 s→60°C, 30 s→72°C, 10 s, and a total of 40 cycles. After outputting the amplification results, 2 -ΔΔCt The qRT-PCR test results were obtained by calculation, such as Figure 1 shown.

[0048] Table 2 Nucleotide sequences of β-Actin primers

[0049] name Sequence (5'~3') SEQ ID NO. Upstream primer F:AGAGCTACGAGCTGCCTGAC 4 Downstream primer R:AGCACTGTGTTGGCGTACAG 5

[0050] The results showed that compared with the control group, the expression of CSTA gene in peripheral blood samples of the benzene exposure group was significantly upregulated, and the difference was statistically significant (P<0.01). This indicates that CSTA can be used as a marker to evaluate the level of hematopoietic damage caused by long-term exposure to toxic substances such as benzene.

[0051] Example 3: CSTA detection in leukemia patients

[0052] (1) Group recruitment: From February to August 2024, 78 leukemia patients were recruited from a cancer hospital as the leukemia group, and 14 healthy volunteers were recruited as the control group. The group study was approved by the Medical Ethics Committee of the hospital (Approval ID: 2020-KY-0091-001);

[0053] (2) Bone marrow sample collection: Bone marrow samples were collected from patients in each leukemia group by bone marrow puncture. Specifically, the patients in each leukemia group were placed in the right lateral decubitus position, and the left posterior superior iliac spine was used as the puncture point. Routine disinfection was performed with a disinfection range of 15 cm in diameter. Local infiltration anesthesia was performed with lidocaine hydrochloride until the periosteum was reached. Then, the puncture needle was inserted vertically into the skin at the puncture point. After the needle felt empty, the core needle was pulled out. 3 mL of red bone marrow fluid was aspirated with a syringe to obtain the bone marrow sample of each leukemia group. Finally, the core needle was inserted, the puncture needle was pulled out, local disinfection was performed, and compression was performed to stop bleeding.

[0054] (3)CD34 + Cell sample collection: Recombinant human granulocyte colony stimulating factor injection was injected subcutaneously in the upper arm of the volunteers in the control group to promote the proliferation and division of hematopoietic stem cells and release them into the peripheral blood; 5 mL of fasting venous blood was collected from the volunteers in each control group, and after centrifugation to collect blood cells, a buffer containing CD34 magnetic beads was added for resuspending, and the amount added was 10 8 Each blood cell contained 100 μL CD34 magnetic beads, which were fully mixed and placed in the dark at 4°C for 30 minutes. The unbound CD34 magnetic beads were washed away by centrifugation, and the cells bound to the CD34 magnetic beads were separated by separation columns. The cells bound to the CD34 magnetic beads were resuspended in 25 μL buffer at room temperature for 10 minutes in the dark, and 2 μL CD34 antibody was added and placed in the dark for 15 minutes again. The excess CD34 antibody was washed away with 1 mL Flowbuffer, and then 200 μL Flowbuffer was added to resuspend the cells bound to the CD34 magnetic beads and flow cytometry was performed to obtain the CD34 of the volunteers in each control group. + Cell sample; the formula of buffer is 100mL PBS+0.5g BSA+0.4mL EDTA;

[0055] (4) cDNA acquisition and qRT-PCR detection: The bone marrow samples of each leukemia group patient and CD34 + cDNA of cell samples and qRT-PCR detection were performed. The test results were as follows Figure 2 shown.

[0056] The results showed that compared with the control group, CD34 + Compared with the cell samples, the expression of CSTA in the bone marrow samples of the leukemia group was significantly upregulated, and the difference was statistically significant (P<0.01). This indicates that the expression of CSTA gradually increases during the hematopoietic damage process, and CSTA can be used as a marker to evaluate the level of hematopoietic damage caused by leukemia.

[0057] Example 4: CSTA test efficiency for evaluating the level of hematopoietic damage

[0058] The ROC curve was drawn based on the CSTA expression levels of the leukemia group and the control group in Example 3, and the critical point, sensitivity and specificity of the leukemia group and the control group were calculated. The results are as follows: Figure 3 shown.

[0059] The results showed that the CSTA expression level of 0.975 can be used as the optimal critical point for screening people with severe hematopoietic damage. At this time, the Youden index is 48.5%, the sensitivity is 62.8%, and the specificity is 85.7%. This shows that CSTA has a high degree of accuracy in evaluating the level of hematopoietic damage.

[0060] As can be seen from the above examples, the present invention provides a marker for evaluating the level of hematopoietic damage, a primer pair, a kit and its application. The CSTA of the present invention can be used as a marker for evaluating hematopoietic damage caused by long-term exposure to toxic substances such as benzene, and has good sensitivity, specificity and accuracy.

[0061] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A marker for evaluating the level of hematopoietic damage, characterized in that: The marker is cystatin A; The nucleotide sequence of cystatin A is shown in SEQ ID NO.

1.

2. Use of the marker according to claim 1 in the preparation of a product for evaluating the level of hematopoietic damage.

3. A kit for evaluating the level of hematopoietic damage, characterized in that: The kit comprises a reagent for detecting the marker of claim 1.

4. A primer pair for detecting the marker according to claim 1, characterized in that: The upstream primer of the primer pair is shown as SEQ ID NO.2; The downstream primer of the primer pair is shown as SEQ ID NO.

3.

5. Use of the primer pair according to claim 4 in preparing a product for detecting the marker according to claim 1.

6. Use of the primer pair according to claim 4 in the preparation of a product for evaluating the level of hematopoietic damage.

7. A kit for detecting the marker according to claim 1, characterized in that: The kit comprises the primer pair according to claim 4.

Images