Engineering bacterium for synthesizing astaxanthin and construction method thereof

Abstract

The invention relates to the technical field of bioengineering, in particular to an engineering bacterium for synthesizing astaxanthin and a construction method thereof, and the construction method comprises the following steps: step 1, constructing to obtain a hepS strain BS01; step 2, knocking out a hepT gene in the BS01 gene to obtain a strain BS02; step 3, knocking out a menA gene in the BS02 gene to obtain a strain BS03; step 4, performing homologous recombination and integration on the Haematococcus lacustris crtE, crtB and crtW genes into a BS03 genome to obtain a strain BS04; 5, the corynebacterium glutamicum crtI and crtY genes are integrated into a BS04 genome through homologous recombination, and a strain BS05 is obtained; and step 6, integrating the gene crtZ of the flavobacterium johnsonii into a BS05 genome through homologous recombination, and constructing to obtain a strain BS06, namely the engineering bacterium for synthesizing the astaxanthin. The method disclosed by the invention has very important significance for obtaining food-grade astaxanthin.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to an engineering bacterium for synthesizing astaxanthin and a construction method thereof. Background Art

[0002] Astaxanthin (3,3′-dihydroxy-4,4′-diketo-β,β′-carotene) is a keto-carotenoid, orange-red, fat-soluble, insoluble in water, and soluble in organic solvents. Astaxanthin not only has strong coloring ability, but also has efficient singlet oxygen quenching ability and antioxidant capacity. For example, the antioxidant capacity of astaxanthin is 6000 times that of vitamin C, and it has been considered to be the strongest antioxidant in nature. Astaxanthin can remove nitrogen dioxide, sulfide, sulfur dioxide, etc., and can also effectively inhibit lipid peroxidation caused by free radicals. In addition, astaxanthin also has physiological effects such as delaying aging, inhibiting tumor occurrence, enhancing the body's immunity, preventing cardiovascular disease, and removing free radicals in the body. It has a good therapeutic effect on skin cancer caused by ultraviolet rays. It has been used in health products, high-end cosmetics, medicine, aquaculture and other fields internationally. Astaxanthin is expensive due to its complex synthesis path. At present, the market price of astaxanthin is about US$1,000 per kilogram. It is estimated that by 2030, the output value of astaxanthin can reach 7.28 billion yuan.

[0003] At present, the methods for producing astaxanthin mainly include chemical synthesis, natural extraction and biosynthesis. Astaxanthin is widely found in some marine animals, such as crab shells, shrimp shells, salmon, trout and some algae, fungi and other organisms. The traditional method of extracting natural astaxanthin from crab shells, shrimp shells, etc. faces bottlenecks such as low extraction efficiency and high cost, and can no longer meet the high market demand for astaxanthin. The astaxanthin on the market is mainly chemically synthesized. For example, companies such as Hoffmann-LaRoche and BASF mainly use chemical synthesis methods to industrially produce astaxanthin. Due to the complex synthesis pathway of astaxanthin, the price of chemically synthesized astaxanthin is also very expensive, and the biological functions and application effects of chemically synthesized astaxanthin are significantly different from those of natural astaxanthin. At the same time, there are also problems such as residual intermediates and by-products and low safety. At present, chemically synthesized astaxanthin has not yet been approved for use in nutritional health products. With the rapid development of synthetic biology, the use of microbial technology to synthesize astaxanthin has the advantages of high conversion efficiency, environmental friendliness, and similar structure and function to natural astaxanthin, and has become the main research direction of synthetic astaxanthin.

[0004] Currently, the commonly used microorganisms for fermentation synthesis of astaxanthin include algae, yeast, Escherichia coli, Corynebacterium glutamicum, etc. Bacillus subtilis, as a food safety microorganism certified by the U.S. Food and Drug Administration (FDA), is of great significance in the synthesis of food-grade astaxanthin. However, there is no method for synthesizing astaxanthin in Bacillus subtilis in the prior art. Summary of the invention

[0005] In view of this, the purpose of the present invention is to propose an engineered bacterium for synthesizing astaxanthin and a construction method thereof, so as to realize astaxanthin synthesis in Bacillus subtilis and improve the biosynthesis efficiency of food-grade astaxanthin.

[0006] Based on the above purpose, the present invention provides a method for constructing an engineered bacterium for synthesizing astaxanthin, comprising the following steps:

[0007] Step 1, knocking out the hepS gene in Bacillus subtilis 168 to construct the △hepS strain BS01;

[0008] Step 2: Knock out the hepT gene in BS01 to obtain the △hepS△hepT strain BS02;

[0009] Step 3, knocking out the menA gene in BS02 to obtain the △hepS△hepT△menA strain BS03;

[0010] Step 4: The crtE, crtB, and crtW genes of Haematococcus lacustrine were homologously recombined and integrated into the genome of BS03 by fusion PCR to obtain the △hepS△hepT△menA-crtE-crtB-crtW strain BS04;

[0011] Step 5: Use fusion PCR to homologously recombinantly integrate crtI and crtY genes of Corynebacterium glutamicum into the BS04 genome to obtain △hepS△hepT△menA-crtE-crtB-crtIP 43 -crtY-crtW strain BS05;

[0012] Step 6: Use the fusion PCR method to homologously recombine the crtZ gene of Flavobacterium johnsonii into the BS05 genome to construct the △hepS△hepT△menA-crtE-crtB-crtI-crtY-crtW-crtZ strain BS06, which is the engineered bacteria for synthesizing astaxanthin.

[0013] Preferably, the method for constructing the ΔhepS strain BS01 in step 1 comprises the following steps:

[0014] A1. Using the genome of Bacillus subtilis 168 as a template, the primer set shown in SEQ ID NO.1-6 was used to amplify the left homology arm, the middle fragment and the right homology arm sequence;

[0015] A2, performing overlap extension PCR on the obtained left homology arm, middle fragment and right homology arm sequences to obtain fusion gene fragment A;

[0016] A3. After the amplified product was purified, the fusion gene fragment A was electroporated into competent cells of Bacillus subtilis 168 to obtain strain BS01.

[0017] Preferably, the method for obtaining the ΔhepS ΔhepT strain BS02 in step 2 comprises the following steps:

[0018] B1, using BS01 genome as template, using primer set as shown in SEQ ID NO.7-12 to amplify the left homology arm, middle fragment and right homology arm sequence;

[0019] B2, performing overlap extension PCR on the obtained left homology arm, middle fragment and right homology arm sequences to obtain fusion gene fragment B;

[0020] B3. After the amplified product is purified, the fusion gene fragment B is electroporated into BS01 competent cells to obtain strain BS02.

[0021] Preferably, the method for obtaining the ΔhepS ΔhepT ΔmenA strain BS03 in step 3 comprises the following steps:

[0022] C1, using BS02 genome as template, using primer set as shown in SEQ ID NO.13-18 to amplify the left homology arm, middle fragment and right homology arm sequence;

[0023] C2, performing overlap extension PCR on the obtained left homology arm, middle fragment and right homology arm sequences to obtain fusion gene fragment C;

[0024] C3. After the amplified product is purified, the fusion gene fragment C is electroporated into BS02 competent cells to obtain strain BS02.

[0025] Preferably, the method for obtaining the ΔhepS ΔhepT ΔmenA-crtE-crtB-crtW strain BS04 in step 4 comprises the following steps:

[0026] D1, using the lake Haematococcus genome as a template, using the primer set shown in SEQ ID NO.19-26 to amplify crtE-crtB-crtW and the middle fragment;

[0027] D2, performing overlap extension PCR on the obtained crtE-crtB-crtW and the middle fragment to obtain the fusion gene fragment D;

[0028] D3. After the amplified product is purified, the fusion gene fragment D is electroporated into BS03 competent cells to obtain strain BS04.

[0029] Preferably, step 5 obtains ΔhepS ΔhepT ΔmenA-crtE-crtB-crtIP 43 The method of the -crtY-crtW strain BS05 comprises the following steps:

[0030] E1. Using the genome of Corynebacterium glutamicum as a template, amplify the crtI-crtY and the intermediate fragment using the primer set shown in SEQ ID NO.27-32;

[0031] E2, performing overlap extension PCR on the obtained crtI-crtY and the middle fragment to obtain the fusion gene fragment E;

[0032] E3. After the amplified product is purified, the fusion gene fragment E is electroporated into BS04 competent cells to obtain strain BS05.

[0033] Preferably, the method for constructing the ΔhepS ΔhepT ΔmenA-crtE-crtB-crtI-crtY-crtW-crtZ strain BS06 comprises the following steps:

[0034] F1, using the genome of Flavobacterium johnsonii as a template, using the primer set shown in SEQ ID NO.33-36 to amplify crtZ and the intermediate fragment;

[0035] F2, overlap extension PCR was performed on the obtained crtZ and the middle fragment to obtain the fusion gene fragment F;

[0036] F3. After the amplified product is purified, the fusion gene fragment F is electroporated into BS05 competent cells to obtain strain BS06.

[0037] The present invention also provides an engineering bacterium for synthesizing astaxanthin, which is constructed by adopting the construction method.

[0038] The engineered bacteria used for synthesizing astaxanthin are subjected to seed culture and fermentation culture in sequence to obtain a fermentation liquid containing astaxanthin.

[0039] In one embodiment, the sequence of the HepT gene is shown in genebank ID: 939002; the sequence of the HepS gene is shown in genebank ID: 938998; the sequence of the MenA gene is shown in genebank ID: 937356; the sequence of the CrtE gene is shown in genebank ID: AKR53701.1; the sequence of the CrtB gene is shown in genebank ID: AQT01363.1; the sequence of the CrtI gene is shown in genebank ID: WFP71049.1, the sequence of the CrtY gene is shown in genebank ID: AP017557.2, the sequence of the CrtW gene is shown in genebank ID: AF534876.1, and the sequence of the CrtZ gene is shown in genebank ID: CP000685.1. The Bacillus subtilis 168 of the present invention is purchased from the American Type Microbiological Collection, and the deposit number is ATCC No. 27370. Haematococcus lacustris was purchased from Baoji Liupanyun Biotechnology Co., Ltd. Corynebacterium glutamicum was purchased from Hunan Fenghui Biotechnology Co., Ltd., with the deposit number ATCC13032. Flavobacterium johnsoniae was purchased from Biowind International Biological Reagent Import and Export Logistics Center, with the deposit number ATCC29587.

[0040] Beneficial effects of the present invention: The engineered bacteria used to synthesize astaxanthin in the present invention have the advantages of clear structure, few by-products, no pollution to the environment, short cultivation time, low production cost, etc. It is of great significance for obtaining food-grade astaxanthin. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings in the following description are only for the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0042] Figure 1 The electrophoresis diagrams are of the BS01 PCR product (left) and the fragments recovered by the DNA fragment recovery kit (right);

[0043] Figure 2 The electrophoresis diagrams are of the BS02 PCR product (left) and the fragments recovered by the DNA fragment recovery kit (right);

[0044] Figure 3 The electrophoresis diagrams are of the BS03 PCR product (left) and the fragments recovered by the DNA fragment recovery kit (right);

[0045] Figure 4 The electrophoresis diagrams are of the BS04 PCR product (left) and the fragments recovered by the DNA fragment recovery kit (right);

[0046] Figure 5 The electrophoresis diagrams are of the BS05 PCR product (left) and the fragments recovered by the DNA fragment recovery kit (right);

[0047] Figure 6 The electrophoresis diagrams are of the BS06 PCR product (left) and the fragments recovered by the DNA fragment recovery kit (right);

[0048] Figure 7 The test chart of astaxanthin content in standard product (A) and BS06 (B) detected by HPLC;

[0049] Figure 8 This is the standard curve of astaxanthin. DETAILED DESCRIPTION

[0050] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments.

[0051] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in the present invention should have the common meanings understood by persons having ordinary skills in the field to which the present invention belongs.

[0052] The invention relates to a method for constructing an engineering bacterium for synthesizing astaxanthin, comprising the following steps: step 1, knocking out a gene encoding heptaprenyldiphosphate synthase component I (hepS) in Bacillus subtilis168 to obtain a △hepS strain BS01; step 2, knocking out a gene encoding heptaprenyldiphosphate synthase componentII (hepT) in BS01 to obtain a △hepS△hepT strain BS02; step 3, knocking out a gene encoding 1,4-dihydroxy-2-naphthoate octaprenyltransferase (menA) in a gene of BS02 to obtain a △hepS△hepT△menA strain BS03; step 4, using a fusion PCR method to knock out a gene encoding geranylgeranyl diphosphate synthase (geranylgeranyltransferase) of Haematococcus lacustris. diphosphatesynthase, CrtE), lycopene cyclase (CrtB), and β-carotenoid ketolase (CrtW) encoding genes were homologously recombined and integrated into the BS03 genome to obtain the △hepS△hepT△menA-crtE-crtB-crtW strain BS04; Step five, PCR amplification, using the fusion PCR method to homologously recombinantly integrate the Corynebacterium glutamicum phytoene desaturase (CrtI) and phytoene synthase (CrtY) encoding genes into the BS04 genome to obtain the △hepS△hepT△menA-crtE-crtB-crtI-crtY-crtW strain BS05; Step six, using the fusion PCR method to amplify the phytoene desaturase (CrtI) and phytoene synthase (CrtY) encoding genes of Flavobacterium johnsonii johnsoniae) β-carotene hydroxylase (CrtZ) encoding gene was integrated into the BS05 genome by homologous recombination to obtain the △hepS△hepT△menA-crtE-crtB-crtI-crtY-crtW-crtZ strain BS06, which is an engineered bacterium for synthesizing astaxanthin.

[0053] Example 1

[0054] A method for constructing an engineered bacterium for synthesizing astaxanthin is as follows:

[0055] 1. Construction of hepS knockout strain BS01

[0056] (1) Using the genome of Bacillus subtilis 168 as a template, primers hepS-LF (primer 1) and hepS-LR (primer 2), hepS-P7C6-F (primer 3) and hepS-P7C6-R (primer 4), hepS-RF (primer 5) and hepS-RR (primer 6) were used to amplify the left homology arm, chloramphenicol resistance fragment, and right homology arm sequence. Primers 1-6 are shown in Table 1 below.

[0057] Table 1 Primer sequence list

[0058] Primers Sequence (5'-3') serial number hepS-LF TGGAGGACAT AGAAC SEQ ID NO.1 hepS-LR ACTCATAAATATCACCCTTGTCCCCA SEQ ID NO.2 hepS-P7C6-F ATGAGTATGAGTATTCAACATTTCCGT SEQ ID NO.3 hepS-P7C6-R TGTCTTGCATACCAATGCTTAATCAGTGAG SEQ ID NO.4 hepS-RF TGCAAGACATCTACGGAACTTTAGCCA SEQ ID NO.5 hepS-RR AAATCCAAGCCCTTGATCTCG SEQ ID NO.6

[0059] The PCR amplification system for the left and right homology arms was: ddH2O 10uL, whole genome template 0.5uL, upstream and downstream primers 1.0uL each, Primer star 12.5uL. PCR amplification conditions: 98℃ denaturation for 3min, 34 cycles (98℃10s, 55℃5s, 72℃10s), and finally 72℃ extension for 5min.

[0060] The PCR amplification conditions for the intermediate fragment were as follows: denaturation at 98°C for 3 min, 34 cycles (98°C for 10 s, 55°C for 5 s, and 72°C for 15 s), and a final extension at 72°C for 5 min.

[0061] (2) The three gene fragments obtained in step (1) were subjected to overlapping extension PCR. The PCR conditions were: 98°C, 5 min pre-denaturation, followed by 98°C denaturation for 10 s, 55°C annealing for 5 s, and 72°C extension for 32 s, for a total of 34 cycles. The fragments of the correct size were recovered by gel cutting to obtain the fusion gene fragment. The electrophoresis of the PCR product and the recovered fragments by the DNA fragment recovery kit is shown in the figure. Figure 1 shown.

[0062] After the target gene band amplification product was purified, the fusion gene fragment was electroporated into Bacillus subtilis 168 competent cells. After transformants grew on the plate, the transformants were picked for liquid culture. PCR bacterial liquid was used to verify the △hepS strain. In order to avoid the influence of multiple resistance markers, the resistance markers were eliminated using the Cre / lox system before the next round of gene overexpression, which was the strain BS01.

[0063] 2. Construction of hepT knockout strain BS02

[0064] (1) Using the genome of Bacillus subtilis BS01 as a template, primers hepT-LF (primer 7) and hepT-LR (primer 8), hepT-P7C6-F (primer 9) and hepT-P7C6-R (primer 10), hepT-RF (primer 11) and hepT-RR (primer 12) were used to amplify the left homology arm, chloramphenicol resistance fragment, and right homology arm sequence. Primers 7-12 are shown in Table 2 below.

[0065] Table 2 Primer sequence list

[0066] Primers Sequence (5'-3') serial number hepT-LF CGTTCTTTCAAGGACGAAAACGA SEQ ID NO.7 hepT-LR AATACTCATTTTTCAGGCCCGCCTCTTCAA SEQ ID NO.8 hepT-P7C6-F TTTTCAGGCCCGATGAGTATTCAACATTTCCGTGTCGCCC SEQ ID NO.9 hepT-P7C6-R TACCAATGCTTAATCAGTGAGGTCCTTGAAAGAACG SEQ ID NO.10 hepT-RF TAAGCATTGGTAGTCCTTGAAAGAACG SEQ ID NO.11 hepT-RR TGATCGTCATTCTGTCCAATG SEQ ID NO.12

[0067] The PCR amplification system for the left and right homology arms was: ddH2O 10uL, whole genome template 0.5uL, upstream and downstream primers 1.0uL each, Primer star 12.5uL. PCR amplification conditions: 98℃ denaturation for 3min, 34 cycles (98℃10s, 55℃5s, 72℃10s), and finally 72℃ extension for 5min.

[0068] The PCR amplification conditions for the intermediate fragment were as follows: denaturation at 98°C for 3 min, 34 cycles (98°C for 10 s, 55°C for 5 s, and 72°C for 15 s), and a final extension at 72°C for 5 min.

[0069] (2) The three gene fragments obtained in step (1) were subjected to overlapping extension PCR. The PCR conditions were: 98°C, 5 min pre-denaturation, followed by 98°C denaturation for 10 s, 55°C annealing for 5 s, and 72°C extension for 32 s, for a total of 34 cycles. The fragments of the correct size were recovered by gel cutting to obtain the fusion gene fragment. The electrophoresis of the PCR product and the recovered fragments by the DNA fragment recovery kit is shown in the figure. Figure 2 shown.

[0070] After the target gene band amplification product was purified, the fusion gene fragment was electroporated into BS01 competent cells. After transformants grew on the plate, the transformants were picked for liquid culture. PCR bacterial liquid was used to verify the △hepT strain. In order to avoid the influence of multiple resistance markers, the resistance markers were eliminated using the Cre / lox system before the next round of gene overexpression, which was the strain BS02.

[0071] 3. Construction of menA knockout strain BS03

[0072] (1) Using the genome of Bacillus subtilis BS02 as a template, primers menA-LF (primer 13) and menA-LR (primer 14), menA-P7C6-F (primer 15) and menA-P7C6-R (primer 16), menA-RF (primer 17) and menA-RR (primer 18) were used to amplify the left homology arm, chloramphenicol resistance fragment, and right homology arm sequence. Primers 13-18 are shown in Table 3 below.

[0073] Table 3 Primer sequence list

[0074] Primers Sequence (5'-3') serial number menA-LF TAAAAAAGACCGCTCGTTTCA SEQ ID NO.13 menA-LR CAACTTCTTCTGCGGAAACAGAAGAAGTTG SEQ ID NO.14 menA-P7C6-F CTGTTTCCGCGGAAACAGAAGAAGTTG SEQ ID NO.15 menA-P7C6-R TTTGGTTCATACCAATGCTTAATCAGT SEQ ID NO.16 menA-RF CTTGGATTTTGAACCAAACAAATAAGGGTG SEQ ID NO.17 menA-RR ATTTTTTTACAAAATGCGGTCGATTGTAAC SEQ ID NO.18

[0075] The PCR amplification system for the left and right homology arms was: ddH2O 10uL, whole genome template 0.5uL, upstream and downstream primers 1.0uL each, Primer star 12.5uL. PCR amplification conditions: 98℃ denaturation for 3min, 34 cycles (98℃10s, 55℃5s, 72℃10s), and finally 72℃ extension for 5min.

[0076] The PCR amplification conditions for the intermediate fragment were as follows: denaturation at 98°C for 3 min, 34 cycles (98°C for 10 s, 55°C for 5 s, and 72°C for 15 s), and a final extension at 72°C for 5 min.

[0077] (2) The three gene fragments obtained in step (1) were subjected to overlapping extension PCR. The PCR conditions were: 98°C, 5 min pre-denaturation, followed by 98°C denaturation for 10 s, 55°C annealing for 5 s, and 72°C extension for 32 s, for a total of 34 cycles. The fragments of the correct size were recovered by gel cutting to obtain the fusion gene fragment. The electrophoresis of the PCR product and the recovered fragments by the DNA fragment recovery kit is shown in the figure. Figure 3 shown.

[0078] After the target gene band amplification product was purified, the fusion gene fragment was electroporated into BS02 competent cells. After transformants grew on the plate, the transformants were picked for liquid culture. PCR bacterial liquid was used to verify the △menA strain. In order to avoid the influence of multiple resistance markers, the resistance markers were eliminated using the Cre / lox system before the next round of gene overexpression, resulting in strain BS03.

[0079] 4. Construction of crtE-crtB-crtW heterologous expression strain BS04

[0080] (1) Using the genome of Haematococcus pluvialis as a template, primers crtE-F (primer 19) and crtE-R (primer 20), crtB-F (primer 21) and crtB--R (primer 22), crtW-F (primer 23) and crtW-R (primer 24), crtE-P7C6-F (primer 25) and crtE-P7C6-R (primer 26) were used to amplify the crtE-crtB-crtW plus chloramphenicol resistance fragment. Primers 19-26 are shown in Table 4 below.

[0081] Table 4 Primer sequence list

[0082] Primers Sequence (5'-3') serial number crtE-F ATGATCCGAGCGATGCACAACCGGGCG SEQ ID NO.19 crtE-R CAGCGGCGACAACATTCAGTTCTTGCGGTACCCTATGAG SEQ ID NO.20 crtB-F AAGAACATGTTGTCGCCGCTGCAGAGACTG SEQ ID NO.21 crtB-R CTACTTGATCATGGCTGGCGG SEQ ID NO.22 crtW-F ATCAAGTAGATGCCATCCGAGTCGTCAGACGCAG SEQ ID NO.23 crtW-R AATACTCATATGGAACGCCCCCCGATCATCATGA SEQ ID NO.24 crtW-P7C6-F ATGAGTATTCAACATTTCCGTGTCGCC SEQ ID NO.25 crtW-P7C6-R TACCAATGCTTAATCAGTGAGGCACCTATCTCAGCG SEQ ID NO.26

[0083] The PCR amplification system for the left and right homology arms was: ddH2O 10uL, whole genome template 0.5uL, upstream and downstream primers 1.0uL each, Primer star 12.5uL. PCR amplification conditions: 98℃ denaturation for 3min, 34 cycles (98℃10s, 55℃5s, 72℃10s), and finally 72℃ extension for 5min.

[0084] The PCR amplification conditions for the intermediate fragment were as follows: denaturation at 98°C for 3 min, 34 cycles (98°C for 10 s, 55°C for 5 s, and 72°C for 15 s), and a final extension at 72°C for 5 min.

[0085] (2) The gene fragment obtained in step (1) was subjected to overlap extension PCR. The PCR conditions were: 98°C, 5 min pre-denaturation, followed by 98°C denaturation for 10 s, 55°C annealing for 5 s, and 72°C extension for 32 s, for a total of 34 cycles. The fragments of the correct size were recovered by gel excision to obtain the fusion gene fragment. The electrophoresis of the PCR product and the recovered fragments by the DNA fragment recovery kit is shown in the figure below. Figure 4 shown.

[0086] After the target gene band amplification product was purified, the fusion gene fragment was electroporated into Bacillus subtilis BS03 competent cells. After transformants grew on the plate, the transformants were picked for liquid culture. PCR bacterial liquid was used to verify the crtE-crtB-crtW strain of lake red algae. In order to avoid the influence of multiple resistance markers, the resistance markers were eliminated using the Cre / lox system before the next round of gene overexpression, which was the strain BS04.

[0087] 5. Construction of crtI-crtY heterologous expression strain BS05

[0088] (1) Using the genome of Corynebacterium glutamicum as a template, primers crtI-F (primer 27) and crtI-R (primer 28), crtI-F (primer 29) and crtI-R (primer 30), crtY-P7C6-F (primer 31) and crtY-P7C6-R (primer 32) were used to amplify the crtI-crtY plus chloramphenicol resistance fragment. Primers 27-32 are shown in Table 5 below.

[0089] Table 5 Primer sequence list

[0090] Primers Sequence (5'-3') serial number crtI-F ATGAAGACATCAACTACAACTCCA SEQ ID NO.27 crtI-R TTAATGATCGTATGAGGTCTTTTGA SEQ ID NO.28 crtY-F TCATCGCGAATTCTTTCTGTAGATG SEQ ID NO.29 crtY CACACCAAAATTCGCCTCTCTTTC SEQ ID NO.30 crtY-P7C6-F ATGAGTATTCAACATTTCCGTGTCG SEQ ID NO.31 crtY-P7C6-R TACCAATGCTTAATCAGTGAGGCACCTATC SEQ ID NO.32

[0091] The PCR amplification system for the left and right homology arms was: ddH2O 10uL, whole genome template 0.5uL, upstream and downstream primers 1.0uL each, Primer star 12.5uL. PCR amplification conditions: 98℃ denaturation for 3min, 34 cycles (98℃10s, 55℃5s, 72℃10s), and finally 72℃ extension for 5min.

[0092] The PCR amplification conditions for the intermediate fragment were as follows: denaturation at 98°C for 3 min, 34 cycles (98°C for 10 s, 55°C for 5 s, and 72°C for 15 s), and a final extension at 72°C for 5 min.

[0093] (2) The gene fragment obtained in step (1) was subjected to overlap extension PCR. The PCR conditions were: 98°C, 5 min pre-denaturation, followed by 98°C denaturation for 10 s, 55°C annealing for 5 s, and 72°C extension for 32 s, for a total of 34 cycles. The fragments of the correct size were recovered by gel excision to obtain the fusion gene fragment. The electrophoresis of the PCR product and the recovered fragments by the DNA fragment recovery kit is shown in the figure below. Figure 5 shown.

[0094] After the target gene band amplification product was purified, the fusion gene fragment was electroporated into Bacillus subtilis BS04 competent cells. After transformants grew on the plate, the transformants were picked for liquid culture. PCR bacterial liquid verification was used to obtain the crtI-crtY strain of Corynebacterium glutamicum. In order to avoid the influence of multiple resistance markers, the resistance markers were eliminated using the Cre / lox system before the next round of gene overexpression, resulting in strain BS05.

[0095] 6. Construction of crtZ heterologous expression strain BS06

[0096] (1) Using the genome of F. johnsonii as a template, primers crtZ-F (primer 33) and crtZ-R (primer 34), crtZ-P7C6-F (primer 35) and crtZ-P7C6-R (primer 36) were used to amplify the crtZ plus chloramphenicol resistance fragment. Primers 33-36 are shown in Table 6 below.

[0097] Table 6 Primer sequence list

[0098] Primers Sequence (5'-3') serial number crtZ-F ATGATTTCTTTTTTAATTTTTATA SEQ ID NO.33 crtZ-R TTACATTTTATAATACTTAAATGG SEQ ID NO.34 crtZ-P7C6-F ATGAGTATTCAACATTTCCGTGTCG SEQ ID NO.35 crtZ-P7C6-R TACCAATGCTTAATCAGTGAGGCACCTATC SEQ ID NO.36

[0099] The PCR amplification system for the left and right homology arms was: ddH2O 10uL, whole genome template 0.5uL, upstream and downstream primers 1.0uL each, Primer star 12.5uL. PCR amplification conditions: 98℃ denaturation for 3min, 34 cycles (98℃10s, 55℃5s, 72℃10s), and finally 72℃ extension for 5min.

[0100] The PCR amplification conditions for the intermediate fragment were as follows: denaturation at 98°C for 3 min, 34 cycles (98°C for 10 s, 55°C for 5 s, and 72°C for 15 s), and a final extension at 72°C for 5 min.

[0101] (2) The gene fragment obtained in step (1) was subjected to overlap extension PCR. The PCR conditions were: 98°C, 5 min pre-denaturation, followed by 98°C denaturation for 10 s, 55°C annealing for 5 s, and 72°C extension for 32 s, for a total of 34 cycles. The fragments of the correct size were recovered by gel excision to obtain the fusion gene fragment. The electrophoresis of the PCR product and the recovered fragments by the DNA fragment recovery kit is shown in the figure below. Figure 6 shown.

[0102] After the target gene band amplification product was purified, the fusion gene fragment was electroporated into the competent cells of Bacillus subtilis BS05. After the transformants grew on the plate, the transformants were picked for liquid culture, and the PCR bacterial solution was verified to obtain the Johnson bacterium crtZ strain. In order to avoid the influence of multiple resistance markers, the Cre / lox system was used to eliminate the resistance markers before the next round of gene overexpression, that is, strain BS06.

[0103] Cultivation of original bacteria and mutant strains and determination of astaxanthin production

[0104] Bacillus subtilis 168 and the recombinant bacteria BS01-BS06 were inoculated into the seed culture medium. Seed culture medium formula: beef extract 5g·L -1 , peptone 10 g·L -1 , sodium chloride 5g·L -1 The Bacillus subtilis seed solution was obtained by culturing at 37°C and 220 rpm for 18 h.

[0105] The obtained seed liquid was transferred into the fermentation medium at a 5% inoculum. Fermentation medium formula: glucose 10g·L -1 , yeast extract 10g·L -1 , KH2PO4 18g·L -1 , K2SO4 1.5g·L -1, ammonium chloride 0.5 g·L -1 , sodium citrate 0.2 g·L -1 , MgSO4·7H2O 3.24g·L -1 , leucine 1g·L -1 , Histidine 1g·L -1 , trace element A 20mL·L -1 , trace element B 24mL·L -1 .

[0106] Trace element A: ZnSO4·7H2O 5.75g·L -1 , MnC12·4H2O 0.32g·L -1 , CoC12·6H2O0.47g·L -1 , NaMoO4·2H2O 0.48g·L -1 , CaC12·2H2O 2.9g·L -1 , FeSO4·7H2O 2.8g·L -1 , 80 mL of 0.5 M EDTA, add NaOH while stirring to adjust the pH to 8.0, and store in a -20°C refrigerator.

[0107] Trace elements B (g·L -1 ): biotin 0.05, calcium pantothenate 1, nicotinic acid 1, myo-inositol 25, thiamine HCl 1, pyridoxal HCl 1, ρ-aminobenzoic acid 0.02, stored in a -20℃ refrigerator.

[0108] The Bacillus subtilis fermentation broth was obtained by culturing at 37°C and 220 rpm for 72 hours. The content of astaxanthin in the fermentation broth was detected by high performance liquid chromatography.

[0109] The method for determining astaxanthin content by HPLC is as follows:

[0110] Accurately weigh 10 mg of astaxanthin standard, dissolve it with a small amount of dichloromethane, and then dilute it to a 100 mL brown volumetric flask with methanol to make a 0.1 mg / mL solution. Accurately measure an appropriate amount of the above solution and dilute it with methanol to make 1.0, 2.0, 3.0, 4.0, and 5.0 mg / L astaxanthin standard solutions.

[0111] Take 6 25mL brown volumetric flasks, transfer different concentrations of astaxanthin standard solutions and methanol as a blank control into each flask, shake well, and prepare a standard curve of the correspondence between astaxanthin content and peak area after high performance liquid chromatography detection.

[0112] Take 0.5 mL of the fermentation broth of each strain, add an equal volume of methanol, shake in an oscillator for 1 min to fully extract the flavonoid components of the fermentation broth, and filter through a 0.22 μm nylon filter membrane for HPLC detection.

[0113] The analysis was performed using a Shimadzu LC-20AT high performance liquid chromatograph, with an Ecosil reverse phase C18 column (4.6 mm × 250 mm); mobile phases: A and B, wherein A was dichloromethane:methanol:acetonitrile:water (5.0:85.0:5.5:4.5), and B was dichloromethane:methanol:acetonitrile:water (22.0:28.0:45.5:4.5); gradient elution: 0% B for 3 min, 0% to 100% B for 5 min; flow rate 0.8 mL / min; column temperature 30°C; detector: DAD, i.e., diode array detector; injection volume 5 μL; detection wavelength 470 nm.

[0114] Figure 7 B is the HPLC chromatogram of BS06 fermentation broth. Figure 7 A) By comparison, the retention time of trans-astaxanthin in BS06 is 3.4 min, and that of cis-astaxanthin is 4.4 min and 4.8 min. Since the peak area (mAU*s) of astaxanthin is 2743011, combined with the astaxanthin standard curve (see Figure 8 ), it can be seen that BS06 contains 27 mg / L of astaxanthin.

[0115] Table 7 The yield of astaxanthin synthesized by each strain

[0116] strains Astaxanthin production (mg / L) Bacillus subtilis 168 (original strain) 0±0.18 BS01 0±0.11 BS02 0±0.13 BS03 0±0.12 BS04 0±0.16 BS05 0±0.21 BS06 27±0.45

[0117] The test results of astaxanthin synthesis by the original bacteria and each mutant strain are shown in Table 7. As can be seen from Table 7, the original strain and the knockout of hepT, hepS, menA, and the heterologous expression of crtE, crtB, crtI, crtY, and crtW cannot achieve the biosynthesis of astaxanthin in the Bacillus subtilis system. However, when crtZ was heterologously expressed on the basis of the knockout of hepT, hepS, menA, and the heterologous expression of crtE, crtB, crtI, crtY, and crtW, obvious astaxanthin synthesis occurred. After high-performance liquid chromatography detection, astaxanthin reached 27±0.45mg / L, realizing the transition of astaxanthin synthesis from 0 to 1 in Bacillus subtilis.

[0118] Those skilled in the art should understand that the discussion of any of the above embodiments is only exemplary and is not intended to imply that the scope of the present invention is limited to these examples; under the concept of the present invention, the technical features in the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other changes in different aspects of the present invention as described above, which are not provided in detail for the sake of simplicity. Any omissions, modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for constructing an engineered bacterium for synthesizing astaxanthin, characterized in that: The steps include: Step 1, knocking out the hepS gene in Bacillus subtilis 168 to construct the △hepS strain BS01; Step 2: Knock out the hepT gene in BS01 to obtain the △hepS△hepT strain BS02; Step 3, knocking out the menA gene in BS02 to obtain the △hepS△hepT△menA strain BS03; Step 4: The crtE, crtB, and crtW genes of Haematococcus lacustrine were homologously recombined and integrated into the genome of BS03 by fusion PCR to obtain the △hepS△hepT△menA-crtE-crtB-crtW strain BS04; Step 5: Use fusion PCR to homologously recombinantly integrate crtI and crtY genes of Corynebacterium glutamicum into the BS04 genome to obtain △hepS△hepT△menA-crtE-crtB-crtIP 43 -crtY-crtW strain BS05; Step 6: Use the fusion PCR method to homologously recombine the crtZ gene of Flavobacterium johnsonii into the BS05 genome to construct the △hepS△hepT△menA-crtE-crtB-crtI-crtY-crtW-crtZ strain BS06, which is the engineered bacteria for synthesizing astaxanthin.

2. The method for constructing an engineered bacterium for synthesizing astaxanthin according to claim 1, characterized in that: The method for constructing the △hepS strain BS01 in step 1 comprises the following steps: A1. Using the genome of Bacillus subtilis 168 as a template, the primer set shown in SEQ ID NO.1-6 was used to amplify the left homology arm, the middle fragment and the right homology arm sequence; A2, performing overlap extension PCR on the obtained left homology arm, middle fragment and right homology arm sequences to obtain fusion gene fragment A; A3. After the amplified product was purified, the fusion gene fragment A was electroporated into competent cells of Bacillus subtilis 168 to obtain strain BS01.

3. The method for constructing an engineered bacterium for synthesizing astaxanthin according to claim 1, characterized in that: The method for obtaining the ΔhepS ΔhepT strain BS02 in step 2 comprises the following steps: B1, using BS01 genome as template, using primer set as shown in SEQ ID NO.7-12 to amplify the left homology arm, middle fragment and right homology arm sequence; B2, performing overlap extension PCR on the obtained left homology arm, middle fragment and right homology arm sequences to obtain fusion gene fragment B; B3. After the amplified product is purified, the fusion gene fragment B is electroporated into BS01 competent cells to obtain strain BS02.

4. The method for constructing an engineering bacterium for synthesizing astaxanthin according to claim 1, characterized in that: Step 3: The method for obtaining △hepS△hepT△menA strain BS03 comprises the following steps: C1, using BS02 genome as template, using primer set as shown in SEQ ID NO.13-18 to amplify the left homology arm, middle fragment and right homology arm sequence; C2, performing overlap extension PCR on the obtained left homology arm, middle fragment and right homology arm sequences to obtain fusion gene fragment C; C3. After the amplified product is purified, the fusion gene fragment C is electroporated into BS02 competent cells to obtain strain BS02.

5. The method for constructing an engineered bacterium for synthesizing astaxanthin according to claim 1, characterized in that: Step 4: The method for obtaining the △hepS△hepT△menA-crtE-crtB-crtW strain BS04 comprises the following steps: D1, using the lake Haematococcus genome as a template, using the primer set shown in SEQ ID NO.19-26 to amplify crtE-crtB-crtW and the middle fragment; D2, performing overlap extension PCR on the obtained crtE-crtB-crtW and the middle fragment to obtain the fusion gene fragment D; D3. After the amplified product is purified, the fusion gene fragment D is electroporated into BS03 competent cells to obtain strain BS04.

6. The method for constructing an engineered bacterium for synthesizing astaxanthin according to claim 1, characterized in that: Step 5: Obtain △hepS△hepT△menA-crtE-crtB-crtIP 43 The method of the -crtY-crtW strain BS05 comprises the following steps: E1. Using the genome of Corynebacterium glutamicum as a template, amplify the crtI-crtY and the intermediate fragment using the primer set shown in SEQ ID NO.27-32; E2, performing overlap extension PCR on the obtained crtI-crtY and the middle fragment to obtain the fusion gene fragment E; E3. After the amplified product is purified, the fusion gene fragment E is electroporated into BS04 competent cells to obtain strain BS05.

7. The method for constructing an engineered bacterium for synthesizing astaxanthin according to claim 1, characterized in that: The method for constructing the △hepS△hepT△menA-crtE-crtB-crtI-crtY-crtW-crtZ strain BS06 comprises the following steps: F1, using the genome of Flavobacterium johnsonii as a template, using the primer set shown in SEQ ID NO.33-36 to amplify crtZ and the intermediate fragment; F2, overlap extension PCR was performed on the obtained crtZ and the middle fragment to obtain the fusion gene fragment F; F3. After the amplified product is purified, the fusion gene fragment F is electroporated into BS05 competent cells to obtain strain BS06.

8. An engineered bacterium for synthesizing astaxanthin, characterized in that: The method is constructed by any one of claims 1 to 7.

9. The engineered bacteria for synthesizing astaxanthin according to claim 9, characterized in that: The engineered bacteria used for synthesizing astaxanthin are subjected to seed culture and fermentation culture in sequence to obtain a fermentation liquid containing astaxanthin.

Images