Application of oryza longistaminata OlARF9 gene in improvement of hypoxia stress resistance of rice

Abstract

The invention discloses an application of a oryza longistaminata OlARF9 gene in improving hypoxia stress resistance of rice, and belongs to the field of bioengineering. According to the invention, overexpression is carried out on the oryza longistaminata OlARF9 gene in rice by adopting an overexpression technology, and according to phenotypic changes of transgenic plants, overexpression of the oryza longistaminata OlARF9 gene in the rice can significantly improve the ability of the rice to resist hypoxia stress, so that the oryza longistaminata OlARF9 gene can be applied to improve the resistance of the rice to abiotic stress and improve the resistance of the oryza longistaminata OlARF9 gene in the rice. Comprising the following steps: overexpressing the oryza longistaminata OlARF9 gene in rice to obtain a transgenic plant, wherein the resistance of the obtained transgenic plant to hypoxia stress is obviously enhanced. The method has application prospects in the aspects of improving and enhancing rice stress resistance, accelerating the stress-resistant molecular breeding process and the like.

Description

Technical Field

[0001] The invention relates to application of an Oryza longistaminata OlARF9 gene in improving the resistance of rice to hypoxia stress, and belongs to the field of bioengineering. Background Art

[0002] There are three main rice planting methods: direct seeding, seedling broadcasting and seedling transplanting. Rice seedling transplanting has become the main rice farming method in my country due to its advantages of high and stable yields. Labor shortages have pushed up production costs, and the development of mechanical direct seeding has made direct seeding of rice a mainstream cultivation method.

[0003] Direct seeding is a light and simple rice cultivation method. According to different sowing forms, people divide it into dry direct seeding, wetland direct seeding and water direct seeding. Dry direct seeding adopts the "dry sowing and water pipe" mode, which is suitable for rice areas in the north with tight water resources, reducing greenhouse gases and water consumption. Water direct seeding sows pre-germinated seeds in the rice field with overlying water layer, omitting cumbersome procedures. It is suitable for highlands, lowlands or flood-prone areas, saving costs and labor. The water layer of water direct seeding suppresses weeds and reduces pest damage. It requires less irrigation water and does not require special management. Wetland direct seeding is similar to water direct seeding, but there is no water layer on the field surface. It needs to be soaked in water for land preparation and is the most widely used. Rice seeds in the direct seeding system may encounter flooding conditions, which has become popular because it reduces the cost of weed control.

[0004] Therefore, in direct seeding systems, rapid and uniform germination and normal development of seedlings under flooded conditions are the keys to improving seedling vigor, efficient nutrient uptake and increasing yield.

[0005] Wild rice longistaminata contains genes for tolerance or resistance to biotic and abiotic stresses and other genes with potential application value such as self-incompatibility, and is a valuable resource for improving Asian cultivated rice and broadening the genetic background.

[0006] Among them, OlARF9 encodes an auxin response factor protein. At present, the research on auxin response factor proteins mainly focuses on affecting the polar transport of auxin. It may be involved in the asymmetric distribution pathway of auxin that depends on HSFA2D and LAZY1, thereby controlling the tillering angle of rice. Some studies have also shown that this family of genes has the function of regulating rice resistance to rice blast. In addition, this family of genes also plays a role in plant development. For example, ARF12 mutations together with any mutation of ARF6, ARF17 or ARF25 lead to the defective phenotypes observed in the miR167d overexpression line OX167d, that is, the stamen filaments cannot elongate, the stigma enlarges, and the lodicule morphology changes, leading to closed flower fertilization.

[0007] However, to date, there has been no report on the role of OlARF9 protein or its encoding gene in improving plant tolerance to hypoxia stress. Summary of the invention

[0008] The present invention provides an Oryza longistaminata OlARF9 gene, the nucleotide sequence of which is shown in SEQ ID NO:1, and which encodes an amino acid sequence shown in SEQ ID NO:2.

[0009] The invention overexpresses the Oryza longistaminata OlARF9 gene in rice to obtain transgenic rice, and the obtained transgenic rice has enhanced resistance to hypoxia stress.

[0010] Preferably, the method for cultivating transgenic rice specifically comprises:

[0011] (1) constructing a recombinant plant expression vector containing the gene encoding the OlARF9 protein of Oryza longistaminata;

[0012] (2) transforming the constructed recombinant plant expression vector into recipient rice tissues or rice cells;

[0013] (3) Cultivate and screen transgenic rice with improved resistance to hypoxia stress.

[0014] Preferably, the present invention provides a recombinant plant expression vector containing the Oryza longistaminata OlARF9 gene and a recombinant host cell containing the recombinant plant expression vector.

[0015] Preferably, the gene of the longistaminata wild rice OlARF9 is operably connected to an expression regulatory element to obtain a recombinant plant expression vector, and the plant expression vector may be composed of a 5′ non-coding region, a coding gene of the longistaminata wild rice OlARF9 protein and a 3′ non-coding region; wherein the 5′ non-coding region may include a promoter sequence, an enhancer sequence and / or a translation enhancing sequence; the promoter may be a constitutive promoter, an inducible promoter, an enhanced promoter, a tissue or organ specific promoter; the 3′ non-coding region may contain a terminator sequence and an mRNA cleavage sequence, and a suitable terminator sequence may be obtained from the Ti-plasmid of Agrobacterium tumefaciens, such as the octopine synthase and nopaline synthase terminator regions.

[0016] Preferably, the recombinant plant expression vector contains a selectable marker gene for selecting transformed cells, which is used to select transformed cells or tissues. The marker genes include: genes encoding antibiotic resistance and genes conferring resistance to herbicidal compounds. In addition, the marker genes also include phenotypic markers, such as β-galactosidase and fluorescent protein.

[0017] Beneficial Effects of the Invention

[0018] The invention has very important theoretical and practical significance for improving and enhancing the stress resistance of rice and accelerating the process of stress-resistant molecular breeding.

[0019] Definitions of terms used in this invention

[0020] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0021] The term "transformation" as used in the present invention refers to genetic transformation of polynucleotides or polypeptides into plants by introducing the coding gene of the Oryza longistaminata OlARF9 protein into plant cells. Methods for introducing the polynucleotides or polypeptides into plants are well known in the art, including but not limited to stable transformation methods, transient transformation methods, and virus-mediated methods. "Stable transformation" means that the introduced polynucleotide construct is integrated into the genome of the plant cell and can be inherited by its progeny; "transient transformation" means that the polynucleotide is introduced into the plant but can only be temporarily expressed or present in the plant. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is the coleoptile length of OlARF9 transgenic rice under hypoxia stress.

[0023] Figure 2 A field simulation experiment was established to determine the survival rate of OlARF9 transgenic seedlings under hypoxia stress.

[0024] Figure 3 Identification of OlARF9 transgenic materials.

[0025] Figure 4 This is a map of the 35S:Ubi:EGFP vector used in the examples. DETAILED DESCRIPTION

[0026] The technical solution of the present invention is further described below in conjunction with the accompanying drawings and through specific implementation methods. However, the following embodiments are only simple examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0027] Unless otherwise specified, the experimental procedures and methods involved in the embodiments are methods well known to those skilled in the art.

[0028] Example 101 Genetic transformation experiment of ARF9 gene in rice

[0029] 1. Construction of OlARF9 gene overexpression vector, the steps are as follows:

[0030] (1) Digest the 35S:Ubi:EGFP vector with restriction endonucleases SmaⅠ and HindⅢ (see Figure 4 ), linearize it and recover the linearized vector.

[0031] (2) Using the cDNA of Oryza longistaminata as a template, primers were designed based on the sequence shown in SEQ ID NO.1, and the linker of the linearized 35S:Ubi:EGFP vector was added to the 5′ end of the upstream and downstream primers to obtain the primer sequence:

[0032] F: 5′- ggatcccc AATGGCCGCCGCGATGGAGATG-3′ (the underlined part is the linker sequence)

[0033] R: 5′- gggcgactata TTAGCAGTCCCTGTTAGTAACT-3′ (the underlined part is the linker sequence)

[0034] (3) Perform PCR amplification using the primers designed in step (2) and recover the amplified target DNA fragment.

[0035] (4) Using In-Fusion HD Cloning Kit (Clontech, Code no: 639648), homologous recombination of the target DNA fragment (obtained in step (3)) and the linearized vector (obtained in step (1)) was performed to obtain a recombinant plasmid.

[0036] (5) The obtained recombinant plasmid is transformed into competent cells, and the competent cells are spread on LB solid medium containing kanamycin to culture to obtain a single clone.

[0037] (6) The single clone obtained in step (5) is selected and cultured in a liquid LB medium containing kanamycin to obtain a bacterial liquid.

[0038] (7) Perform PCR identification on the bacterial solution obtained in step (6) using the primers shown below.

[0039] OE-OlARF9-F: 5'-CTATTTCTTTGCCCTCGGAC-3',

[0040] OE-OlARF9-R: 5'-CCTGACCTATTGCATCTCCC-3'.

[0041] A 10ul PCR amplification system was prepared. For each system, 1ul of the bacterial solution to be identified was taken, 0.5ul of OE-OlARF9-F and OE-OlARF9-R were added, 5ul of 2xmix Platinum Taq DNA enzyme (Thermo Fisher), and 3.5ul of ddH2O were added. The PCR program was set to pre-denaturation at 95 degrees for 3min, denaturation at 95 degrees for 30s, annealing at 56 degrees for 30s, extension at 72 degrees for 1min45s, 33 cycles, and final extension at 72 degrees for 5min.

[0042] After PCR, agarose gel electrophoresis was performed, and the bacterial solution with a band size of about 1500b was sent to a biological sequencing company for sequencing.

[0043] The results showed that the OlARF9 gene fragment shown in SEQ ID NO.1 was inserted into the downstream of GFP in the vector 35S:Ubi:EGFP ( Figure 3 B), the amino acid sequence of the OlARF9 protein encoded by the sequence is shown in SEQ ID NO.2, and the recombinant vector is named OE-OlARF9.

[0044] (8) Extraction of single clone plasmid: According to the sequencing results, the positive clone bacterial liquid with correct sequence was selected and inoculated into 30 ml of liquid LB medium containing kanamycin. The culture was carried out on a constant temperature shaker at 37°C and 200 rpm for 12 h. The plasmid was extracted using a plasmid extraction kit to obtain the expression vector OE-OlARF9 plasmid DNA for later use.

[0045] 2. Agrobacterium transformation

[0046] The expression vector OE-O1ARF9 was transferred into Agrobacterium EHA105 competent cells by freeze-thaw method. The method was referred to the molecular cloning experiment guide. The specific steps are as follows:

[0047] (1) Add 1 μg of the expression vector OE-O1ARF9 plasmid DNA to 50 μl of EHA105 Agrobacterium competent cells and incubate on ice for 30 min.

[0048] (2) Place in liquid nitrogen for 1 min, then immediately place in a 37°C water bath for 5 min.

[0049] (3) Add 0.5 ml of liquid LB medium and culture at 28°C and 220 rpm for 4 h to obtain a bacterial solution.

[0050] (4) Take out the bacterial solution obtained in step (3) and spread it on an LB plate containing canagliflozin antibiotics, and culture it upside down in an incubator at 28°C. After 2 days, a single colony will grow on the plate.

[0051] (5) Pick a single colony and place it in a liquid LB medium containing canagliflozin antibiotics, incubate it in an incubator at 28° C. to obtain Agrobacterium carrying the expression plasmid vector OE-O1ARF9 for later use.

[0052] 3. Genetic transformation

[0053] Genetic transformation was carried out using Agrobacterium-mediated genetic transformation with rice PR24 and Zhonghua 11 as recipient materials. The culture medium formula is shown in Table 1.

[0054] Table 1 Culture medium and its formula used for genetic transformation

[0055]

[0056] The specific method is as follows:

[0057] (1) Callus induction

[0058] Take 20g of mature PR24 and Zhonghua 11 seeds respectively, after shelling, first wash and disinfect with 70% alcohol for 1min, shaking continuously during the process, and then disinfect with 15% sodium hypochlorite for 30min (can be placed on a shaker for oscillation); finally rinse with sterile distilled water for 5 times, use sterile filter paper to absorb the moisture on the surface of the seeds and then inoculate; the disinfected seeds are inoculated in an induction medium containing 2.0mg / L 2,4-D, and cultured in the dark at 28℃ for 30-40 days. The callus obtained by culture is expanded and cultured on the subculture medium, and subcultured every 2 weeks until embryonic callus is formed.

[0059] (2) Agrobacterium infection

[0060] A. Streak the Agrobacterium carrying the expression plasmid vector OE-O1ARF9 on the surface of LB solid culture medium containing antibiotics (50 mg / L kanamycin or spectinomycin, 25 mg / L rifampicin) and culture overnight at 28°C and 200 rpm.

[0061] B. Pick a single clone with a sterilized toothpick and inoculate it into 5 mL of YEB liquid medium containing the corresponding antibiotics. Cultivate at 28°C with shaking until the OD reaches 0. 600 =0.5.

[0062] C. Take the activated fresh bacterial solution and inoculate it into 25mL of the same YEB liquid medium at a ratio of 1:100, and culture it under the same conditions until OD 600 =0.5.

[0063] D. Centrifuge the bacterial solution at 5000g, 4℃ for 10 min to collect the bacteria and discard the supernatant; add 25mL of 10mM MgSO4 to suspend the bacteria and gently use a pipette to fully suspend them. Centrifuge at 5000g, 4℃ for 10 min to re-collect the bacteria and discard the supernatant.

[0064] E. Resuspend with 25 mL of AA-AS staining medium containing 200 μM acetosyringone (AS).

[0065] F. Transfer the embryonic callus with good growth status from the subculture medium to a culture dish covered with sterile filter paper (cut the callus into 0.3-0.4 mm size) and air-dry on a clean bench for 10-20 minutes.

[0066] G. Immerse the dried embryonic callus in a 50 mL centrifuge tube containing the bacterial solution obtained in step (E) for 20 minutes, shaking it every 5 minutes; then pour out the bacterial solution, take out the callus, place it on sterile filter paper and air-dry it for 10 to 20 minutes, and then transfer it to CC medium containing 200 μM acetosyringone (AS) with sterile filter paper on the surface, and co-cultivate it in the dark at 25°C for 3 days.

[0067] H. Collect callus tissue with no obvious Agrobacterium on the surface, rinse it three times with sterile water containing 600 mg / L cephalosporin, and absorb excess water.

[0068] I. The callus tissue was transferred to a screening medium (N6 medium containing 500 mg / L cephalosporin and 50 mg / L hygromycin) and the screening was continued for 3 times, each time for two weeks, to finally obtain well-growing bright yellow hygromycin-resistant callus tissue.

[0069] (3) Transformant plant regeneration

[0070] Take fresh hygromycin-resistant callus, cut the callus into 2 mm small pieces, inoculate in pre-regeneration medium, culture in dark at 28°C for 7 days, then place in light culture room (12h light / 12h dark) for 8-9 days, transfer the callus that has differentiated adventitious buds to regeneration medium (250mL tissue culture bottle), and continue light culture. Wait until the adventitious buds grow into 4-6cm high seedlings and then transfer to rooting medium, culture in light culture room (12h light / 12h dark) at 28°C for about 15 days, obtain transformant plants, move to greenhouse for planting, and obtain transgenic plants as T0 generation. One month later, take leaves of T0 generation plants for PCR positive identification. The primer sequences used for PCR here are as follows:

[0071] Hpt-F: 5'-CTATTTCTTTGCCCTCGGAC-3',

[0072] Hpt-R: 5'-CCTGACCTATTGCATCTCCC-3'.

[0073] The seeds of T0 generation plants identified as positive were harvested. The positive T0 generation plants included the following: PR24-OlARF9-OE1, PR24-OlARF9-OE2, ZH11-OlARF9-OE1, ZH11-OlARF9-OE2, and ZH11-OlARF9-OE3. Next, experiments will be carried out based on these transgenic plants, and the seeds obtained are T1 generation.

[0074] 5. Molecular identification and stress resistance identification of transgenic plants

[0075] The obtained positive T1 generation seeds were disinfected with 1.5% (v / v) sodium hypochlorite for 15 minutes, rinsed 8 times with ultrapure water, and then placed in a 10 cm centrifuge tube filled with autoclaved ultrapure water and sealed, 10 seeds per tube, 3 tubes for each material. Cultured in the dark for 7 days (28°C, 16 hours; 22°C, 8 hours) to allow the coleoptile to fully grow and elongate, and the length of the coleoptile at 7 days of germination was used as an indicator of germination flooding tolerance (Sun Zhiguang, Wang Baoxiang, Zhou Zhenling. Screening of rice germplasm resources and QTL positioning for germination flooding tolerance. Acta Agronomica Sinica, 2021, 471.61-70.). Figure 1 (A) and Figure 1 (C) The coleoptile morphology of PR24, PR24-O1ARF9-OE1 and PR24-O1ARF9-OE2 transgenic materials based on PR24 background, and ZH11, ZH11-O1ARF9-OE1, ZH11-O1ARF9-OE2 and ZH11-O1ARF9-OE3 transgenic materials based on ZH11 background after germination under hypoxia for 7 days; Figure 1 (B) and Figure 1 (D) The coleoptile lengths of PR24, PR24-OlARF9-OE1 and PR24-OlARF9-OE2 transgenic materials based on PR24 background, and ZH11, ZH11-OlARF9-OE1, ZH11-OlARF9-OE2 and ZH11-OlARF9-OE3 transgenic materials based on ZH11 background after 7 days of hypoxia germination; Figure 1 It can be concluded that the coleoptile length of the material with OlARF9 gene was significantly longer than that of the wild type. The coleoptile length is an indicator of low oxygen germination resistance, that is, OlARF9 can improve the plant's low oxygen tolerance.

[0076] T2 generation (T2 is the plant obtained from T1 generation seeds) OlARF9 transgenic overexpression PR24 and Zhonghua 11 plants were selected, and the hypoxia germination tolerance ability was evaluated by referring to the simulated field flooding direct seeding experimental method of Han Yuqing (Han Yuqing. Research on the response of rice 14-3-3 protein OsGF14h via OsVP1 to hypoxia stress [D]. Shenyang Agricultural University, 2023.). The number of materials that survived hypoxia germination for 7 days after covering with a 10 cm water layer was used as the flooding tolerance index; 3 biological replicates were set, and 15 materials were planted in each replicate;

[0077] Figure 2 (A) and Figure 2(C) The PR24, PR24-O1ARF9-OE1 and PR24-O1ARF9-OE2 transgenic materials with PR24 as the background survived after 7 days of hypoxia germination covered with a 10 cm water layer, and the ZH11, ZH11-O1ARF9-OE1, ZH11-O1ARF9-OE2 and ZH11-O1ARF9-OE3 transgenic materials with ZH11 as the background survived after 7 days of hypoxia germination covered with a 10 cm water layer; Figure 2 (B) and Figure 2 (D) The survival rates of transgenic materials PR24-OlARF9-OE1 and PR24-OlARF9-OE2 with PR24 as background and covered with 10 cm water layer after germination under hypoxia for 7 days, and the survival rates of transgenic materials ZH11 and ZH11-OlARF9-OE1, ZH11-OlARF9-OE2 and ZH11-OlARF9-OE3 with ZH11 as background and covered with 10 cm water layer after germination under hypoxia for 7 days. The experimental results showed that the survival rate of seedlings overexpressing the functional type of OlARF9 was significantly higher than that of the wild type. In summary, rice with the functional gene of OlARF9 has a stronger ability to germinate and establish hypoxic seedlings under hypoxia.

[0078] The seeds of T2 generation (T2 is the plant obtained from T1 generation seeds) OlARF9 transgenic overexpressing PR24, Zhonghua 11 and wild type (i.e. non-transgenic plants) PR24, Zhonghua 11 were selected and sown in boxes after germination. The culture conditions were light / darkness of 16 / 8h, light conditions of 28°C, and dark conditions of 22°C. The expression level of all rice leaves at the RNA level was detected by fluorescent quantitative PCR method. Actin was selected as the internal reference. The fluorescent quantitative PCR primer sequences were:

[0079] F:CATGATGCTTGTCGGGGATG;

[0080] R:TGAGGCATGATTGTCCAGGT;

[0081] The internal reference Actin primers are as follows:

[0082] F:CACCTTCTACAACGAGCTCC;

[0083] R:CCATCACCAGAGTCCAACAC.

[0084] The results of fluorescence quantitative PCR were as follows Figure 3 (A) The expression levels of OlARF9 overexpressing materials in PR24 background and Zhonghua11 background were higher than those in wild type.

[0085] In order to confirm that the overexpression plasmid was introduced into the wild type, Figure 4 The vector was designed with the front primer at EGFP and the back primer at OlARF9. The specific primer sequences are:

[0086] F:GCGATCACATGGTCCTGC;

[0087] R:ATGAGAGAGTTTGGGCTGCT.

[0088] PCR was performed using the designed primers. The results were as follows Figure 3 As shown in (B), it was proved that the OlARF9 gene was not detected in the wild type, while a band of about 1500 bp was detected in the overexpression materials, indicating that the overexpression materials were authentic and the overexpressed genes could be stably inherited in plants.

Claims

1. A Oryza longistaminata OlARF9 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1, and which encodes the amino acid sequence shown in SEQ ID NO:

2.

2. Use of the Oryza longistaminata OlARF9 gene according to claim 1 in improving the resistance of rice to hypoxia stress.

Images