Molecular marker related to corn low-temperature-resistant gene WRKY and application of molecular marker

Abstract

The invention relates to the technical field of plant breeding, in particular to a molecular marker related to a corn low-temperature-resistant gene WRKY and application of the molecular marker. The molecular marker is DNdCAPS603 and is located at the 603rd site of a CDS region of a ZmWRKY48 gene of a fifth chromosome of corn, and a mutant base is C / T. A mutation site is detected by using a primer pair as shown in SEQ ID NO.2 and SEQ ID NO.3 for amplification, the site of a low-temperature sensitive material is C and cannot be cut by HindIII restriction endonuclease, and the site of a low-temperature resistant material is T and can be cut into two fragments of 19 bp and 208 bp by HindIII restriction endonuclease. The molecular marker provided by the invention can be used for cultivating low-temperature-resistant transgenic plants, provides a new technical means and method basis for screening and creating new low-temperature-resistant corn materials, and has important value in the field of plant breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of plant breeding, and in particular to a molecular marker related to a corn cold-resistance gene WRKY and an application thereof. Background Art

[0002] Corn is an important crop for food, feed and ethanol, and is of great significance to economic development. Abiotic stress is the main limiting factor affecting corn yield, which seriously affects the growth and development of corn, resulting in a large-scale reduction in corn production. Low temperature will reduce the seed vigor of corn seeds and affect seed germination, which will have a serious impact on corn yield and quality. Therefore, it is of great significance to explore the genes related to low temperature tolerance in corn, and then screen and create new low temperature tolerant corn varieties to improve the low temperature tolerance of corn.

[0003] When subjected to low temperature stress, plants undergo a series of physiological changes, such as regulating the content of osmotic regulating substances and endogenous hormones in response to low temperature; at the same time, low temperature can induce the expression of plant cold tolerance-related genes and activate their regulatory networks to respond to low temperature stress, minimizing the damage caused by low temperature to plants. WRKY is one of the important transcription factors involved in the regulation of plant response to low temperature stress. It activates or inhibits the expression of downstream genes in response to low temperature stress by binding to downstream specific cis-acting elements. At present, it has been reported that overexpression of WRKY genes in plants such as rice can improve the plant's ability to tolerate low temperatures, such as in rice. OsWRKY76 Gene, Apple MBWRKY40 There are few reports on WRKY genes in maize cold tolerance. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a molecular marker related to a corn cold-resistance gene WRKY and an application thereof.

[0005] The present invention explores the relationship between corn low temperature resistance and ZmWRKY48 Gene, analyze the sequence variation of its coding region in different maize inbred lines, and then conduct association analysis with the low temperature tolerance of the inbred lines, and then explore the associated sites and develop molecular markers, which will provide a way and reference for the future selection of new low temperature tolerant maize varieties, provide a basis for the study of the molecular regulatory mechanism of plant resistance to low temperature stress, and have practical significance for further improving maize yield and quality. In the process of research, a SNP molecular marker related to the low temperature tolerance of maize was obtained, which can be used for molecular marker-assisted breeding of low temperature tolerant maize lines.

[0006] In the first aspect, the present invention provides a molecular marker, the molecular marker is DNdCAPS603, located on chromosome 5 of maize ZmWRKY48 At position 603 in the CDS region of the gene, the mutated base is C / T.

[0007] Furthermore, the ZmWRKY48 The gene name in the Maize GDB database is Zm00001d015515 .

[0008] Furthermore, the molecular marker includes a nucleic acid having a nucleotide sequence as shown in SEQ ID NO.1, wherein there is a mutation at position 24, and the mutant base is C / T.

[0009] The nucleotide sequence shown in SEQ ID NO.1 is as follows: TGGCGCAAGTACGGGCAGAAGCTTACCAAGGACAACCCCTGCCCGCGGGCCTACTTCCGCTGCTCCTTCGCCCCGGCCTGCCCAGTCAAGAAGAAGGTGCAGCGCAGCGCCGACGACCCCACCATCCTGGTCGCCACGTACGAGGGCGACCACAACCACGGCCAGCCCCCGCCACAGGCGCAGGCGCCGCACGACGGCTCCAGCCCTGGCGCCAGCAAGAAGCCGCC.

[0010] Furthermore, for the molecular marker, plants with a T site have stronger low temperature resistance than plants with a C site.

[0011] In a second aspect, the present invention provides a primer pair, comprising the nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO.3.

[0012] SEQ ID NO.2: 5'-TGGCGCAAGTACGGGCAGAAGCT-3',

[0013] SEQ ID NO. 3: 5'-GGCGGCTTCTTGCTGGCGCC-3'.

[0014] In a third aspect, the present invention provides a kit comprising the molecular marker or the primer pair.

[0015] In a fourth aspect, the present invention provides the use of the molecular marker, the primer pair, or the kit in identifying the low temperature tolerance of plants.

[0016] The present invention further provides the use of the molecular marker, the primer pair, or the kit in any of the following: (1) Cultivate low-temperature-tolerant transgenic plants; (2) Molecular marker-assisted breeding of plants; (3) Improved plant germplasm resources.

[0017] Furthermore, the plant is corn.

[0018] In a fifth aspect, the present invention provides a method for identifying low temperature tolerance of plants, comprising: The molecular marker is detected on the plant sample to be tested, and the low temperature resistance of the plant sample to be tested is determined according to the detection result.

[0019] Further, including: The genomic DNA of the plant sample to be tested is extracted, and PCR amplification is performed using the primer pair or the kit, and the low temperature resistance of the plant sample to be tested is determined according to the amplification result.

[0020] Further, judging the low temperature tolerance of the plant sample to be tested according to the amplification result includes: digesting the amplified product with HindIII restriction endonuclease, the low temperature sensitive material has a C site, which cannot be digested by HindIII restriction endonuclease, while the low temperature tolerant material has a T site, which can be digested by HindIII restriction endonuclease into two fragments of 19 bp and 208 bp. That is, the plant whose amplified product is digested to obtain two fragments of 19 bp and 208 bp has a higher low temperature tolerance.

[0021] Furthermore, the ZmWRKY48 The full length of the gene is shown in SEQ ID NO.4:

[0022] The present invention has the following beneficial effects: The present invention is based on corn low temperature resistance related genes ZmWRKY48 By analyzing the different maize inbred lines ZmWRKY48 The sequence variation of the CDS region of the gene was analyzed and associated with the cold-resistant phenotypic indicators of the inbred line. The associated sites were mined, the restriction sites of the sites were analyzed and restriction endonucleases were selected to develop a gene related to the cold-resistant gene of the plant. ZmWRKY48 The SNP molecular markers related to the low temperature tolerance of plants can be detected by detecting the mutation type of the SNP molecular markers in plants. The SNP molecular markers provided by the present invention can be applied to improve the germplasm resources of corn, cultivate low temperature resistant corn varieties, and improve corn yield and quality, which has important value in the field of corn planting. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction will be given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 The embodiment 1 of the present invention provides ZmWRKY48 SNPs, InDels and haplotypes in the intronic regions of genes.

[0025] Figure 2 It is the genotype detection result of the molecular marker DNdCAPS603 provided in Example 2 of the present invention; wherein a: M is a DNA Marker, and 1-6 are the PCR products of Ji853, Mo17, Dan99L, Zhong106, B73, and HD568, respectively; b: M is a DNA Marker, and 1-6 are the enzyme cutting products of Ji853, Mo17, Dan99L, Zhong106, B73, and HD568, respectively.

[0026] Figure 3 It is the verification result of the molecular marker DNdCAPS603 provided in Example 3 of the present invention in some inbred lines; wherein M is DNA Marker, and 1-24 are the enzyme digestion products of Dan599, 7884, Zao49, Si387, Han23, Dan988, 77, Guan17, H3, D185, PI36, Shen137, Shen5003, Han21, SH15, Qi319, Mo17, Ji477, Zi495, Zhong17, 7922, 501, H21, and Yu12, respectively. DETAILED DESCRIPTION

[0027] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The experimental methods involved in the following examples, unless otherwise mentioned, are all conventional methods in the art, for example, reference may be made to experimental manuals in the art, or the conditions recommended in the manufacturer's instructions.

[0029] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0030] Example 1 Corn ZmWRKY48 Sequence variation analysis of genes

[0031] 1. ZmWRKY48 The gene name in the Maize GDB database is Zm00001d015515 The genome is located on chromosome 5, with a total length of 1700 bp, and its sequence is shown in SEQ ID NO. 4. Its CDS sequence is 1044 bp in total, encoding 347 amino acids. ZmWRKY48 The gene consists of 2 exons and 1 intron.

[0032] The primers designed by the present invention (Table 1) were used to amplify the DNA sequences of 40 maize inbred lines (Table 2) with different low temperature tolerance. ZmWRKY48 The CDS region of the gene was extracted and the DNA SPv 6.0 software was used to analyze the 40 maize inbred lines. ZmWRKY48 The CDS region of the gene was subjected to sequence variation analysis, and the results showed that ZmWRKY48 There are mutations in both the first and second exon regions of the gene, and a large number of mutations in the second exon region, with the second exon mutation rate being significantly higher than other regions.

[0033] Table 1 ZmWRKY48 Gene sequence primers

[0034] Table 2 Evaluation of low temperature tolerance of 40 maize inbred lines during germination

[0035] Note: Class I is highly resistant to low temperatures, Class II is resistant to low temperatures, Class III is moderately resistant to low temperatures, Class IV is sensitive to low temperatures, and Class V is highly sensitive to low temperatures.

[0036] 2. ZmWRKY48 Genotype analysis

[0037] The invention is used in 40 corn inbred lines with different low temperature resistance levels. ZmWRKY48 A total of 12 SNP sites and 1 InDel site were detected in the CDS region of the gene. The SNP sites were located at positions 66, 109, 403, 405, 408, 409, 410, 603, 701, 706, 870, and 918, and the InDel site was located at positions 391-402 (Table 3). The polymorphic sites were typed according to the type of nucleotide variation and the number of occurrences. A total of 11 haplotypes were detected using DNA SPv6.0 software, with a haplotype polymorphism of 0.908. The main haplotypes were HAP1, HAP2, HAP4, HAP5, and HAP6, accounting for 85% of the tested materials, and the remaining haplotypes were rare variations. Among them, HAP2 contains 10 inbred lines, including the high low temperature resistant material Zhong106, the low temperature resistant materials Dan717, F12, 52106, HD568, Si387, H21, and the medium low temperature resistant materials B73, Shen151, and P25. HAP5 is composed of two low temperature resistant materials Dong237 and NP1200, and HAP6 is composed of two low temperature resistant materials H270 and 444 and one medium low temperature resistant material LX9801. Based on the above results, it is preliminarily determined that HAP2 contains 10 materials with medium low temperature resistance or above as excellent monomer types (Table 4). In addition, ZmWRKY48 Two SNP sites and four InDel sites were found in the introns of the gene. The SNPs were located at positions 74 and 82 of the introns, and the InDel sites were located at positions 7-11, 58, 67-71, and 132-134 of the introns. Figure 1 ).

[0038] Table 3 ZmWRKY48 Gene CDS region SNP, InDel and haplotype

[0039] Table 4 ZmWRKY48 Inbred lines corresponding to haplotypes

[0040] 2. ZmWRKY48 Analysis of changes in gene amino acid levels

[0041] The present invention found in 40 maize inbred lines ZmWRKY48There are 4 synonymous mutation SNP sites and 6 non-synonymous mutation SNP sites in the CDS region of the gene. The material with mutation at SNP409 also has base mutation at SNP410, and SNP409 and SNP410 encode the same amino acid. Although the 4 synonymous mutation SNP sites do not affect the amino acid sequence, they may affect the splicing efficiency and accuracy of mRNA; the 6 non-synonymous mutation SNP sites may change the structure and physiological function of the protein and thus affect the low temperature tolerance of corn, namely, the 135th amino acid changes from lysine (Pro, P) to alanine (Ala, A), the 137th amino acid changes from glutamine (Gln, Q) to alanine (Ala, A), the 234th amino acid changes from threonine (Thr, T) to aspartic acid (Asn, N), the 236th amino acid changes from leucine (Leu, L) to valine (Val, V), and the 290th amino acid changes from histidine (His, H) to glutamine (Gln, Q) (as shown in Table 5).

[0042] Table 5 ZmWRKY48 The amino acid changes corresponding to the SNPs of non-synonymous gene mutations

[0043] 3. ZmWRKY48 Gene nucleotide diversity analysis

[0044] The invention combines the low temperature resistance phenotype identification result of corn inbred lines in the germination period, and analyzes the SNP nucleotide diversity and haplotype diversity by DNAspv6.0 software. The results show that the nucleotide diversity π of 5 high low temperature resistance materials is 0.00038, and the haplotype diversity is 0.4000; the nucleotide diversity π of 14 low temperature resistance materials is 0.00185, and the haplotype diversity is 0.7473; the nucleotide diversity π of 12 medium low temperature resistance materials is 0.00304, and the haplotype diversity is 0.8636; the nucleotide diversity π of 5 low temperature sensitive materials is 0.00364, and the haplotype diversity is 0.9000; the nucleotide diversity π of 4 low temperature high sensitive materials is 0.00383, and the haplotype diversity is 0.8333. TaJima's Test is performed on 40 corn inbred lines with different low temperature resistance grades. The test results showed that Tajima's D value was -0.95922, which did not reach a significant level, indicating that the gene was neutrally evolved in the maize inbred line population (as shown in Table 6).

[0045] Table 6 ZmWRKY48 Nucleotide diversity analysis of genes

[0046] Example 2 ZmWRKY48Gene dCAPS functional marker development

[0047] 1. ZmWRKY48 Association analysis between gene sequence variation and low temperature tolerance in maize

[0048] The present invention combines the phenotypic identification results of corn inbred line materials subjected to low temperature stress in the laboratory in the early stage, and uses TASSEL 5.0 software to analyze the phenotypic characteristics of 40 corn inbred lines. ZmWRKY48 The SNP sites and InDel sites in the CDS region of the gene were associated with the relative germination rate (RGR), relative shoot length (RGL), relative root length (RRL), relative vitality index (RVI), relative root surface area (RRSA) and relative root volume (RRV) of the germination period. The results showed that at the 0.05 level, SNP405, SNP408, SNP409, SNP410, and SNP870 were significantly correlated with the relative germination rate (RGR) of the germination period ( P <0.05), SNP603 was significantly correlated with the relative vitality index (RVI) during germination ( P <0.01), the phenotypic contribution rate of this site was the largest, with a phenotypic contribution rate of 22.49%; the phenotypic contributions of SNP405, SNP408, SNP409, and SNP410 were all 12.09%, and the phenotypic contribution of SNP870 was 11.41% (Table 7).

[0049] Table 7 Correlation analysis results between ZmWRKY48 gene sequence variation and maize low temperature tolerance

[0050] 2. ZmWRKY48 Design of gene dCAPS functional markers

[0051] The present invention is based on ZmWRKY48 The results of the association analysis of the gene CDS region were selected to be extremely significantly correlated with the relative vitality index of maize germination period ( P <0.01) and the SNP603 (C / T) locus with the largest phenotypic contribution rate was used for dCAPS marker development. The online website dCAPS Finder was used to analyze the optimal enzyme cutting site and select restriction endonucleases to develop functional markers. The marker converted by SNP603 (C / T) was named DNdCAPS603. The full length of PCR amplification was 227 bp. The 24th base was the mutation site. The site was C in the low-temperature sensitive material and could not be cut by the HindIII restriction endonuclease, while the site was T in the low-temperature resistant material and could be cut by the HindIII restriction endonuclease into two fragments of 19 bp and 208 bp ( Figure 2 ).

[0052] Example 3 Verification of DNdCAPS603 functional markers

[0053] The present invention verifies the DNdCAPS603 marker using 102 maize inbred line materials with different low-temperature tolerance phenotypes evaluated in the laboratory in the early stage (Table 8). The genomic total DNA of different maize inbred lines was used as a template, and PCR amplification was performed using labeled primers. The amplified products were recovered and digested with HindIII restriction endonuclease.

[0054] The results are as follows Figure 3 As shown: After enzyme digestion verification, the PCR products of the low-temperature resistant genotype and low-temperature sensitive genotype materials obtained two bands of 208, 19 bp and 227 bp respectively ( Figure 3 ). 60 of the 102 inbred lines had a low temperature resistant phenotype, of which 36 inbred lines such as 888-9, Dan 599 and Zao 49 had enzyme digestion products of 208 and 19 bp, showing a low temperature resistant genotype, and the genotype-phenotype consistency rate was 60.00%. 42 of the 102 inbred lines had a low temperature sensitive phenotype, of which 30 inbred lines such as Shen 3336, Zhong 17 and Chang 7-2 had enzyme digestion products of 227 bp, showing a low temperature sensitive genotype, and the genotype-phenotype consistency rate was 71.43% (Table 9). In summary, DNdCAPS603 can effectively identify the SNP603 (C / T) site and can be used to screen low temperature resistant inbred lines.

[0055] Table 8 Evaluation of low temperature tolerance of 102 maize inbred lines - Part I

[0056] Table 9 Evaluation of low temperature tolerance of 102 maize inbred lines - Part II

[0057] Table 10 Analysis of selection efficiency of marker DNdCAPS603

[0058] In summary, the present invention is based on corn ZmWRKY48 The molecular marker DNdCAPS603 developed by the gene can be used to identify the low temperature tolerance of corn, and then to screen or cultivate low temperature tolerant corn varieties.

[0059] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker, characterized in that The molecular marker is DNdCAPS603, located on chromosome 5 of maize ZmWRKY48 At position 603 in the CDS region of the gene, the mutated base is C / T.

2. A molecular marker, characterized in that The molecular marker includes a nucleic acid having a nucleotide sequence as shown in SEQ ID NO.1, wherein a mutation occurs at position 24, and the mutant base is C / T.

3. A primer pair, characterized in that: The primer pair includes the nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO.

3.

4. A kit, characterized in that: It comprises the molecular marker according to claim 1 or 2, or the primer pair according to claim 3.

5. Use of the molecular marker according to claim 1 or 2, or the primer pair according to claim 3, or the kit according to claim 4 in identifying the low temperature tolerance of plants.

6. Use of the molecular marker according to claim 1 or 2, or the primer pair according to claim 3, or the kit according to claim 4 in any of the following: (1) Cultivate low-temperature-tolerant transgenic plants; (2) Molecular marker-assisted breeding of plants; (3) Improved plant germplasm resources.

7. The use according to claim 6, characterized in that: The plant is corn.

8. A method for identifying low temperature tolerance of plants, characterized in that: include: The molecular marker according to claim 1 or 2 is detected on the plant sample to be tested, and the low temperature resistance of the plant sample to be tested is determined according to the detection result.

9. The method according to claim 8, characterized in that include: Extract the genomic DNA of the plant sample to be tested, perform PCR amplification using the primer pair described in claim 3 or the kit described in claim 4, and judge the low temperature resistance of the plant sample to be tested according to the amplification result.

10. The method according to claim 8 or 9, characterized in that: The method of judging the low temperature resistance of the plant sample to be tested according to the amplification result includes: performing HindIII restriction endonuclease digestion on the amplified product, the site of the low temperature sensitive material is C, which cannot be digested by HindIII restriction endonuclease, while the site of the low temperature resistant material is T, which can be digested by HindIII restriction endonuclease into two fragments of 19 bp and 208 bp.

Images