Electrochemical biosensor and preparation method thereof

Abstract

The invention discloses an electrochemical biosensor and a preparation method, the electrochemical biosensor comprises a nucleic acid nanoprobe, a three-electrode system and a sensor platform, the three-electrode system comprises a working electrode, a reference electrode and a counter electrode, the nucleic acid nanoprobe is a three-metal nanoenzyme modified by a hairpin DNA S1 sequence, and the three-metal nanoenzyme is a three-metal nanoenzyme modified by the hairpin DNA S1 sequence. The sensor platform constructed by the invention comprises a three-legged DNA walker formed by hybridizing a hairpin DNA H1 sequence, a hairpin DNA H2 sequence and a hairpin DNA H3 sequence; according to the electrochemical biosensor prepared by the invention, the detection limit of an ultra-low expression miRNA-21 sequence reaches 1.6 aM, the constructed fitting equation is high in fitting degree and wide in detection concentration range, and the recognition degree of the miRNA-21 sequence is high, so that the method is higher in selectivity, false positive or false negative in detection can be effectively avoided, and the detection sensitivity is high. And accurate qualitative detection and quantitative analysis of the ultra-low expression miRNA-21 sequence in the early stage of cancer are facilitated.

Description

Technical Field

[0001] The invention belongs to the field of biosensors, relates to an electrochemical biosensor, and in particular to an electrochemical biosensor and a preparation method thereof. Background Art

[0002] MicroRNAs are a type of non-coding RNA specifically expressed in cells and tissues. They are rich in variety and generally have a size of 20-23 bases. Because of their short sequences, they are also called micro RNAs, or miRNAs for short. MicroRNAs participate in the regulation of many cell biological processes. Currently, there is evidence that MicroRNAs participate in the regulation of the occurrence of various cell carcinogenesis. Among them, miRNA-21 is the earliest miRNA discovered in the human genome. The literature "A micro-RNA expression signature of human solid tumors defines cancer gene targets" (Volinia S et al., published in Proc Nat 1 Acad Sci USA, 2006: 103, 2257-2261) discloses the miRNA expression profiles of 6 solid tumors including breast cancer, colon cancer, lung cancer, pancreatic cancer, prostate cancer and gastric cancer, among which miRNA-21 is the only miRNA whose expression is all elevated in all the above types of tumors.

[0003] Recent studies have also found that breast cancer-related miRNAs can be highly expressed and stably present in peripheral blood. Therefore, the detection of miRNAs in blood samples can help diagnose breast cancer. Moreover, the samples used can be obtained non-invasively. However, miRNAs are expressed at very low levels in the early stages of cancer, and miRNAs have the characteristics of small size, short sequence, and high sequence homology, which greatly increases the difficulty of accurate detection and quantitative analysis. For the detection of miRNAs, traditional detection methods, such as northern hybridization, quantitative reverse transcription polymerase chain reaction, and microfluidics technology, all have limitations in different aspects, such as the need for expensive instruments, which are not conducive to promotion and application, low sensitivity of the methods, which leads to insufficient accuracy, or overly cumbersome experimental operations.

[0004] Electrochemical biosensors refer to sensors that use immobilized organisms or their components as sensitive elements, electrodes as signal conversion elements, and potential or current as detection signals. They are widely used in clinical testing, gene diagnosis, bacterial and viral disease diagnosis, drug analysis, environmental testing and many other fields due to their advantages of convenient, rapid, sensitive, and non-radioactive testing operations. For example, the Chinese invention patent application "Electrochemical Biosensor and Its Preparation Method and Application" with document number 201110310297.8 discloses an electrochemical biosensor, which is composed of one, two or three electrodes, wherein the conductive layer of the electrode is composed of one or two of nano-platinum, nano-gold, nano-silver and nano-copper, and the material of the biological sensitive layer is an aqueous solution of bioactive molecules, preferably at least one of an aqueous solution of oxidoreductase, dehydrogenase, antibody, antigen and hormone. The document uses nanomaterials with a large specific surface area as working electrodes to improve the sensitivity of the sensor to a certain extent, but the disclosed minimum detection limit is only 0.1mM, which is far from meeting the detection limit requirements of ultra-low-expressed miRNA in early cancer. For the detection of miRNA, the Chinese invention patent application with document number 201510292239.5, "A DNA nanomachine for determining miRNA and its establishment and determination method", discloses a method of combining chain displacement technology and rolling circle amplification technology, using miRNA as "fuel" to construct a DNA nanomachine. This method uses fluorescence amplification to detect miRNA. Through the dual amplification technology of rolling circle amplification reaction and restriction endonuclease digestion reaction, an obvious fluorescence amplification signal can be generated. The rolling circle amplification used is a constant temperature amplification technology. Compared with traditional polymerase chain reaction and other technologies, it does not require cyclic temperature control and linear amplification. This method reduces the detection concentration of miRNA to the femtomolar level, but it is still impossible to detect miRNA samples with a concentration of attomole level, and the detection sensitivity still needs to be further improved.

[0005] In order to meet the needs of early diagnosis and prognosis of various cancers, it is necessary to detect ultra-low expressed miRNA-21, and there is an urgent need to provide a more sensitive, accurate and easy-to-use electrochemical biosensor. Summary of the invention

[0006] The present invention constructs an electrochemical biosensor for the detection of miRNA-21, aiming to improve the sensitivity and accuracy of the detection of ultra-low expressed miRNA-21 in serum samples of various early cancers.

[0007] The technical solution adopted by the present invention provides an electrochemical biosensor, including a nucleic acid nanoprobe, a three-electrode system and a ratiometric sensor platform, wherein the three-electrode system includes a working electrode, a reference electrode and a counter electrode, and the key is that the nucleic acid nanoprobe is a trimetallic nanozyme modified by a hairpin DNA S1 sequence, and the ratiometric sensor platform includes the nucleic acid nanoprobe and a tripod DNA walker formed by hybridization of a hairpin DNA H1 sequence, a hairpin DNA H2 sequence and a hairpin DNA H3 sequence;

[0008] The sequence of the hairpin DNA S1 is: 5′-AGCTTATCAGACCCACTATrAGGAAGTCTGATCAACATCAGTCTGATAAGCTA-3′;

[0009] The sequence of the hairpin DNA H1 is: 5′-GAAGTCTGATCAGCTTATCAGTAGCTTATCAG ACTGATGTTGATCAGACTTCTCCGAGCCGGTCGAAATAGTGGGT-3′;

[0010] The sequence of the hairpin DNA H2 is: 5′-TATCAGTGATAAACTGATGTTGATACCACTCA CTTATCACTGATAAGCTGATCAGACTTCTCAGACTTCTCCGAGCCGGTCGAAATAG TGGGT-3′;

[0011] The sequence of the hairpin DNA H3 is: 5′-GTGAGTGGTATCAACATCAGTTCAGACTTCTCCGAGCCGGTCGAAATAGTGGGT-3′;

[0012] The DNA H1 sequence, DNA H2 sequence and DNA H3 sequence all contain deoxyribonuclease fragments.

[0013] Specifically, the surface modification material of the working electrode is a bimetallic nanocomposite material, the bimetallic nanocomposite material is a C1-MoSe2 / MXenes bimetallic nanocomposite material modified by a DNA C1 sequence, and the DNAC1 sequence is: 5′-ATAGTGGGTCTGATAAGCT-3′; the working electrode is a glassy carbon electrode.

[0014] More specifically, the above-mentioned trimetallic nanozyme is a S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme in which a single-atom iron-containing nanozyme is anchored to a Nd2O3-Ir bimetallic nanozyme and modified by a hairpin DNA S1 sequence.

[0015] A method for preparing an electrochemical biosensor is used to prepare the above electrochemical biosensor. The key lies in that the specific operation steps are:

[0016] S1. Preparation of MoSe2 / MXenes nanocomposites:

[0017] S1-1, add 1g Ti3AlC2 powder to 10mL-20mL of LiF and HCl mixed solution and dissolve it, continue stirring and react at 30℃-40℃ for 20h-24h to obtain Ti3C2Tx, centrifuge, wash with ultrapure water, and freeze-dry after ultrasonic treatment to prepare Ti3C2Tx dry powder;

[0018] S1-2, dissolving 0.04 g of selenium powder in 4 mL to 8 mL of hydrazine hydrate to prepare solution A;

[0019] S1-3, dissolving 0.02 g of sodium molybdate dihydrate in 20 mL to 30 mL of water to prepare solution B;

[0020] S1-4, the Ti3C2Tx dry powder, solution A and solution B are transferred into an autoclave and heated to 200°C to 240°C, centrifuged, washed with ultrapure water, and subjected to ultrasonic treatment, followed by freeze drying to obtain MoSe2 / MXenes nanoparticles;

[0021] Surface modification and DNA modification of S2, MoSe2 / MXenes nanoparticles:

[0022] S2-1, adding 0.2 g to 0.3 g of sodium citrate to 10 mL to 15 mL of an aqueous solution containing 0.25 mg of MoSe2 / MXenes nanoparticles, mixing and stirring to prepare a carboxyl-protected MoSe2 / MXenes NPs solution;

[0023] S2-2, adding 1 mg of 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.2 mg to 0.3 mg of N-hydroxysuccinimide to 1 mL of the MoSe2 / MXenes NPs solution, washing with phosphate buffer and incubating for 8 h to 12 h, adding a DNA C1 sequence solution and reacting, washing and sealing with a bovine serum albumin solution, and preparing a C1-MoSe2 / MXenes bimetallic nanocomposite solution;

[0024] S3. Preparation of single-atom iron-containing nanozymes:

[0025] S3-1, calcining potassium citrate at 800°C to 880°C under N2 protection environment, washing, adjusting the pH to neutral, and drying to obtain porous carbon powder;

[0026] S3-2, adding ferrous chloride and 1,10-phenanthroline monohydrate solution to ethanol, adding porous carbon powder after ultrasonic treatment, stirring and evaporating ethanol, mixing with melamine, calcining at 700° C. to 800° C. under N2 protection environment, and then cooling;

[0027] S3-3, treated with H2SO4 solution, washed and dried to obtain single-atom iron-containing nanozymes;

[0028] Preparation of S4, Nd2O3-Ir bimetallic nanozymes:

[0029] S4-1, dissolving 1.0 g of iridium chloride in ethylene glycol and stirring, adjusting the pH, heating at 160°C to 170°C for 2h to 4h in flowing argon, cooling, centrifuging, washing, and drying to obtain Ir NPs powder;

[0030] S4-2, adding 20 mL of toluene to 6.0 mL to 6.5 mL of ethanol solution containing potassium oleate, and then mixing with 12 mL to 14 mL of Nd(NO3)3 aqueous solution, heating to 70°C to 80°C, stirring, separating the toluene supernatant, and preparing a complex solution;

[0031] S4-3, adding 5 mL of oleylamine and the Ir NPs powder prepared in step S4-1 to the complex solution, stirring, transferring to 20 mL of an aqueous solution of tert-butylamine, heating in an autoclave at 180° C. to 190° C. for 20 h to 28 h, washing, centrifuging, and drying;

[0032] S4-4, then uniformly heating to 700°C to 750°C and maintaining for 4h to 6h to obtain Nd2O3-Ir nanoparticles;

[0033] S4-5, dissolving 0.25 mg of Nd2O3-Ir nanoparticles in 10 mL to 15 mL of water, adding 0.2 g to 0.3 g of sodium citrate, stirring and mixing to prepare a carboxyl-protected Nd2O3-Ir NPs solution, and washing and drying to obtain a bimetallic nanozyme Nd2O3-Ir NPs powder;

[0034] S5. Anchoring the single-atom iron-containing nanozyme on the bimetallic nanozyme and functionalizing it:

[0035] S5-1, single-atom iron-containing nanozymes and Nd2O3-Ir NPs powders were mixed in a mass ratio of 10 to 12:1, added to a dimethylformamide solution, and a colloidal suspension with a concentration of 1.0 g / L to 1.2 g / L was prepared. After ultrasonic treatment, a Nd2O3-Ir-Fe-NC solution was prepared;

[0036] S5-2, 1 mg of 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.2 mg to 0.3 mg of N-hydroxysuccinimide were added to 1 mL of Nd2O3-Ir-Fe-NC solution, washed with phosphate buffer and incubated for 8 h to 12 h, hairpin DNA S1 sequence solution was added and reacted, washed and blocked with bovine serum albumin solution, and S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme solution was prepared by magnetic separation;

[0037] S6. Construction of sensor platform and three-legged DNA walker:

[0038] S6-1, treating the bare working electrode with alumina powder and performing ultrasonic pretreatment, dripping the C1-MoSe2 / MXenes bimetallic nanocomposite solution prepared in step S2 onto the pretreated working electrode, drying at room temperature, dripping bovine serum albumin solution, and rinsing with phosphate buffer;

[0039] S6-2, respectively, add the S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme solution and the miRNA-21 sequence solution to be tested into a centrifuge tube, the miRNA-21 sequence hybridizes with the hairpin DNA S1 sequence on the S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme to form a double-stranded structure, add the hairpin DNA H1 sequence solution, the hairpin DNA H1 sequence replaces the miRNA-21 sequence and hybridizes with the DNA S1 sequence, so that the replaced miRNA-21 sequence can enter the cycle amplification; add the hairpin DNA H2 sequence solution and the hairpin DNA H3 sequence solution, so that the hairpin DNA H1 sequence, the hairpin DNA H2 sequence, and the hairpin DNA H3 sequence form a three-legged DNA walker, and incubate in a centrifuge tube; the added hairpin DNA H1 sequence, the hairpin DNA H2 sequence, and the DNA H3 sequence all contain deoxyribonuclease fragments, which can be used as DNA enzymes to cut the S1 chain;

[0040] S6-3. Add Zn to the centrifuge tube 2+ In the solution, the deoxynuclease fragments on the hairpin DNA H1 sequence, the hairpin DNA H2 sequence, and the DNA H3 sequence cut the DNA S1 sequence on the trimetallic nanozyme, and the cut trimetallic nanozyme is captured by DNAC1 on the electrode surface to generate a current response;

[0041] S6-4. Immerse the electrode processed in step S6-1 into a centrifuge tube to capture the nanoprobe after the signal amplification reaction to construct a sensor platform.

[0042] Furthermore, in the above step S2-1, the mass ratio of sodium citrate and MoSe2 / MXenes nanoparticles is 800-1200:1; in the above step S4-2, the concentration of Nd(NO3)3 in the Nd(NO3)3 aqueous solution is 0.028M-0.030M, and the concentration of potassium oleate in the above potassium oleate ethanol solution is 0.15M-0.18M; in the above step S4-3, the concentration of the aqueous solution of tert-butylamine is 0.07M-0.08M.

[0043] Furthermore, the ultrasonic treatment conditions in the above steps S1-1 and S1-4 are 28kHz to 45kHz, each treatment lasts 4h to 8h, and the treatment is performed 3 to 5 times.

[0044] Preferably, Zn is added in the above step S6-2. 2+ Zn in solution 2+ The concentration is 10μM~20μM.

[0045] Specifically, the above-mentioned S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme solution, the mi-RNA 21 sequence to be tested, the hairpin DNA H1 sequence, the hairpin DNA H2 sequence, the hairpin DNA H3 sequence, and the Zn 2+ The volume ratio of the solution is 5:5:2:2:2:5; the concentrations of the hairpin DNA C1 sequence, the hairpin DNA S1 sequence, the hairpin DNA H1 sequence, the hairpin DNA H2 sequence and the hairpin DNA H3 sequence are each 0.5 μM to 0.6 μM.

[0046] It should be noted that the electrochemical biosensor prepared above is used for the detection of miRNA-21 sequence, and Zn 2+ The auxiliary deoxynuclease cuts the DNA S1 sequence on the incubated trimetallic nanozyme.

[0047] Compared with the prior art, the present invention has the following beneficial effects:

[0048] The present invention constructs an electrochemical biosensor, using MoSe2 / MXenes nanocomposite as the surface modification material of the working electrode, and constructs a new Nd2O3-Ir-Fe-NC trimetallic nanozyme by anchoring and encapsulating single-atom iron-containing nanozyme on the surface of an ultrasmall Nd2O3-Ir bimetallic nanozyme. The aptamer is used as a carrier to bind the aptamer, and a sensing platform is constructed by using a nucleic acid nanoprobe combined with a tripod DNA walker to amplify the reaction.

[0049] The MoSe2 / MXenes nanocomposite material modified with MoSe2 in the present invention makes it difficult for MoSe2 to agglomerate and stack together in a loose state, resulting in developed porosity, expanding the interlayer distance and electron transfer. The MoSe2 / MXenes nanocomposite material modified with the modified DNA C1 sequence can increase biocompatibility and active sites, and can anchor more nucleic acid nanoprobes.

[0050] The novel Nd2O3-Ir-Fe-NC trimetallic nanozyme constructed by the present invention can strongly and specifically bind between biomolecules and Nd2O3 surfaces, increase the biomolecule loading, improve sensitivity and facilitate the improvement of signal amplification. The Ir element in the nanoparticles can not only successfully fix enzymes, proteins or DNA, but also help retain their biological activity, further improving the detection sensitivity. In order to produce stronger electrochemical signals, single-atom iron-containing metal enzymes are anchored on Nd2O3-Ir nanoparticles, which can greatly enhance the catalytic activity. Therefore, the trimetallic nanozyme particles prepared by the present invention have excellent peroxidase-like activity and electrocatalytic activity. Due to the self-enhanced electrochemical signal exhibited by geometric and electronic effects, it has better stability, more sufficient surface active area, can provide sufficient catalytic active sites, and can maintain sufficient contact time with the reactants, and has better anti-electromigration ability than bimetallic or monometallic nanoparticles. The present invention increases the binding sites of biomolecules, improves biocompatibility, fixes specific nucleic acid aptamers, enhances selectivity and reduces false positive or false negative results, and has better catalytic activity.

[0051] The signal amplification principle of the present invention is that the above-mentioned Nd2O3-Ir-Fe-NC trimetallic nanozyme with high mimetic enzyme activity and the MoSe2 / MXenes nanocomposite material with excellent conductivity and large specific surface area are used as electrode surface modification materials. When the detection target, i.e., miRNA-21, is present, the DNAS1 sequence labeled by the trimetallic nanozyme can hybridize with the targeted miRNA-21 sequence to form a double-stranded structure. When the hairpin DNA H1 sequence is added, the hairpin DNA H1 sequence replaces the target and hybridizes with DNA1S1, and the replaced miRNA-21 sequence enters the cyclic amplification; in the presence of the hairpin DNA H2 sequence and the DNA H3 sequence, the hairpin DNA H1 sequence, the DNA H2 sequence, and the DNA H3 sequence hybridize to form a tripod DNA walker. Therefore, a miRNA-21 sequence can trigger multiple tripod DNA walkers to achieve signal amplification.

[0052] The hairpin DNA H1 sequence, the hairpin DNA H2 sequence and the hairpin DNA H3 sequence used in the present invention include a deoxyribonuclease sequence, which can be 2+Under the action of S1, the DNA1 S1 labeled with the trimetallic nanozyme is cut, and the cut trimetallic nanozyme is more easily captured, thereby generating richer signals and higher current response. The present invention not only enables the tripod DNA walker to take advantage of the high walking speed of the multi-legged walker, but also does not reduce the sensitivity and reproducibility of the biosensor due to the complex probe design.

[0053] The electrochemical biosensor of the present invention has a detection limit of 1.6aM for ultra-low expression miRNA-21 sequences, and the constructed fitting equation has a high degree of fitting and a wide detection concentration range. In addition, the sensor of the present invention has a high recognition degree for miRNA-21 sequences and a higher selectivity, which can effectively avoid false positives or false negatives in detection, and is helpful for accurate qualitative detection and quantitative analysis of ultra-low expression miRNA-21 sequences in early cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 This is a scanning electron microscope image of MXenes material (8.4mm×30.0k, SE mode);

[0055] Figure 2 It is the scanning electron microscope image of MoSe2 / MXenes nanocomposite (9.3mm×7.0k, SE mode);

[0056] Figure 3 It is the scanning electron microscope image of MoSe2 / MXenes nanocomposite (9.3mm×50.0k, SE mode);

[0057] Figure 4 is the transmission electron microscopy image of Nd2O3-Ir nanoparticles (100nm, TEM mode);

[0058] Figure 5 are the detection results of the electrochemical biosensor of the present invention at different target concentrations;

[0059] Figure 6 is the standard curve of the electrochemical biosensor of the present invention for testing miRNA-21 detection;

[0060] Figure 7 It is the test result of the present invention for different miRNA sequences;

[0061] Figure 8 This is a comparison chart of impedance results for different materials;

[0062] Fig. 9 It is the result of catalytic activity of different bimetallic nanozymes;

[0063] Fig.10 It is the result of the catalytic activity of different trimetallic nanozymes. DETAILED DESCRIPTION

[0064] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0065] If no specific conditions are specified in the examples, the experiments can be carried out under conventional conditions; if no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0066] Table 1: Gene sequence table involved in the present invention

[0067]

[0068]

[0069] Note: The rA base in the DNA S1 sequence in Table 1 is derived from an RNA base; the underlined portion in Table 1 is a deoxynuclease, which can be used as a DNA enzyme to cleave the S1 chain.

[0070] Embodiment 1

[0071] S1. Preparation of MoSe2 / MXenes nanocomposites:

[0072] S1-1, add 1g Ti3AlC2 powder to 15mL of LiF and HCl mixed solution and dissolve it, continue stirring and react at 35°C for 22h to obtain Ti3C2Tx, centrifuge, wash with ultrapure water, treat at 35kHz for 6h each time, ultrasonically treat 4 times and then freeze-dry to obtain Ti3C2Tx dry powder;

[0073] S1-2, dissolving 0.04 g of selenium powder in 6 mL of hydrazine hydrate to prepare solution A;

[0074] S1-3, dissolving 0.02 g of sodium molybdate dihydrate in 25 mL of water to prepare solution B;

[0075] S1-4, the Ti3C2Tx dry powder, solution A and solution B are transferred into an autoclave and heated to 220°C, centrifuged, washed with ultrapure water, treated at 25kHz for 6h each time, ultrasonically treated 3 times and then freeze-dried to obtain MoS e2 / MXenes nanoparticles;

[0076] Surface modification and DNA modification of S2, MoSe2 / MXenes nanoparticles:

[0077] S2-1, adding 0.2 g of sodium citrate to 12 mL of an aqueous solution containing 0.25 mg of MoSe2 / MXenes nanoparticles, mixing and stirring to prepare a carboxyl-protected MoSe2 / MXenes NPs solution;

[0078] S2-2, adding 1 mg of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 0.2 mg to 0.3 mg of N-hydroxysuccinimide to 1 mL of the MoSe2 / MXenes NPs solution, washing with phosphate buffer and incubating for 10 h, adding a 0.5 μM DNA C1 sequence solution and reacting overnight, washing and blocking with a bovine serum albumin solution to prepare a C1-MoSe2 / MXenes bimetallic nanocomposite solution;

[0079] S3. Preparation of single-atom iron-containing nanozymes:

[0080] S3-1, calcining potassium citrate at 800°C under N2 protection for 2h, washing, adjusting the pH to neutral, and drying to obtain porous carbon powder;

[0081] S3-2, add 0.6mmol ferrous chloride and 3mmol 1,10-phenanthroline monohydrate solution to 20mL ethanol, add porous carbon powder after ultrasonic vibration for 20min, stir for 20min and evaporate ethanol at 60℃ until ethanol evaporates completely, mix with melamine, transfer to a quartz boat, calcine at 700℃ under N2 protection environment at a heating rate of 5℃ / min for 2h, and then cool;

[0082] S3-3, treated with 1M H2SO4 solution for 2h to remove unstable metal particles, and then washed with distilled water and ethanol and dried to obtain single-atom iron-containing nanozymes;

[0083] Preparation of S4, Nd2O3-Ir bimetallic nanozymes:

[0084] S4-1, dissolving 1.0 g of iridium chloride in 150 mL of ethylene glycol and stirring, adjusting the pH value to 10, heating at 160° C. for 2 h in flowing argon, cooling, centrifuging, washing, and drying to obtain Ir NPs powder;

[0085] S4-2, add 20 mL of toluene to 6.0 mL of 0.15 M ethanol solution of potassium oleate, mix with 12 mL of 0.028 M Nd(NO3)3 aqueous solution, heat to 75°C, stir vigorously, separate the toluene supernatant phase after separation, the volume is about 20 mL, and prepare a complex solution;

[0086] S4-3, adding 5 mL of oleylamine and the Ir NPs powder prepared in step S4-1 to the complex solution, stirring for 10 min, transferring to 20 mL of an aqueous solution of 0.07 M tert-butylamine, heating in an autoclave at 180° C. for 24 h, washing with ethanol, centrifuging, and drying;

[0087] S4-4, then heating to 700°C at a rate of 10°C / min in air and maintaining for 6 hours to obtain Nd2O3-Ir nanoparticles;

[0088] S4-5, dissolving 0.25 mg of Nd2O3-Ir nanoparticles in 10 mL of water, adding 0.2 g of sodium citrate, stirring and mixing to prepare a carboxyl-protected Nd2O3-Ir NPs solution, and washing and drying to obtain Nd2O3-Ir NPs powder;

[0089] S5. Anchoring the single-atom iron-containing nanozyme on the bimetallic nanozyme and functionalizing it:

[0090] S5-1, single-atom iron-containing nanozyme and Nd2O3-Ir NPs powder were mixed in a mass ratio of 10:1, added to a dimethylformamide solution, and a colloidal suspension with a concentration of 1.0 g / L was prepared. After ultrasonic treatment for 6 h, a Nd2O3-Ir-Fe-NC solution was prepared;

[0091] S5-2, adding 1 mg of 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.2 mg to 0.3 mg of N-hydroxysuccinimide to 1 mL of the Nd2O3-Ir-Fe-NC solution, washing with phosphate buffer and incubating for 10 h, adding a 0.5 μM DNA S1 sequence solution and reacting overnight, washing and blocking with a bovine serum albumin solution, and preparing S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme suspended in phosphate buffer by magnetic separation;

[0092] S6. Construction of sensor platform and three-legged DNA walker:

[0093] S6-1, treating the bare working electrode with alumina powder and performing ultrasonic pretreatment, dripping the C1-MoSe2 / MXenes bimetallic nanocomposite solution prepared in step S2 onto the pretreated working electrode, drying at room temperature, dripping bovine serum albumin solution, and rinsing with phosphate buffer;

[0094] S6-2, respectively, add 5 μL of S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme solution and 5 μL of the miRNA A-21 sequence solution to be tested into a centrifuge tube, the miRNA-21 sequence hybridizes with the DNAS1 sequence on the S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme to form a double-stranded structure, add 2 μL of a 0.5 μM hairpin DNA H1 sequence solution, the hairpin DNA H1 sequence replaces the miRNA-21 sequence and hybridizes with the DNA S1 sequence, so that the replaced miRNA-21 sequence can enter the cycle amplification; add 2 μL of a 0.5 μM hairpin DNA H2 sequence solution and 2 μL of a 0.5 μM hairpin DNA H3 sequence solution, the hairpin DNA H1 sequence, the hairpin DNA H2 sequence, and the hairpin DNA H3 sequence form a tripod DNA walker, and incubate in a centrifuge tube;

[0095] S6-3, add 5 μL of 15 μM Zn 2+ In the solution, the deoxynuclease fragments on the hairpin DNA H1 sequence, the hairpin DNA H2 sequence, and the DNA H3 sequence cut the DNA S1 sequence on the trimetallic nanozyme, and the cut trimetallic nanozyme is captured by DNA C1 on the electrode surface, generating a current response;

[0096] S6-4. Immerse the electrode processed in step S6-1 into a centrifuge tube to capture the nanoprobe after the signal amplification reaction to construct a sensor platform.

[0097] Embodiment 2

[0098] S1. Preparation of MoSe2 / MXenes nanocomposites:

[0099] S1-1, add 1g Ti3AlC2 powder to 10mL of LiF and HCl mixed solution and dissolve it, continue stirring and react at 40°C for 20h to obtain Ti3C2Tx, centrifuge, wash with ultrapure water, treat at 28kHz for 8h each time, ultrasonically treat 3 times and then freeze-dry to obtain Ti3C2Tx dry powder;

[0100] S1-2, dissolving 0.04 g of selenium powder in 4 mL of hydrazine hydrate to prepare solution A;

[0101] S1-3, dissolving 0.02 g of sodium molybdate dihydrate in 30 mL of water to prepare solution B;

[0102] S1-4, the Ti3C2Tx dry powder, solution A and solution B are transferred into an autoclave and heated to 200°C, centrifuged, washed with ultrapure water, treated at 45kHz for 8h each time, ultrasonically treated 5 times and then freeze-dried to obtain MoS e2 / MXenes nanoparticles;

[0103] Surface modification and DNA modification of S2, MoSe2 / MXenes nanoparticles:

[0104] S2-1, adding 0.3 g of sodium citrate to 10 mL of an aqueous solution containing 0.25 mg of MoSe2 / MXenes nanoparticles, mixing and stirring to prepare a carboxyl-protected MoSe2 / MXenes NPs solution;

[0105] S2-2, adding 1 mg of 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.2 mg to 0.3 mg of N-hydroxysuccinimide to 1 mL of the MoSe2 / MXenes NPs solution, washing with phosphate buffer and incubating for 8 h, adding a 0.6 μM DNA C1 sequence solution and reacting overnight, washing and blocking with a bovine serum albumin solution to prepare a C1-MoSe2 / MXenes bimetallic nanocomposite solution;

[0106] S3. Preparation of single-atom iron-containing nanozymes:

[0107] S3-1, same as step S3-1 in Example 1, except that the calcination temperature is 840°C;

[0108] S3-2, same as step S3-2 in Example 1, except that the calcination temperature is 800°C;

[0109] S3-3, same as step S3-3 in embodiment 1;

[0110] Preparation of S4, Nd2O3-Ir bimetallic nanozymes:

[0111] S4-1, same as step S4-1 in Example 1, except that the heating is performed at 170° C. for 4 h;

[0112] S4-2, add 20 mL of toluene to 6.2 mL of 0.18 M ethanol solution of potassium oleate, mix with 13 mL of 0.030 M Nd(NO3)3 aqueous solution, heat to 70°C, stir vigorously, separate the toluene supernatant phase after separation, the volume is about 20 mL, and prepare a complex solution;

[0113] S4-3, adding 5 mL of oleylamine and the Ir NPs powder prepared in step S4-1 to the complex solution, stirring for 10 min, transferring to 20 mL of an aqueous solution of 0.08 M tert-butylamine, heating in an autoclave at 190° C. for 24 h, washing with ethanol, centrifuging, and drying;

[0114] S4-4, then heating to 730°C in air at a rate of 10°C / min and maintaining for 4 hours to obtain Nd2O3-Ir nanoparticles;

[0115] S4-5, dissolving 0.25 mg of Nd2O3-Ir nanoparticles in 12 mL of water, adding 0.3 g of sodium citrate, stirring and mixing to prepare a carboxyl-protected Nd2O3-Ir NPs solution, and washing and drying to obtain Nd2O3-Ir NPs powder;

[0116] S5. Anchoring the single-atom iron-containing nanozyme on the bimetallic nanozyme and functionalizing it:

[0117] S5-1, the same as step S5-1 in Example 1, except that the mass ratio of the single-atom iron-containing nanozyme to the Nd2O3-Ir NPs powder is 11:1, and the concentration of the colloidal suspension is 1.2 g / L;

[0118] S5-2, adding 1 mg of 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.2 mg to 0.3 mg of N-hydroxysuccinimide to 1 mL of the Nd2O3-Ir-Fe-NC solution, washing with phosphate buffer and incubating for 8 h, adding a 0.6 μM DNA S1 sequence solution and reacting overnight, washing and blocking with a bovine serum albumin solution, and preparing S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme suspended in phosphate buffer by magnetic separation;

[0119] S6. Construction of sensor platform and three-legged DNA walker:

[0120] The steps are the same as those in Example 1, except that in step S6-2, the concentration of the hairpin DNA H1 sequence solution is 0.6 μM, the concentration of the hairpin DNA H2 sequence solution is 0.6 μM, the concentration of the hairpin DNA H3 sequence solution is 0.6 μM, and the concentration of Zn 2+ The concentration of the solution was 10 μM.

[0121] Embodiment 3

[0122] S1. Preparation of MoSe2 / MXenes nanocomposites:

[0123] S1-1, add 1g Ti3AlC2 powder to 20mL of LiF and HCl mixed solution and dissolve it, continue stirring and react at 30°C for 24h to obtain Ti3C2Tx, centrifuge, wash with ultrapure water, treat at 45kHz for 4h each time, ultrasonically treat 5 times and then freeze-dry to obtain Ti3C2Tx dry powder;

[0124] S1-2, dissolving 0.04 g of selenium powder in 8 mL of hydrazine hydrate to prepare solution A;

[0125] S1-3, dissolving 0.02 g of sodium molybdate dihydrate in 20 mL of water to prepare solution B;

[0126] S1-4, the Ti3C2Tx dry powder, solution A and solution B are transferred into an autoclave and heated to 240°C, centrifuged, washed with ultrapure water, treated at 35kHz for 4h each time, ultrasonically treated 4 times and then freeze-dried to obtain MoS e2 / MXenes nanoparticles;

[0127] Surface modification and DNA modification of S2, MoSe2 / MXenes nanoparticles:

[0128] S2-1, adding 0.25 g of sodium citrate to 15 mL of an aqueous solution containing 0.25 mg of MoSe2 / MXenes nanoparticles, mixing and stirring to prepare a carboxyl-protected MoSe2 / MXenes NPs solution;

[0129] S2-2, adding 1 mg of 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.2 mg to 0.3 mg of N-hydroxysuccinimide to 1 mL of the MoSe2 / MXenes NPs solution, washing with phosphate buffer and incubating for 12 h, adding a DNA C1 sequence solution with a concentration of 0.55 μM and reacting overnight, washing and blocking with a bovine serum albumin solution to prepare a C1-MoSe2 / MXenes bimetallic nanocomposite solution;

[0130] S3. Preparation of single-atom iron-containing nanozymes:

[0131] S3-1, same as step S3-1 in Example 1, except that the calcination temperature is 880°C;

[0132] S3-2, same as step S3-2 in Example 1, except that the calcination temperature is 750°C;

[0133] S3-3, same as step S3-3 in embodiment 1;

[0134] Preparation of S4, Nd2O3-Ir bimetallic nanozymes:

[0135] S4-1, S4-1, same as step S4-1 in Example 1, except that heating is performed at 165° C. for 3 h;

[0136] S4-2, add 20 mL of toluene to 6.5 mL of 0.15 M ethanol solution of potassium oleate, mix with 14 mL of 0.029 M Nd(NO3)3 aqueous solution, heat to 80°C, stir vigorously, separate the toluene supernatant phase after separation, the volume is about 20 mL, and prepare a complex solution;

[0137] S4-3, adding 5 mL of oleylamine and the Ir NPs powder prepared in step S4-1 to the complex solution, stirring for 10 min, transferring to 20 mL of an aqueous solution of 0.078 M tert-butylamine, heating in an autoclave at 185° C. for 28 h, washing with ethanol, centrifuging, and drying;

[0138] S4-4, then heating to 750°C in air at a rate of 10°C / min and maintaining for 5h to obtain Nd2O3-Ir nanoparticles;

[0139] S4-5, dissolving 0.25 mg of Nd2O3-Ir nanoparticles in 15 mL of water, adding 0.25 g of sodium citrate, stirring and mixing to prepare a carboxyl-protected Nd2O3-Ir NPs solution, and washing and drying to obtain Nd2O3-Ir NPs powder;

[0140] S5. Anchoring the single-atom iron-containing nanozyme on the bimetallic nanozyme and functionalizing it:

[0141] S5-1, same as step S5-1 in Example 1, except that the mass ratio of the single-atom iron-containing nanozyme to the Nd2O3-Ir NPs powder is 12:1, and the concentration of the colloidal suspension is 1.1 g / L;

[0142] S5-2, adding 1 mg of 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.2 mg to 0.3 mg of N-hydroxysuccinimide to 1 mL of the Nd2O3-Ir-Fe-NC solution, washing with phosphate buffer and incubating for 12 h, adding a DNA S1 sequence solution with a concentration of 0.55 μM and reacting overnight, washing and blocking with a bovine serum albumin solution, and preparing S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme suspended in phosphate buffer by magnetic separation;

[0143] S6. Construction of sensor platform and three-legged DNA walker:

[0144] The steps are the same as those in Example 1, except that in step S6-2, the concentration of the hairpin DNA H1 sequence solution is 0.55 μM, the concentration of the hairpin DNA H2 sequence solution is 0.55 μM, the concentration of the hairpin DNA H3 sequence solution is 0.55 μM, and the concentration of Zn 2+ The concentration of the solution was 20 μM.

[0145] Measurement and analysis

[0146] 1. The commercially available MXenes materials and the MoS e2 / MXenes nanocomposites prepared by the present invention were observed under the SEM mode. The results are shown in the attached Figures 1 to 3 .

[0147] The experimental results show that after MXenes are modified with MoSe2, the huge specific surface area of ​​MXenes provides abundant attachment sites for MoSe2, making it difficult for MoSe2 to agglomerate, thus avoiding the situation where MoSe2 agglomerates and destroys the electrode structure. In addition, the MoSe2 / MXenes nanocomposites are stacked together in a loose state, resulting in developed porosity, expanding the interlayer distance and electron transfer.

[0148] Not only that, the modified MoSe2 / MXenes nanocomposites with DNA C1 sequences also have increased biocompatibility and active sites, and are able to anchor more nucleic acid nanoprobes.

[0149] 2. Observation of the Nd2O3-Ir nanoparticles prepared by the present invention using a transmission electron microscope. Figure 4 .

[0150] Nd2O3 not only has unique redox properties and plays an important role in catalytic activity, but also has a unique surface chemical structure. Nd2O3 has a high surface area and is porous, which can adsorb more reactants, provide sufficient active sites for reactants, and promote efficient catalytic reactions. Therefore, biomolecules can bind strongly and specifically to the Nd2O3 surface, increase the biomolecule loading, improve sensitivity and facilitate signal amplification. The Ir element in the nanoparticles can not only successfully fix enzymes, proteins or DNA, but also help retain their biological activity, further improving detection sensitivity. The trimetallic nanozyme particles prepared by the present invention increase the binding sites of biomolecules, improve biocompatibility, fix specific biorecognition molecules, enhance selectivity and reduce false positive or false negative results, and have better catalytic activity.

[0151] 3. Using the electrochemical biosensor prepared by the present invention, the target concentration was changed, and 0.01fM, 0.1fM, 1fM, 10fM, 100fM, 1pM, 10pM, 100pM, and 1nM miRNA-21 solutions were added respectively, and electrochemical measurements were performed in 0.01M phosphate buffer (pH=7.4) using differential pulse voltammetry (DPV). The results are shown in Figure 5 .

[0152] The peak current of the DPV curves of different concentrations of targets was plotted, and the correlation equation between the current change value (△I) and the logarithm of the miRNA-21 concentration was established. The results are shown in Figure 6 , the fitting equation is obtained by calculation:

[0153] y=0.18533LogC miRNA-21 +1.05134,R 2 =0.98443.

[0154] After calculation and verification, the detection limit of the electrochemical biosensor prepared by the present invention for miRNA-21 is 1.6aM. It can be seen that the electrochemical sensor prepared by the present invention has good sensitivity and exhibits a relatively wide detection range and an extremely low detection limit.

[0155] 4. The electrochemical biosensor prepared by the present invention was used to detect blood samples 1 to 5 with known concentrations of miRNA-21 solution. The results are shown in Table 2.

[0156] Table 2: Comparison of test results and theoretical values ​​of samples 1-8

[0157] Sample number to be tested Theoretical value (M) Detection value (M) 1 <![CDATA[5.0×10 -15 ]]> <![CDATA[5.01×10 -15 ]]> 2 <![CDATA[2.0×10 -15 ]]> <![CDATA[2.01×10 -15 ]]> 3 <![CDATA[3.0×10 -15 ]]> <![CDATA[3.01×10 -15 ]]> 4 <![CDATA[1.0×10 -15 ]]> <![CDATA[1.00×10 -15 ]]> 5 <![CDATA[2.0×10 -18 ]]> <![CDATA[1.98×10 -18 ]]>

[0158] As can be seen from the results in Table 2, the electrochemical biosensor prepared by the present invention has a very high detection accuracy for ultra-low content miRNA-21, and can be used for the detection of ultra-low expressed miRNA-21 in the early stage of cancer. At the same time, the entire detection process is simple to operate and the detection is fast, which has great application value in biomedical research and clinical diagnosis.

[0159] V. The selectivity of the electrochemical biosensor of the present invention was verified by detecting different types of miRNA sequences with known concentrations. Electrochemical measurements were performed using differential pulse voltammetry (DPV) in 0.01 M phosphate buffer (pH = 7.4). The results are shown in Figure 7 .

[0160] Sample a: blank targeting;

[0161] Sample b: miRNA-126;

[0162] Sample c: miRNA-155;

[0163] Sample d: miRNA-141;

[0164] Sample e: mixed sample (miRNA-126+miRNA-155+miRNA-141+miRNA-21);

[0165] Sample f: miRNA-21.

[0166] 6. A spike recovery test was performed in real samples, and electrochemical measurements were performed using differential pulse voltammetry (DPV) in 0.01 M phosphate buffer (pH = 7.4). The results are shown in Table 3.

[0167] Table 3: Spike recovery test data

[0168] Sample concentration Standard value (△I / μA) Test value (△I / μA) Recovery rate (%) 1fM 1.14 1.13 98.7 10fM 1.25 1.27 101.9 100fM 1.50 1.44 96.3

[0169] It can be seen from the results in Table 3 that when the concentration of the spiked sample is 1 fM, the recovery rate of the present invention can reach 98.7%.

[0170] Comparative Example 1

[0171] 5 μL of 10 mg / mL MoSe2, MXene and MoSe2 / MXenes NPs solution prepared in the present invention were dropped onto the working electrode surface, respectively. 3- / 4- The impedance of the electrode surface was measured by electrochemical impedance spectroscopy (EIS) in a composite solution of Figure 8 .

[0172] Among the electrodes modified with different metal materials, the electrode modified with MoSe2 / MXenes NPs has the lowest AC impedance, which indicates that the bimetallic nanocomposite material used in the present invention has higher metal conductivity and can reduce the interface resistance value of the electrode.

[0173] Comparative Example 2

[0174] 5 μL of 1 mg / mL Au / Pd, SrCoO3 / Co3O4, Pd / Cu TP and the Nd2O3-Ir bimetallic nanozyme prepared by the present invention were dropped onto the working electrode surface, and electrochemical measurements were performed in 0.01 M phosphate buffer (pH = 7.4) using differential pulse voltammetry (DPV). The results are shown in Fig. 9 From the results, it can be seen that the current response value of the Nd2O3-Ir bimetallic nanozyme prepared by the present invention is the highest.

[0175] Comparative Example 3

[0176] 5 μL of 1 mg / mL Ir, Nd2O3-Ir bimetallic nanozyme and Nd2O3-Ir-Fe-NC solution prepared by the present invention were dropped onto the working electrode surface, and electrochemical measurements were performed in 0.01 M phosphate buffer (pH = 7.4) by differential pulse voltammetry (DPV). The results are shown in Fig.10 From the results, it can be seen that the current response value of the Nd2O3-Ir-Fe-NC trimetallic nanozyme prepared by the present invention is the highest.

[0177] Comparative Example 4

[0178] The implementation method is the same as Example 1, except that "the preparation of S4, Nd2O3-Ir bimetallic nanozymes" and "Au-Ag bimetallic nanozymes" are used in Comparative Example 4. The specific experimental method is as follows:

[0179] Quickly pour 0.6 mL of 0.01 M sodium borohydride solution into 0.25 mL of chloroauric acid and 10 mL of 0.01 M mixed solution to prepare Au seed solution;

[0180] 5 mL of 0.01 M chloroauric acid solution, 1 mL of 0.01 M silver nitrate solution, and 95 mL of 0.1 M hexadecyltrimethylammonium bromide solution were added, and after mixing evenly, 0.55 mL of 0.1 M ascorbic acid solution was added to prepare a mixture A;

[0181] 0.12 mL of Au seed solution was added to the above mixture A to react and produce Au nanoparticles. The solution was mixed for 20 seconds and allowed to stand for at least 12 hours before use to form an Au nanoparticle suspension;

[0182] Disperse 50 mL of the Au nanoparticle suspension in 50 mL of a 0.08 M hexadecyltrimethylammonium chloride aqueous solution and keep it for at least 12 hours;

[0183] Add 5 mL of 0.01 M AgNO3 solution, and add 2.5 mL of 0.1 M ascorbic acid solution under stirring;

[0184] The above solution was maintained at a temperature of 65° C. for 3 h to react and generate Au-Ag bimetallic nanozyme. The generated Au-Ag bimetallic nanozyme was centrifuged to obtain Au-Ag bimetallic nanozyme.

[0185] 0.25 mg of the Au-Ag bimetallic nanozyme prepared by the above method was dissolved in 15 mL of water, and 0.25 g of sodium citrate was added and stirred to prepare a carboxyl-protected Au-Ag NPs solution, which was washed and dried to obtain Au-Ag NPs powder.

[0186] The Au-Ag NPs powder prepared above was used in the subsequent steps to prepare the electrochemical biosensor comparison 1.

[0187] Electrochemical biosensor 1 was used to detect blood samples containing miRNA-21 solutions of different concentrations. The results are shown in Table 4.

[0188] Comparative Example 5

[0189] The implementation method is the same as Example 1, except that in the step of "S6, construction of ratiometric sensor platform and tripod DNA walker", hairpin DNA H1 sequence, hairpin DNA H2 sequence and hairpin DNA H3 sequence are not used to construct the tripod DNA walker, but 3 μL of 0.5 μM hairpin DNA H4 sequence and 3 μL of 0.5 μM hairpin DNA H5 sequence are used to construct a bipedal DNA walker. Because the hairpin DNA sequence used does not contain a deoxynuclease sequence, step S6-3 is not performed in this example to prepare electrochemical biosensor comparison 2.

[0190] The electrochemical biosensor was used to detect two pairs of blood samples containing miRNA-21 solutions of different concentrations. The results are shown in Table 4.

[0191] Note: The hairpin DNA H4 sequence and hairpin DNA H5 sequence were designed based on the paper "A programmatic electrochemical nanos ensorbased on robust bipedal DNA walkers fueled by catalytic hairpin assembly" (2021) published by Dongmei Wang, Huan Zhou et al. in Sensors & Actuators: B.

[0192] Comparative Example 6

[0193] The implementation method is the same as Example 1, except that in the step of "S6, construction of ratio sensor platform and tripod DNA walker", hairpin DNA H1 sequence, hairpin DNA H2 sequence and hairpin DNA H3 sequence are not used to construct the tripod DNA walker. Instead, 2 μL of 0.5 μM hairpin DNA H6 sequence, 2 μL of 0.5 μM hairpin DNA H7 sequence and 2 μL of 0.5 μM hairpin DNA H8 sequence are used to construct the tripod DNA walker. Because the hairpin DNA sequence used does not contain a deoxynuclease sequence, step S6-3 is not performed in this example to prepare electrochemical biosensor comparison 3.

[0194] Electrochemical biosensor was used to detect three pairs of blood samples containing miRNA-21 solutions of different concentrations. The results are shown in Table 4.

[0195] Note: The hairpin DNA H6 sequence, hairpin DNA H7 sequence and hairpin DNA H8 sequence were designed according to the literature "Y-shaped walker with abundant recognition domians mediated ultrasensitive electrochemical biosensor for miRNA-21 detection" (2023) published by Liang Zhu, Xiaolong Zhang et al. in Sensors & Actuators: B.

[0196] Comparative Example 7

[0197] The implementation method is the same as that of Example 1, except that in the step "S6, construction of ratiometric sensor platform and tripod DNA walker", step S6-3 is not performed, i.e., Zn is not added. 2+ The solution was cut, and the subsequent steps were the same as in Example 1 to prepare the electrochemical biosensor comparison 4.

[0198] Electrochemical biosensor was used to detect 4 pairs of blood samples with known concentrations of miRNA-21 solution. The results are shown in Table 4.

[0199] Table 4: Comparison of the detection results and theoretical values ​​of the electrochemical biosensor comparative sample

[0200] Sample number to be tested Sensor comparison 1 detection value Sensor comparison 2 detection value Sensor comparison 3 detection values Sensor comparison 4 detection values 1 <![CDATA[4.98×10 -12 ]]> <![CDATA[4.90×10 -12 ]]> <![CDATA[4.98×10 -12 ]]> <![CDATA[5.01×10 -12 ]]> 2 <![CDATA[1.85×10 -15 ]]> <![CDATA[1.89×10 -15 ]]> <![CDATA[2.00×10 -15 ]]> <![CDATA[1.95×10 -15 ]]> 3 <![CDATA[2.56×10 -15 ]]> <![CDATA[2.83×10 -15 ]]> <![CDATA[2.88×10 -15 ]]> <![CDATA[2.68×10 -15 ]]> 4 Not detected <![CDATA[0.81×10 -15 ]]> <![CDATA[0.92×10 -15 ]]> <![CDATA[0.94×10 -15 ]]> 5 Not detected Not detected Not detected <![CDATA[1.85×10 -18 ]]>

[0201] From the results in Table 4, it can be seen that the detection accuracy and sensitivity of sensors 1, 2, 3 and 4 are not as good as the sensor prepared by the present invention. -15 M (i.e., femtomolar) level, but compared with the present invention, not only is the detection limit still relatively high, but the accuracy is also insufficient, and both cannot be used to detect miRNA-21 content within 10 -18 M (i.e. attomole level) samples.

[0202] At the same time, the electrochemical biosensor comparison 4 and the sensor samples prepared in Example 1 were subjected to a repeatability test, requiring the same analyst to test the miRNA-21 samples of known concentration, and each concentration gradient was tested three times to evaluate the measurement results. The results are shown in Table 5.

[0203] Table 5: Electrochemical biosensor comparison 4 and Example 1 sample repeatability test results

[0204]

[0205] It can be seen from the results in Table 5 that the electrochemical biosensor prepared in the present invention has better sensitivity and reproducibility than sensor comparison 4 in the detection of different concentrations of miRNA-21. This is because the structure of the nucleic acid nanoprobe after cutting is more compact and short, which is more conducive to being captured by the working electrode, which not only improves the sensitivity of the sensor, but also improves the reproducibility.

Claims

1. An electrochemical biosensor, comprising a nucleic acid nanoprobe, a three-electrode system and a sensor platform, wherein the three-electrode system comprises a working electrode, a reference electrode and a counter electrode, characterized in that: The nucleic acid nanoprobe is a trimetallic nanozyme modified by a hairpin DNA S1 sequence, and the sensor platform comprises the nucleic acid nanoprobe and a tripod DNA walker formed by hybridization of a hairpin DNA H1 sequence, a hairpin DNA H2 sequence, and a hairpin DNA H3 sequence; The hairpin DNA S1 sequence is: 5′-AGCTTATCAGACCCACTATrAGGAAGTCTGATCAACATCAGTCTGATAAGCTA-3′; The hairpin DNA H1 sequence is: 5′-GAAGTCTGATCAGCTTATCAGTAGCTTATCAG ACTGATGTTGATCAGACTTCTCCGAGCCGGTCGAAATAGTGGGT-3′; The hairpin DNA H2 sequence is: 5′-TATCAGTGATAAACTGATGTTGATACCACTCA CTTATCACTGATAAGCTGATCAGACTTCTCAGACTTCTCCGAGCCGGTCGAAATAG TGGGT-3′; The hairpin DNA H3 sequence is: 5′-GTGAGTGGTATCAACATCAGTTCAGACTTCTCCGAGCCGGTCGAAATAGTGGGT-3′; The DNA H1 sequence, DNA H2 sequence and DNA H3 sequence all contain deoxyribonuclease fragments.

2. An electrochemical biosensor according to claim 1, characterized in that: The surface modification material of the working electrode is a bimetallic nanocomposite material, which is a C1-MoSe2 / MXenes bimetallic nanocomposite material modified by a DNA C1 sequence, and the DNA C1 sequence is: 5′-ATAGTGGGTCTGATAAGCT-3′; and the working electrode is a glassy carbon electrode.

3. An electrochemical biosensor according to claim 1, characterized in that: The trimetallic nanozyme is a S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme in which a single-atom iron-containing nanozyme is anchored to a Nd2O3-Ir bimetallic nanozyme and modified by a hairpin DNA S1 sequence.

4. A method for preparing an electrochemical biosensor, for preparing the electrochemical biosensor as claimed in any one of claims 1 to 3, characterized in that: The specific steps are: S1. Preparation of MoSe2 / MXenes nanocomposites: S1-1, add 1g Ti3AlC2 powder to 10mL-20mL of LiF and HCl mixed solution and dissolve it, continue stirring and react at 30℃-40℃ for 20h-24h to obtain Ti3C2Tx, centrifuge, wash with ultrapure water, and freeze-dry after ultrasonic treatment to prepare Ti3C2Tx dry powder; S1-2, dissolving 0.04 g of selenium powder in 4 mL to 8 mL of hydrazine hydrate to prepare solution A; S1-3, dissolving 0.02 g of sodium molybdate dihydrate in 20 mL to 30 mL of water to prepare solution B; S1-4, the Ti3C2Tx dry powder, solution A and solution B are transferred into an autoclave and heated to 200°C to 240°C, centrifuged, washed with ultrapure water, subjected to ultrasonic treatment and then freeze-dried to obtain MoSe2 / MXenes nanoparticles; Surface modification and DNA modification of S2, MoSe2 / MXenes nanoparticles: S2-1, adding 0.2 g to 0.3 g of sodium citrate to 10 mL to 15 mL of an aqueous solution containing 0.25 mg of MoSe2 / MXenes nanoparticles, mixing and stirring to prepare a carboxyl-protected MoSe2 / MXenes NPs solution; S2-2, adding 1 mg of 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.2 mg to 0.3 mg of N-hydroxysuccinimide to 1 mL of the MoSe2 / MXenes NPs solution, washing with phosphate buffer and incubating for 8 h to 12 h, adding a DNA C1 sequence solution and reacting, washing and sealing with a bovine serum albumin solution, and preparing a C1-MoSe2 / MXenes bimetallic nanocomposite solution; S3. Preparation of single-atom iron-containing nanozymes: S3-1, calcining potassium citrate at 800°C to 880°C under N2 protection environment, washing, adjusting the pH to neutral, and drying to obtain porous carbon powder; S3-2, adding ferrous chloride and 1,10-phenanthroline monohydrate solution to ethanol, adding porous carbon powder after ultrasonic treatment, stirring and evaporating ethanol, mixing with melamine, calcining at 700° C. to 800° C. under N2 protection environment, and then cooling; S3-3, treated with H2SO4 solution, washed and dried to obtain single-atom iron-containing nanozymes; Preparation of S4, Nd2O3-Ir bimetallic nanozymes: S4-1, dissolving 1.0 g of iridium chloride in ethylene glycol and stirring, adjusting the pH, heating at 160°C to 170°C for 2h to 4h in flowing argon, cooling, centrifuging, washing, and drying to obtain Ir NPs powder; S4-2, adding 20 mL of toluene to 6.0 mL to 6.5 mL of ethanol solution containing potassium oleate, and then mixing with 12 mL to 14 mL of Nd(NO3)3 aqueous solution, heating to 70°C to 80°C, stirring, separating the toluene supernatant, and preparing a complex solution; S4-3, adding 5 mL of oleylamine and the Ir NPs powder prepared in step S4-1 to the complex solution, stirring, transferring to 20 mL of an aqueous solution of tert-butylamine, heating in an autoclave at 180° C. to 190° C. for 20 h to 28 h, washing, centrifuging, and drying; S4-4, then uniformly heating to 700°C to 750°C and maintaining for 4h to 6h to obtain Nd2O3-Ir nanoparticles; S4-5, dissolving 0.25 mg of Nd2O3-Ir nanoparticles in 10 mL to 15 mL of water, adding 0.2 g to 0.3 g of sodium citrate, stirring and mixing to prepare a carboxyl-protected Nd2O3-Ir NPs solution, and washing and drying to obtain a bimetallic nanozyme Nd2O3-IrNPs powder; S5. Anchoring the single-atom iron-containing nanozyme on the bimetallic nanozyme and functionalizing it: S5-1, single-atom iron-containing nanozymes and Nd2O3-Ir NPs powders were mixed in a mass ratio of 10 to 12:1, added to a dimethylformamide solution, and a colloidal suspension with a concentration of 1.0 g / L to 1.2 g / L was prepared. After ultrasonic treatment, a Nd2O3-Ir-Fe-NC solution was prepared; S5-2, 1 mg of 1-ethyl-(3-dimethylaminopropyl) carbodiimide hydrochloride and 0.2 mg to 0.3 mg of N-hydroxysuccinimide were added to 1 mL of Nd2O3-Ir-Fe-NC solution, washed with phosphate buffer and incubated for 8 h to 12 h, hairpin DNA S1 sequence solution was added and reacted, washed and blocked with bovine serum albumin solution, and S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme solution was prepared by magnetic separation; S6. Construction of sensor platform and three-legged DNA walker: S6-1, treating the bare working electrode with alumina powder and performing ultrasonic pretreatment, dripping the C1-MoSe2 / MXenes bimetallic nanocomposite solution prepared in step S2 onto the pretreated working electrode, drying at room temperature, dripping bovine serum albumin solution, and rinsing with phosphate buffer; S6-2, respectively, add the S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme solution and the miRNA-21 sequence solution to be tested into a centrifuge tube, the miRNA-21 sequence hybridizes with the hairpin DNA S1 sequence on the S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme to form a double-stranded structure, add the hairpin DNA H1 sequence solution, the hairpin DNA H1 sequence replaces the miRNA-21 sequence and hybridizes with the DNA S1 sequence, so that the replaced miRNA-21 sequence can enter the cycle amplification; add the hairpin DNA H2 sequence solution and the hairpin DNA H3 sequence solution, so that the hairpin DNA H1 sequence, the hairpin DNA H2 sequence, and the hairpin DNA H3 sequence form a three-legged DNA walker, and incubate in a centrifuge tube; the added hairpin DNA H1 sequence, the hairpin DNA H2 sequence, and the DNA H3 sequence all contain deoxyribonuclease fragments, which can be used as deoxyribonuclease to cut the S1 chain; S6-3. Add Zn to the centrifuge tube 2+ In the solution, the deoxynuclease fragments on the hairpin DNA H1 sequence, the hairpin DNA H2 sequence, and the DNA H3 sequence cut the DNA S1 sequence on the trimetallic nanozyme, and the cut trimetallic nanozyme is captured by DNA C1 on the electrode surface, generating a current response; S6-4. Immerse the electrode processed in step S6-1 into a centrifuge tube to capture the nanoprobe after the signal amplification reaction to construct a sensor platform.

5. The method for preparing an electrochemical biosensor according to claim 4, characterized in that: In the step S2-1, the mass ratio of sodium citrate and MoSe2 / MXenes nanoparticles is 800-1200:1; in the step S4-2, the concentration of Nd(NO3)3 in the Nd(NO3)3 aqueous solution is 0.028M-0.030M, and the concentration of potassium oleate in the potassium oleate ethanol solution is 0.15M-0.18M; in the step S4-3, the concentration of the aqueous solution of tert-butylamine is 0.07M-0.08M.

6. The method for preparing an electrochemical biosensor according to claim 4, characterized in that: The ultrasonic treatment conditions of the steps S1-1 and S1-4 are 28 kHz to 45 kHz, each treatment lasts 4 h to 8 h, and the treatment is performed 3 to 5 times.

7. The method for preparing an electrochemical biosensor according to claim 4, characterized in that: In the step S6-2, Zn is added 2+ Zn in solution 2+ The concentration is 10μM~20μM.

8. The method for preparing an electrochemical biosensor according to claim 4, characterized in that: The S1-Nd2O3-Ir-Fe-NC trimetallic nanozyme solution, the mi-RNA 21 sequence to be tested, the hairpin DNA H1 sequence, the hairpin DNA H2 sequence, the hairpin DNA H3 sequence, and the Zn 2+ The volume ratio of the solution is 5:5:2:2:2:5; the concentrations of the hairpin DNA C1 sequence, the hairpin DNA S1 sequence, the hairpin DNA H1 sequence, the hairpin DNA H2 sequence and the hairpin DNA H3 sequence are each 0.5 μM to 0.6 μM.

9. A method for preparing an electrochemical biosensor according to claims 4 to 8, characterized in that: The prepared electrochemical biosensor was applied to the detection of miRNA-21 sequence, and Zn 2+ The auxiliary deoxynuclease cuts the DNA S1 sequence on the incubated trimetallic nanozyme.

Images