DNA tetrahedron and application thereof

Abstract

The invention relates to the technical field of biological detection, in particular to a DNA tetrahedral fluorescent probe and application thereof. In the microRNA targeting probe based on DNA plasticity prepared by the invention, different types of miRNAs cause obvious fluorescence difference of DNA tetrahedrons, that is, the DNA tetrahedral structure (TDN) as the probe can be used for detecting targeting nucleotides. The advantages of natural biocompatibility, structural stability, programmability, easiness in internalization, editability and the like of a DNA tetrahedral nanostructure are utilized, extracellular vesicles serve as a delivery platform, an EV-TDN compound can be synthesized, the safety is improved, the target organ / whole body signal ratio effect is improved, the behavior of EV in a mouse is accurately and quantitatively tracked, and the application prospect is wide. The regeneration capacity and the treatment effect are not influenced. The DNA tetrahedral fluorescent probe TDN designed by the invention can be used for detecting targeted nucleotides; the fate and treatment effect of the EV in a lung organ and even a life system can be represented safely, accurately, noninvasively, in real time and quantitatively, and the method is applied to biosensing and disease diagnosis research.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and in particular relates to a DNA tetrahedron and application thereof. Background Art

[0002] Since the first four-arm nucleic acid junction was designed by SEEMAN in 1982 (SEEMAN NC. Nucleic acid junctions and lattices [J]. J Theor Biol, 1982, 99 (2): 237-247.), the development of DNA nanostructures has gradually developed, and related nanomaterials have made great progress and been widely used in the field of biomedicine. In recent years, the third generation of nanostructures has achieved a breakthrough from two-dimensional (2D) to three-dimensional (3D) structures. As a representative of 3D DNA nanostructures, tetrahedral framework nucleic acid (tFNA) was developed by TURBERFIELD and his collaborators, which is composed of an equal mixture of four single-stranded DNAs of equal length. The general tetrahedral DNA used for detection is a three-dimensional DNA nanostructure composed of four ssDNAs (GOODMAN RP, SCHAAP IA, TARDIN CF, et al. Rapid chiral assembly of rigid DNA building blocks for molecular nanofabrication [J]. Science, 2005, 310 (5754): 1661-1665.), where the four ssDNAs form a double-stranded DNA structure through base complementary pairing, forming the six edges of the tetrahedral DNA. Among the four ssDNAs, three ssDNAs are fixed on the sensor surface to form the three vertices of the tetrahedral DNA, and the other longer ssDNA, in addition to the paired parts with the other three ssDNAs, also extends a section of ssDNA away from the sensor surface to form the fourth vertex of the tetrahedron, which is used to identify its target molecule.

[0003] DNA tetrahedral nanostructures have the advantages of natural biocompatibility, structural stability, programmability, easy internalization and editability, and have broad application prospects in drug delivery and biomedical treatment (Hu Q, Li H, Wang L, et al. DNA nanotechnology-enabled drug delivery systems. Chemical Reviews, 2019, 119 (10): 6459-6506.). It can be used as a biological carrier to effectively deliver therapeutic ingredients into cells, while overcoming the instability and biological barriers of drugs, and making them have better dispersibility and stability, thereby improving the efficacy of free drugs and thus improving their therapeutic effects (ZHANG XL, LIU NX, ZHOU M, et al. The application of tetrahedral framework nucleic acids as a drug carrier in biomedicine fields [J]. Curr Stem Cell Res Ther, 2021, 16 (1): 48-56.). The typical spatial structure of tFNA is permeable to cell walls or cell membranes, which can effectively enhance drug efficacy (Ye Dekai, Zuo Xiaolei, Fan Chunhai. Sensing interface regulation and biological detection application based on DNA nanostructures [J]. Progress in Chemistry, 2017, 29 (1): 36-46.). At present, research in this area mainly involves: 1) biological carriers and tumor delivery, such as constructing new self-assembled complexes to improve the efficacy of free drugs, carrying small molecule RNA to slow down cancer progression, and self-assembled complexes for precise targeted therapy. 2) Regulating inflammation and immune response, such as reducing inflammatory factors, treating inflammatory diseases, preventing diabetes, and acting as an immunomodulator. 3) Promoting tissue regeneration, such as promoting stem cell proliferation and differentiation, promoting peripheral nerve regeneration, and promoting wound repair through angiogenesis.

[0004] DNA nanotechnology is a new type of nanotechnology developed based on the high-precision base complementary pairing principle of DNA and the high designability of the sequence. Its high programmability is unmatched by any other material. Probes based on DNA nanotechnology have also attracted extensive research by researchers. The design of DNA probes is the key and directly determines the luminescence performance. Generally, they require both high photon density and good specificity. Traditional single-stranded DNA probes are easily decomposed by intracellular nucleases due to their loose and soft structure, which is not conducive to imaging. And due to the random excitation principle of super-resolution, they are not suitable for super-resolution microscopes such as STROM. Nanoprobes based on DNA tetrahedral structure have unique advantages: (1) They have good biocompatibility and can be actively taken up by cells in an endocytic manner and stably exist for more than 48 hours. (2) They have good programmable properties and can change the density of fluorescent groups by changing their size. (3) They can be flexibly designed for different biological molecules (such as DNA, microRNA, etc.), which is expected to achieve super-resolution imaging at the nucleic acid level.

[0005] The dynamic imaging study of exosomes in vivo is crucial. Existing exosome in vivo imaging modalities include optical imaging, nuclear medicine imaging, magnetic resonance imaging, photoacoustic imaging, and X-ray CT imaging. Among them, the methods for optical imaging of exosomes mainly include fluorescence imaging (Fluorescence imaging, FLI) and bioluminescence imaging (BLI). The in vivo penetration depth of light in optical imaging is limited. As the imaging depth increases, the signal attenuates and the resolution decreases, which has certain limitations. In vivo imaging of exosomes can dynamically monitor the biological behavior, uptake mechanism, dynamic distribution, and metabolism of exosomes in vivo in real time, provide key in vivo imaging information, and can be used for in-depth research on processes such as tumor metastasis, stem cell therapy, and drug delivery at different levels (Jiang XC, Zhang T, Gao JQ. The in vivo fate and targeting engineering of crossover vesicle-based gene delivery system [J]. Adv Drug Deliv Rev. 2022, 187: 114324.), which is of great clinical significance.

[0006] Noninvasive in vivo tracing of extracellular vesicles (EVs) is an important tool for developing and optimizing their diagnostic and therapeutic effects. Molecular imaging technology can provide direct information for the study of the biological behavior of exogenous EVs in vivo (KIM DH, KOTHANDAN VK, KIM HW, et al. Noninvasive assessment of exosome pharmacokinetics in vivo: a review [J]. Pharmaceutics, 2019, 11 (12): 649.). However, tracking EVs in vivo is a challenge (BETZER O, BARNOY E, SADAN T, et al. Advances in imaging strategies for in vivo tracking of exosomes [J]. Wiley Interdiscip Rev Nanomed Nanobiotechnol, 2020, 12 (2): e1594.). In addition to reliable technical operations, it is also necessary to ensure the membrane integrity and biological activity of EVs after labeling with exogenous probes (KOUREMBANAS S. Exosomes: vehicles of intercellular signaling, biomarkers, and vectors of cell therapy [J]. Annu Rev Physiol, 2015, 77: 13-27.). In the evolving field of nanotechnology, molecular imaging helps guide the development of EVs in medical diagnosis and treatment. In vivo tracking of EVs can help people better understand physiological and pathological processes, promote the clinical development of EV-based drug delivery systems, and is crucial for the development of reliable therapeutic and diagnostic tools. By encapsulating DNA tetrahedrons targeting specific microRNAs into extracellular vesicles derived from mesenchymal stem cells, the dual purposes of imaging and treatment can be achieved based on changes in fluorescence intensity.

[0007] DNA polyhedral nanostructures can be used as a universal platform to construct various fluorescent probes by using chemical labeling, structural modification and clever sequence design. Therefore, it is necessary to develop imaging probes with good biosafety, good water solubility and high sensitivity. Summary of the invention

[0008] The present invention has discovered a DNA tetrahedron TDN, which has programmability, high stability and high biocompatibility; it can bind to a specific nucleotide sequence, for example, it can bind to an extracellular vesicle (EV) to form an EV-TDN complex, and has the function of real-time visualization and monitoring of extracellular vesicles (EV). Based on this, the present invention is completed.

[0009] In the first aspect, the present invention provides a DNA tetrahedron TDN, wherein the tetrahedron is composed of 6 edges composed of DNA chains, wherein at least one edge is a single-stranded DNA and the rest are double-stranded DNA. When the single-stranded DNA in the tetrahedron is complementary to a target nucleotide, the target nucleotide can be captured.

[0010] Furthermore, the double-stranded DNA region in the tetrahedron is formed by local complementary pairing of nucleotides shown in SEQ ID NOs. 1 to 6.

[0011] Furthermore, the nucleotides shown in SEQ ID NO.1 to 6 also include nucleotides having 80%-100% homology thereto, preferably nucleotides having 90%-100% homology thereto, further preferably nucleotides having 95%-100% homology thereto, and even more preferably nucleotides having 99%-100% homology thereto.

[0012] Furthermore, in a specific embodiment of the present invention, the DNA chain carries a fluorescent group when constituting a fluorescent probe, and the fluorescent group is located at any position of the DNA chain; preferably, the fluorescent group is located at a position where the spatial distance between the donor and the acceptor molecules is 7 to 10 nm and no fluorescence quenching will occur between the donor and acceptor fluorophores themselves.

[0013] Furthermore, the carried fluorescent group is a conjugated fluorescent group, such as CFP-YFP; CFP-dsRED; BFP-GFP; GFP-dsRED; YFP-dsRED; Cy3-Cy5; Alexa488-Alexa555; Alexa488-Cy3; FITC-Rhodamine (TRITC); YFP-TRITC; YFP-Cy; preferably Cy3 and Cy5.

[0014] Furthermore, the donor is an electron-accepting fluorophore, such as Cy5.

[0015] Furthermore, the acceptor is an electron-donating fluorophore, such as Cy3.

[0016] Furthermore, when the carried fluorescent groups are Cy3 and Cy5, preferably, the first strand of the DNA tetrahedron is labeled with Cy3, the second strand is labeled with Cy5, and the 3' end of the sixth strand is labeled with Cy5.

[0017] Furthermore, the DNA sequences of strand 1, strand 2 and strand 6 are shown as SEQ ID NOs. 1, 2 and 6.

[0018] Furthermore, the targeting nucleotide refers to a targeting single-stranded nucleotide; preferably a short-chain nucleotide with a sequence length not exceeding 24 bp, such as microRNA and small interfering RNA.

[0019] Furthermore, the microRNA is any microRNA, such as microRNA 23a, microRNA 125b, microRNA 145 and / or microRNA 21; preferably microRNA 21.

[0020] In a second aspect, the present invention provides a method for preparing a DNA tetrahedron, the method comprising the following steps:

[0021] S1. Dissolve the nucleotides of the DNA chain shown in SEQ ID NO. 1 to 6 in a buffer and mix well;

[0022] S2. Perform PCR reaction on the solution in step S1 to obtain DNA tetrahedron.

[0023] Furthermore, the nucleotides shown in SEQ ID NO. 1 to 6 carry fluorescent groups, and the resulting DNA tetrahedron is called a fluorescent probe for capturing the targeted nucleotides. When the DNA chain constitutes a fluorescent probe, it carries a fluorescent group, and the fluorescent group is located at any position of the DNA chain; preferably, the fluorescent group is located at a position where the spatial distance between the donor and the acceptor molecule is 7 to 10 nm and the donor and acceptor fluorophores themselves do not cause fluorescence quenching.

[0024] Furthermore, the nucleotides shown in SEQ ID NO.1 to 6 also include nucleotides having 80%-100% homology thereto, preferably nucleotides having 90%-100% homology thereto, further preferably nucleotides having 95%-100% homology thereto, and even more preferably nucleotides having 99%-100% homology thereto.

[0025] Furthermore, the carried fluorescent group is a conjugated fluorescent group, such as CFP-YFP; CFP-dsRED; BFP-GFP; GFP-dsRED; YFP-dsRED; Cy3-Cy5; Alexa488-Alexa555; Alexa488-Cy3; FITC-Rhodamine (TRITC); YFP-TRITC; YFP-Cy; preferably Cy3 and Cy5.

[0026] Furthermore, the donor is an electron-accepting fluorophore, such as Cy5.

[0027] Furthermore, the acceptor is an electron-donating fluorophore, such as Cy3.

[0028] Furthermore, when the carried fluorescent groups are Cy3 and Cy5, preferably, the first strand of the DNA tetrahedron is labeled with Cy3, the second strand is labeled with Cy5, and the 3' end of the sixth strand is labeled with Cy5.

[0029] Furthermore, the DNA sequences of strand 1, strand 2 and strand 6 are shown as SEQ ID NOs. 1, 2 and 6.

[0030] Furthermore, the targeting nucleotide refers to a targeting single-stranded nucleotide; preferably a short-chain nucleotide with a sequence length not exceeding 24 bp, such as microRNA and small interfering RNA.

[0031] Furthermore, the microRNA is any microRNA, such as microRNA 23a, microRNA 125b, microRNA 145 and / or microRNA 21; preferably microRNA 21.

[0032] In a third aspect, the present invention provides an extracellular vesicle DNA tetrahedron (EV-TDN) complex, wherein the complex is composed of one or more single strands of TDN complementary to one or more nucleotides inside the EV, and the TDN can capture the nucleotides inside the EV.

[0033] Furthermore, the double-stranded DNA region in the tetrahedron is formed by local complementary pairing of nucleotides shown in SEQ ID NOs. 1 to 6.

[0034] Furthermore, the nucleotides shown in SEQ ID NO.1 to 6 also include nucleotides having 80%-100% homology thereto, preferably nucleotides having 90%-100% homology thereto, further preferably nucleotides having 95%-100% homology thereto, and even more preferably nucleotides having 99%-100% homology thereto.

[0035] Furthermore, when the DNA chain constitutes a fluorescent probe, it carries a fluorescent group, and the fluorescent group is located at any position of the DNA chain; preferably, the spatial distance between the fluorescent group donor and acceptor molecules is 7 to 10 nm and the position between the donor and acceptor fluorescent groups themselves will not cause fluorescence quenching.

[0036] Furthermore, the carried fluorescent group is a conjugated fluorescent group, such as CFP-YFP; CFP-dsRED; BFP-GFP; GFP-dsRED; YFP-dsRED; Cy3-Cy5; Alexa488-Alexa555; Alexa488-Cy3; FITC-Rhodamine (TRITC); YFP-TRITC; YFP-Cy; preferably Cy3 and Cy5.

[0037] Furthermore, the donor is an electron-accepting fluorophore, such as Cy5.

[0038] Furthermore, the acceptor is an electron-donating fluorophore, such as Cy3.

[0039] Furthermore, when the carried fluorescent groups are Cy3 and Cy5, preferably, the first strand of the DNA tetrahedron is labeled with Cy3, the second strand is labeled with Cy5, and the 3' end of the sixth strand is labeled with Cy5.

[0040] Furthermore, the DNA sequences of strand 1, strand 2 and strand 6 are shown as SEQ ID NOs. 1, 2 and 6.

[0041] Furthermore, the targeting nucleotide refers to a targeting single-stranded nucleotide; preferably a short-chain nucleotide with a sequence length not exceeding 24 bp, such as microRNA and small interfering RNA.

[0042] Furthermore, the microRNA is any microRNA, such as microRNA 23a, microRNA 125b, microRNA 145 and / or microRNA 21; preferably microRNA 21.

[0043] Furthermore, the extracellular vesicles are derived from umbilical cord mesenchymal stem cells, adipose mesenchymal stem cells and / or bone marrow mesenchymal stem cells.

[0044] In a fourth aspect, the present invention provides a use of the DNA tetrahedral structure (TDN) as described in the first aspect as a probe, wherein the probe is used to detect a targeted nucleotide.

[0045] Furthermore, the targeting nucleotide refers to a targeting single-stranded nucleotide; preferably a short-chain nucleotide with a sequence length not exceeding 24 bp, such as microRNA and small interfering RNA.

[0046] Furthermore, the microRNA is any microRNA, such as microRNA 23a, microRNA 125b, microRNA 145 and / or microRNA 21; preferably microRNA 21.

[0047] In a fifth aspect, the present invention provides a use of the DNA tetrahedron as described in the first aspect as a targeted nucleotide molecular imaging agent, wherein when one or more single strands of TDN are complementary paired with one or more targeted nucleotides, the fluorescence of TDN itself may undergo specific spectral changes after the fluorescent group is excited by exogenous excitation light.

[0048] Furthermore, the targeted nucleotide molecule imaging agent is used for extracellular vesicle imaging, cell imaging and / or free nucleotide imaging in body fluids.

[0049] Furthermore, when the fluorescent groups are selected as Cy3 and Cy5, after being excited by the excitation light, TDN itself emits red fluorescence; the extracellular vesicles labeled by TDN emit yellow fluorescence.

[0050] Furthermore, the excitation light wavelength is 440-720nm, preferably 488-525nm; preferably 550-560nm; preferably 570-580nm; preferably 660-700nm.

[0051] Furthermore, the extracellular vesicles are derived from umbilical cord mesenchymal stem cells, adipose mesenchymal stem cells and / or bone marrow mesenchymal stem cells.

[0052] Furthermore, the extracellular vesicle imaging is in vivo imaging and / or ex vivo imaging.

[0053] Beneficial Effects

[0054] The DNA tetrahedron fluorescent probe prepared by the present invention is a microRNA targeting probe based on DNA plasticity. Different types of miRNA cause obvious differences in DNA tetrahedron fluorescence, that is, the DNA tetrahedron structure (TDN) can be used as a probe to detect targeted nucleotides. Taking advantage of the natural biocompatibility, structural stability, programmability, easy internalization and editability of the DNA tetrahedron nanostructure, EV-TDN complexes can be synthesized by using extracellular vesicles derived from mesenchymal stem cells as a delivery platform. The complex has the effect of improving safety and enhancing the target organ / systemic signal ratio, and accurately and quantitatively tracking the behavior of EV in mice for 7 consecutive days without affecting its regenerative ability and therapeutic effect. The DNA tetrahedron fluorescent probe TDN designed in this application can be used to detect targeted nucleotides; it can safely, accurately, non-invasively, in real time, and quantitatively characterize the fate and therapeutic effect of EV in lung organs and even life systems, and can be applied to biosensing and disease diagnosis research. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 Fluorescence spectra of DNA tetrahedron after incubation with different types of miR-21-5p for 2 h.

[0056] Figure 2 DNA tetrahedron detection of nucleic acid-detection linear data. (A) Fluorescence spectra of DNA tetrahedron after incubation with different concentrations of miR-21-5p for 2 hours; (B) Fluorescence intensity of DNA tetrahedron at 570 nm after incubation with different concentrations of miR-21-5p for 2 hours; (C) Corresponding calibration curve. (n=3, mean±sd).

[0057] Figure 3 Characterization of DNA tetrahedral probes by 5% agarose gel electrophoresis. (A) TDN probe; (B) TDN probe bound to miR-21.

[0058] Figure 4 Atomic force microscopy characterization of TDN and TDN probe bound to miR-21. (A) TDN probe; (B) TDN probe bound to miR-21; (C) Size comparison.

[0059] Figure 5 Fluorescence changes of TDN probe and TDN probe bound to miR-21.

[0060] Figure 6 Effects of the position and quantity of Cy5 fluorescent groups on the fluorescence intensity of TDN probes. (A) Fluorescence intensity of TDN probes carrying fluorescent groups on chains 2, 5, and 6; (B) Position pattern of TDN fluorescent groups; (C) Emission peaks of Cy5 fluorescent groups at different positions and quantities (Cy3 emission peak / Cy5 emission peak).

[0061] Figure 7 PMT voltage setting diagram.

[0062] Figure 8 Nanoflow cytometry results of unlabeled extracellular vesicles (A) and extracellular vesicles labeled with different concentrations of DNA tetrahedron probes (5uM (B), 10uM (C), 15uM (D)). (E) Nanoflow cytometry results of extracellular vesicles labeled with DiO. (F) Statistical graph of the results of the above labeling methods.

[0063] Fig. 9 Fluorescence stability and labeling efficiency of EV-TDN. (A) 12-day fluorescence stability of EVs labeled with 15 μM TDN probe and DiO; (B) Labeling efficiency of EVs labeled with different concentrations of TDN probe and DiO.

[0064] Fig.10 Efficiency and fluorescence stability of EV labeling by TDN probes of different sizes.

[0065] Fig.11Cell imaging results of EV-TDN (EV-TDN uptake by RAW247.6 cells). Note: Laser confocal microscope image, DAPI marks the cell nucleus, DAPI is blue signal, EV-TDN is red signal, scale bar is 25μm.

[0066] Fig.12 EV-TDN labeled frozen section results of lung tissue. Note: Laser confocal microscopy image of frozen section of lung tissue of mice injected with EV-TDN 7 days ago, EV-TDN is yellow signal, scale bar is 250μm. DETAILED DESCRIPTION

[0067] The specific embodiments of the present invention are further described below. It should be noted that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation of the present invention. In addition, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.

[0068] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0069] the term

[0070] RAW264.7 cells: are cells derived from a mouse intestinal cell line, derived from an Abelson murine leukemia virus-induced tumor; negative for sIg-, Ia-antigens, and Thy-1.2 surface antigens. RAW 264.7 cells do not secrete detectable viral particles, and the XC spot formation test is negative. RAW 264.7 cells can pinocytose neutral red and phagocytose latex particles and yeast polysan, and can antibody-dependently decompose sheep red blood cells and tumor target cells. LPS or PPD treatment for 2 days can induce RAW 264.7 cells to decompose red blood cells, but has no effect on tumor target cells.

[0071] Extracellular vesicles (EV / EVs): EVs are a heterogeneous group of membrane structures secreted by cells and wrapped in a lipid bilayer, containing tiny particles secreted by cells. EV vesicles vary in biological origin and size: exosomes are smaller vesicles with a diameter of about (50-150nm), formed in endosomes, which are organelles responsible for endocytosis and decomposition of substances inside the cell; microvesicles are larger vesicles with a diameter between 50-500nm and 1000nm, which are formed by the shedding of the cell membrane and can mature and separate through protrusions on the cell membrane; apoptotic bodies are larger vesicles formed during cell death, with a diameter greater than 1000nm, and when cells enter the process of apoptosis (programmed cell death), they release these vesicles. Extracellular vesicles are cell-derived nanosized vesicles that mediate intercellular communication by transporting bioactive molecules and therefore play important roles in various physiological and pathological conditions.

[0072] microRNA (miRNA, miR): is a small, non-coding RNA molecule with a length of about 18 to 25 nucleotides. It binds to the target mRNA completely or incompletely, resulting in target mRNA degradation or translation inhibition. It plays an important role in the post-transcriptional regulation of eukaryotic gene expression and participates in physiological processes such as individual growth and development. In recent years, studies have found that abnormal expression of microRNA may play an important role in the occurrence and development of tumors (such as proliferation, differentiation, and apoptosis).

[0073] miR-21: It is one of the earliest miRNA molecules discovered and confirmed in mammals. Currently, miR-21 has been found in various tissues and cells in 31 species. Like other miRNAs, miR-21 is encoded by the miR-21 gene, which is transcribed by RNA polymerase II in the cell nucleus to produce the initial transcript pri-miR-21, and then modified in two orderly steps to form mature miR-21.

[0074] Mesenchymal stem cells (MSC): an important member of the stem cell family, belonging to adult stem cells. They originate from the mesoderm and ectoderm in the early stages of development. MSC was first discovered in Friedenstein's bone marrow in 1968, and has attracted increasing attention due to its multi-directional differentiation potential, hematopoietic support, promotion of stem cell implantation, immune regulation and self-replication. For example, under specific induction conditions in vivo or in vitro, mesenchymal stem cells can differentiate into a variety of tissue cells such as fat, bone, cartilage, muscle, tendon, ligament, nerve, liver, myocardium, endothelium, etc., and they still have multi-directional differentiation potential after continuous subculture and cryopreservation, and can be used as ideal seed cells for repairing tissue and organ damage caused by aging and pathology.

[0075] Example

[0076] Example 1 DNA Tetrahedron Detection of Nucleic Acids - Detection of Linear Data

[0077] 1.1 Quantification of single-stranded DNA concentration

[0078] Six single-stranded DNA (nucleotides shown in SEQ ID NOs. 1 to 6) dry powders were synthesized by Sangon, and the concentration of the single-stranded DNA was quantified to 50 μM using a UV-visible spectrophotometer.

[0079] 1.2 DNA tetrahedron synthesis

[0080] (1) DNA tetrahedron synthesis was performed using a 100 μL system, the system being as shown in Table 1:

[0081] Table 1. DNA tetrahedron synthesis system (100 μL)

[0082] DEPC water 78μL 10X TM Buffer 10μL 50 μM ssDNA 2μL

[0083] (2) PCR reaction: 95°C for 10 min, then cool to 4°C;

[0084] (3) The final concentration of synthesized DNA tetrahedron is 1 μM.

[0085] 1.3 Preparation of miR-21-5p solutions at different concentrations

[0086] The miR-21-5p dry powder was synthesized by Sangon, and the concentration of miR-21-5p was quantified to 50 μM by UV-visible spectrophotometer;

[0087] Prepare miR-21-5p solutions of the following concentrations by dilution:

[0088] 0 nM, 2 nM, 10 nM, 20 nM, 100 nM, 200 nM, 1 μM, 2 μM, 4 μM, 10 μM, 20 μM, 30 μM, 40 μM and 50 μM.

[0089] 1.4 DNA tetrahedrons were co-incubated with different concentrations of miR-21-5p in buffer

[0090] (1) Composition of the 120 μL incubation system, as shown in Table 2:

[0091] Table 2. DNA tetrahedron incubation system (120 μL)

[0092] DEPC water 2μL 10XPBS 12μL 1 μM DNA Tetrahedron 100μL miR-21-5p 6μL

[0093] (2) Different concentrations of miR-21-5p were added according to the above incubation system.

[0094] The concentrations of miR-21-5p were changed to:

[0095] 0 nM, 0.1 nM, 0.5 nM, 1 nM, 5 nM, 10 nM, 50 nM, 100 nM, 200 nM, 500 nM, 1 μM, 1.5 μM, 2 μM and 2.5 μM;

[0096] (3) Incubation conditions: 37°C for 2 h, rotation speed of 350 rpm.

[0097] 1.5 Fluorescence value determination

[0098] 120 μL of DNA tetrahedron and miR-21-5p binding solution was transferred to a 96-well plate, and the fluorescence intensity was measured using a multifunctional microplate reader.

[0099] For obtaining the fluorescence spectrum: by spectral scanning, under the excitation of 488nm, the fluorescence value of 500-700nm was detected;

[0100] For quantitative analysis and comparison: endpoint kinetics was used to detect the fluorescence value at 570 nm under 488 nm excitation.

[0101] 1.6 Data analysis: Use origin software for data processing and drawing.

[0102] 1.7 Test results

[0103] Figure 1 A is the fluorescence spectrum of DNA tetrahedron after incubation with different concentrations of miR-21-5p for 2 h. The fluorescence values ​​of 500 to 700 nm were detected, and the highest peak was near 570 nm.

[0104] Figure 1B is the fluorescence intensity at 570 nm after DNA tetrahedron was co-incubated with different concentrations of miR-21-5p for 2 h. Figure 1 C is the corresponding calibration curve. The experimental results show that in the concentration range of 0-2 μM, the fluorescence intensity increases with the increase of miR-21-5p concentration, and in the concentration range of 0-1 μM, the fluorescence intensity increases linearly with the increase of concentration. When the concentration exceeds 2 μM, the fluorescence intensity no longer increases even if the miR-21-5p concentration increases.

[0105] In summary, it was demonstrated that DNA tetrahedron showed a good linear relationship with miR-21-5p, and the linear detection range was 0-1 μM, which indicated that DNA tetrahedron could be used for nucleic acid detection.

[0106] Example 2 DNA Tetrahedron Detection of Nucleic Acids - Selectivity Data

[0107] 2.1 Quantification of single-stranded DNA concentration

[0108] The 6 single-stranded DNA dry powders were synthesized by Sangon, and the concentration of the single-stranded DNA was quantified to 50 μM using a UV-visible spectrophotometer.

[0109] 2.2 DNA Tetrahedron Synthesis

[0110] (1) DNA tetrahedron synthesis was performed using a 100 μl system, the system being as shown in Table 3:

[0111] Table 3. DNA tetrahedron synthesis system (100 μL)

[0112] DEPC water 78μL 10X TM Buffer 10μL 50 μM ssDNA 2μL

[0113] (2) PCR reaction: 95°C for 10 min, then cool to 4°C;

[0114] (3) The final concentration of synthesized DNA tetrahedron is 1 μM.

[0115] 2.3 DNA tetrahedrons and different types of miRNAs co-incubated in buffer

[0116] (1) Composition of the 120 μL incubation system, as shown in Table 4:

[0117] Table 4. DNA tetrahedron incubation system (120 μL)

[0118] DEPC water 2μL 10XPBS 12μL 1 μM DNA Tetrahedron 100μL miRNA 6μL

[0119] (2) Different types of miRNAs were added according to the above incubation system. The types and sequences of miRNAs are shown in Table 5:

[0120] Table 5. Types and sequences of miRNAs

[0121] miRNA types sequence miR21-5nt UAGCU miR21-10nt UAGCUUAUCA miR21-15nt UAGCUUAUCAGACUG miR21-20nt UAGCUUAUCAGACUGAUGUU mixture GAUUAGGCUUACUUCGAUAUAU miss1 UAGCUUAUCAGACUGAUAUUGA miss2 UAGCUUAUCAGACCGAUAUUGA miss3 UAGCUUAUCAGACCGAUAUCGA miR-21-5p UAGCUUAUCAGACUGAUGUUGA

[0122] (3) Incubation conditions: 37°C for 2 h, rotation speed of 350 rpm.

[0123] 2.4 Fluorescence value determination

[0124] 120 μL of DNA tetrahedron and miRNA binding solution was transferred to a 96-well plate, and the fluorescence intensity was measured using a multifunctional microplate reader.

[0125] For obtaining the fluorescence spectrum: by spectral scanning, under the excitation of 488nm, the fluorescence value of 500-700nm was detected;

[0126] For quantitative analysis and comparison: endpoint kinetics was used to detect the fluorescence value at 570 nm under 488 nm excitation.

[0127] 2.5 Data analysis: Use origin software for data processing and drawing.

[0128] 2.6 Test results

[0129] In order to confirm the recognition specificity between DNA tetrahedron and miRNA 21, miRNAs of different lengths such as miR21-5nt, miR21-10nt, miR21-15nt, and miR21-20nt (having the same bases as miRNA 21 but in different numbers); mixture miRNAs having the same bases as miRNA21 but in different base sequences; and miss1 and miss2 miRNAs having the same number of bases as miRNA21 but with 1 and 2 base mutations, respectively, were co-incubated for 2 h and the fluorescence spectra were measured (e.g. Figure 2 shown).

[0130] The results showed that different types of miRNA caused significant differences in DNA tetrahedron fluorescence, which can be used for nucleic acid detection.

[0131] Example 3 Synthesis of DNA Tetrahedron Probe

[0132] 3.1 Test methods

[0133] (1) providing six DNA tetrahedral single strands (2 uL) targeting specific microRNAs, including a single strand with a fluorescent group, dissolved in a buffer and mixed;

[0134] (2) After the PCR reaction, the temperature is quickly lowered;

[0135] (3) Add microRNA 21 to the system in (2), mix well and incubate; the DNA tetrahedron that binds to miR-21 in vitro is TDN-miR21, wherein the sequence of miR-21 is (5'-3'):

[0136] (4) DNA tetrahedron running verification: the gel was stained with gel red, and the synthesis effect of DNA tetrahedron was imaged and analyzed using a gel imager.

[0137] 3.2 DNA sequences

[0138] Six tetrahedral DNA single strands targeting specific microRNAs, including a single strand with a fluorescent group, when the fluorescent group is Cy3 and Cy5, the single strand DNA sequence is shown in Table 6.

[0139] Table 6. DNA tetrahedral fluorescent group single-stranded DNA sequence

[0140]

[0141] 3.3 Test results

[0142] like Figure 3 As shown, agarose electrophoresis confirmed that the TDN probe was composed of six DNA single strands and could bind to miR-21 in vitro. Figure 3 Agarose gel electrophoresis in A shows that with the addition of TDN body structure sequence (chain 1 to chain 6), the electrophoretic mobility obviously changes from slow to fast under the combined effect of DNA single strand molecular weight and negative charge carrying amount, and six DNA single strands synthesize TDN. Figure 3 B Agarose gel electrophoresis showed that the electrophoretic mobility slowed down significantly after the addition of miR-21, indicating that the DNA tetrahedron probe had bound to miR-21. In summary, it was confirmed that the TDN probe was successfully synthesized and could bind to miRNA.

[0143] like Figure 4 As shown in the figure, the atomic force microscope scanning image shows that the prepared TDN probe is well dispersed and the spatial structure is a regular tetrahedron. After the TDN probe binds to miR-21, the spatial structure is still a tetrahedron. The size statistics show that the TDN probe successfully binds to miR-21 and changes in size with significant statistical differences.

[0144] like Figure 5 As shown, the fluorescence spectrophotometer shows that the TDN probe can show the highest emission peak at 560-570nm after being excited at 550nm. Compared with the free DNA tetrahedron probe, the emission peak of the TDN probe bound to miR-21 at 560-570nm is higher, indicating that the structural change of the TDN probe after binding to miR-21 can enhance the fluorescence intensity of the probe and amplify the detection signal.

[0145] like Figure 6 As shown, extracellular vesicles derived from mesenchymal stem cells were obtained by ultracentrifugation, and the extracellular vesicles were negatively stained with uranyl acetate. Transmission electron microscopy results showed that the extracellular vesicles extracted from mesenchymal stem cells presented a typical spherical cup-shaped structure; nanoparticle tracking analysis showed that the diameter of the extracellular vesicles was 191.5±125.7nm.

[0146] Example 4 DNA Tetrahedrons Entering Mesenchymal Stem Cell-Derived Extracellular Vesicles

[0147] DNA tetrahedrons can be incubated overnight at 37 degrees / electroporated into mesenchymal stem cell-derived extracellular vesicles as follows:

[0148] 4.1 Obtaining extracellular vesicles from mesenchymal stem cells

[0149] (1) Mesenchymal stem cells are cultured in a medium containing extracellular vesicles removed;

[0150] (2) performing continuous centrifugation to remove cells, apoptotic bodies, and cell debris, respectively;

[0151] (3) harvesting extracellular vesicles by centrifugation;

[0152] (4) The precipitate is resuspended and ultra-concentrated to remove contaminating proteins, thereby obtaining extracellular vesicles derived from mesenchymal stem cells.

[0153] 4.2 DNA tetrahedrons were incubated at 37°C overnight to enter extracellular vesicles derived from mesenchymal stem cells

[0154] The synthesized DNA tetrahedrons can be placed incubated at 37 degrees overnight and enter the extracellular vesicles derived from mesenchymal stem cells. 4.3 Electroporation of DNA tetrahedrons into extracellular vesicles derived from mesenchymal stem cells

[0155] (1) The synthesized tetrahedron is concentrated using an ultrafiltration tube as needed to obtain a concentration of 15 uM;

[0156] (2) Precooling the electric rotating cup;

[0157] (3) Prepare electroporation solution (82 μL Nucloefector TM Solution+18μL Supplement), add 20μL of DNA tetrahedron and 2μL of 25μg / μL extracellular vesicles to the electroporation solution, and mix the system thoroughly;

[0158] (4) Transfer the liquid to an electric rotating cup;

[0159] (5) Idle running;

[0160] (6) Electroporation;

[0161] (7) Cooling after electroporation;

[0162] (8) transferring the liquid in the electroporation cup to an ultrafiltration tube, and ultrafiltration is performed to remove the DNA tetrahedrons that have not entered the extracellular vesicles;

[0163] (9) collecting the product in the ultrafiltration tube, flushing the ultrafiltration tube, and transferring the flushing solution to the product collection tube to obtain the DNA tetrahedron electroporated into the mesenchymal stem cell-derived extracellular vesicles.

[0164] Example 5 Detection of the efficiency of DNA tetrahedral fluorescent probe dye labeling extracellular vesicles

[0165] 5.1 Test steps

[0166] (1) Using nano-flow cytometry, the PMT voltage was set as follows Figure 7 As shown;

[0167] (2) Refer to the instructions of the mixed microspheres to determine the distribution of 110, 180, 240, 300, 500, 590, 880, and 1300 nm nanometer standard microspheres; after determining the analysis parameters, determine the size position by running the standard mixed microspheres;

[0168] (3) Keep the system clean;

[0169] (4) Run EV-TDN samples with a sample loading concentration of 104-106 / ul;

[0170] (5) Collect data and analyze event / s and event / μL;

[0171] (6) Analyze the data and calculate the percentage of gated area using the denominator of total events.

[0172] 5.2 Results

[0173] like Figure 8 The AD nanoflow cytometry results showed that unlabeled extracellular vesicles had no fluorescent signal, while TDN-labeled extracellular vesicles had fluorescent signals and were clearly grouped.

[0174] Figure 8 F shows that the labeling efficiency of 10μM and 15μM DNA tetrahedral TDN probe is higher than that of 5μM (P<0.05), confirming that the concentration is positively correlated with EV labeling efficiency.

[0175] Figure 8 BF confirmed that the labeling efficiency of 5, 10, and 15 μM DNA tetrahedron probes was higher than that of Dio (P<0.001).

[0176] Therefore, compared with the traditional membrane dye DiO, TDN has a high labeling efficiency.

[0177] like Fig. 9 A Nanoflow cytometry analysis showed that the fluorescence positive ratio of TDN-labeled extracellular vesicles decreased with the increase of days.

[0178] Fig. 9 B shows that the fluorescence positive ratio of 5, 10, and 15 μM EV-TDN decreased by no more than 20% within 12 days, indicating that EV-TDN has good fluorescence stability and the TDN labeling material has high stability.

[0179] like Fig.10 A Nanoflow cytometry assay showed that as the number of days increased, the fluorescence positive ratio of 39nt and 45nt TDN-labeled extracellular vesicles fluctuated but did not decrease significantly, indicating that EV-TDN had good fluorescence stability.

[0180] Fig.10 B shows that the TDN labeling efficiency of 27 nt is the highest, and the TDN labeling efficiency of 39 nt is higher than that of 45 nt.

[0181] Example 6 Application of EV-TDN in Cell Imaging

[0182] 6.1 Test steps

[0183] (1) RAW264.7 cells were inoculated into a cell slide in culture medium;

[0184] (2) adding extracellular vesicles labeled with different concentrations of DNA tetrahedron (5 μM, 10 μM, 15 μM) and incubating;

[0185] (3) removing the supernatant and washing the cells;

[0186] (4) Fixing the cells and then washing them;

[0187] (5) Incubate the fixed cells with anti-CD31 primary antibody overnight;

[0188] (6) incubation with Alexa Fluor 488 goat anti-mouse IgG or Alexa Fluor 594 goat anti-mouse IgG;

[0189] (7) The cell nuclei were counterstained with 4,6-diamidino-2-phenylindole (DAPI) and the fluorescence was detected by CLSM at 520 nm excitation and 530 nm.

[0190] -700nm signal collection imaging.

[0191] 6.2 Results

[0192] like Fig.11As shown, using confocal laser microscopy, co-localization of red fluorescent images (EV-TDN) and blue fluorescent images (DAPI) was observed in RAW247.6 cells, and the red fluorescent image (EV-TDN) was aggregated in the perinuclear region of the cells, indicating that RAW247.6 cells successfully phagocytosed EV-TDN, and EV-TDN was mostly distributed in the cytoplasm.

[0193] Example 7 Application of EV-TDN in in vivo imaging

[0194] 7.1 Test steps

[0195] (1) C57BL / 6 mice were anesthetized and placed on an animal plate;

[0196] (2) Injection of EV-TDN solution into healthy mice;

[0197] (3) imaging of material distribution in lung tissue of EV-TDN in mice;

[0198] (4) light with a central wavelength of 488 nm was selected as the excitation source, and in vivo spectral imaging from 500 nm to 700 nm was performed with an exposure time of 200 m per image frame, and the intensity of the fluorescence signal was quantified by the average radiance from a fixed-area region of interest (ROI) of the lung;

[0199] (5) At designated time intervals, mice injected with EV-TDN were killed, brain tissue was obtained by cardiac perfusion and then fixed, and major organs (heart, liver, spleen, lung, and kidney) were isolated and subjected to ex vivo fluorescence imaging using an imaging system;

[0200] (6) The obtained lung tissue was processed, fixed, embedded in OCT compound, and frozen and sectioned for imaging under 488 nm excitation and 500-700 nm signal collection.

[0201] 7.2 Results

[0202] like Fig.12 As shown, on day 7, yellow punctate and aggregated signals (EV-TDN) were still clearly detected in lung tissue cells, indicating the stable labeling properties of EV-TDN in mice.

Claims

1. A DNA tetrahedron TDN, wherein the tetrahedron is composed of 6 edges composed of DNA chains, wherein: At least one side is a single-stranded DNA, and the rest are double-stranded DNA. When the single-stranded DNA in the tetrahedron is complementary to the target nucleotide, the target nucleotide can be captured.

2. A method for preparing a DNA tetrahedron as claimed in claim 1, comprising the following steps: S1. Dissolve the nucleotides of the DNA chain shown in SEQ ID NO. 1 to 6 in a buffer and mix well; S2. Perform PCR reaction on the solution in step S1 to obtain DNA tetrahedron.

3. An extracellular vesicle DNA tetrahedron (EV-TDN) complex, wherein the complex is composed of one or more single strands of TDN complementary to one or more nucleotides inside the EV, and the TDN can capture the nucleotides inside the EV; the TDN is as described in claim 1.

4. Use of the tetrahedral DNA structure (TDN) as claimed in claim 1 as a probe for detecting a targeted nucleotide.

5. A use of the DNA tetrahedron as claimed in claim 1 as a targeted nucleotide molecular imaging agent, wherein when one or more single strands of TDN are complementary paired with one or more targeted nucleotides, the fluorescence of TDN itself can undergo specific spectral changes after the fluorescent group is excited by exogenous excitation light.

6. The targeted nucleotide molecular imaging agent as described in claim 5 is used for extracellular vesicle imaging, cell imaging and / or free nucleotide imaging in body fluids; the extracellular vesicles are derived from umbilical cord mesenchymal stem cells, adipose mesenchymal stem cells and / or bone marrow mesenchymal stem cells; the extracellular vesicle imaging is in vivo imaging and / or ex vivo imaging; when the fluorescent groups are selected as Cy3 and Cy5, after excitation by excitation light, TDN itself is red fluorescence; TDN-labeled extracellular vesicles are yellow fluorescence; the excitation light wavelength is 440-720nm, preferably 488-525nm; preferably 550-560nm; preferably 570-580nm; preferably 660-700nm.

7. A DNA tetrahedral fluorescent probe (TDN) as claimed in any one of claims 1 to 3, wherein the double-stranded DNA region in the tetrahedron is formed by local complementary pairing of the nucleotides shown in SEQ ID NOs. 1 to 6; the nucleotides shown in SEQ ID NOs. 1 to 6 also include nucleotides having 80%-100% homology thereto, preferably nucleotides having 90%-100% homology thereto, further preferably nucleotides having 95%-100% homology thereto, and even more preferably nucleotides having 99%-100% homology thereto.

8. The DNA chain as claimed in any one of claims 1 to 3 carries a fluorescent group when constituting a fluorescent probe, and the fluorescent group is located at any position of the DNA chain; preferably, the fluorescent group is located at a position where the spatial distance between the donor and the acceptor molecules is 7 to 10 nm and no fluorescence quenching will occur between the donor and acceptor fluorophores themselves.

9. The fluorescent group carried as claimed in any one of claims 1 to 3 is a conjugated fluorescent group, such as CFP-YFP; CFP-dsRED; BFP-GFP; GFP-dsRED; YFP-dsRED; Cy3-Cy5; Alexa488-Alexa555; Alexa488-Cy3; FITC-Rhodamine (TRITC); YFP-TRITC; YFP-Cy3; preferably Cy3 and Cy5; when the carried fluorescent groups are Cy3 and Cy5, preferably the 1st strand of the DNA tetrahedron is labeled with Cy3, the 2nd strand is labeled with Cy5, and the 3' end of the 6th strand is labeled with Cy5; the DNA sequences of the 1st strand, the 2nd strand and the 6th strand are as shown in SEQ ID NO.1, 2 and 6.

10. As described in any one of claims 1-4, the targeting nucleotide refers to a targeting single-stranded nucleotide; preferably a short-chain nucleotide with a sequence length not exceeding 24 bp, such as microRNA, small interfering RNA; the microRNA is any microRNA, such as microRNA 23a, microRNA 125b, microRNA 145 and / or microRNA 21; preferably microRNA 21.

Images