Primer probe and kit for detecting Mycobacterium leprosy, and use method and application of primer probe and kit for detecting Mycobacterium leprosy

Abstract

The invention discloses a primer probe, a kit, a use method and application for detecting mycobacterium leprosy, the primer probe at least comprises a primer probe pair for detecting the mycobacterium leprosy, the nucleotide sequence MF-F of a forward primer is as shown in SEQ ID NO.1, the nucleotide sequence MF-F of a reverse primer is as shown in SEQ ID NO.2, and the nucleotide sequence MF-F of a reverse primer is as shown in SEQ ID NO.3. The nucleotide sequence MF-R of the reverse primer is as shown in SEQ ID NO. 2; and the nucleotide sequence MF-P of the primer probe is as shown in SEQ ID NO. 3. According to the scheme provided by the invention, the nucleic acid of the mycobacterium leprosy in the human nasal swab specimen is detected based on a multiplex fluorescent PCR technology, and the infection risk of a leprosy patient without disability or a suspected leprosy patient can be quickly predicted in the early stage, so that the diagnosis accuracy is helped, timely intervention or treatment is given, and the risk of infection is reduced. The spreading of diseases and the occurrence of disability are effectively prevented.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a primer probe, a kit, a use method and an application for detecting Mycobacterium leprae. Background Art

[0002] Leprosy, also known as Hansen's disease, is a chronic infectious disease caused by a bacterium called Mycobacterium leprae. The disease affects the skin, peripheral nerves, upper respiratory tract mucosa and eyes, and can cause progressive and permanent damage to the skin, nerves, limbs and eyes, leading to disability.

[0003] Leprosy is a neglected tropical disease (NTD). In 2019, more than 200,000 new leprosy patients were diagnosed worldwide, with more than 120 countries reporting cases (including non-local cases), 80% of which were newly diagnosed in India, Brazil and Indonesia. At present, the prevalence of leprosy in most parts of my country has been significantly controlled, but it still spreads to a certain extent in some remote rural areas. As of the end of 2022, there are still 46 counties (cities and districts) in the country with a leprosy prevalence rate greater than 1 / 100,000; in 2022, 194 counties (cities and districts) reported local new leprosy cases, and some areas are at risk of epidemic fluctuations or rebounds. Due to the long incubation period after infection with Mycobacterium leprae and the lack of obvious early symptoms, most patients can only be discovered clinically after severe limb deformities occur.

[0004] Early diagnosis and treatment of leprosy can effectively prevent disability. However, accurate diagnosis of leprosy remains a challenge. Currently, the diagnosis of leprosy is made clinically by finding at least one of the following main signs: (1) pale (hypopigmented) or reddish skin patches with obvious sensory loss; (2) thickening or enlargement of peripheral nerves, accompanied by sensory loss and / or weakness of the muscles innervated by these nerves; (3) skin smear examination (Ziehl-Neelsen acid-fast staining). Traditional skin smear examination is economical and rapid, but has low sensitivity and specificity, and an experienced physician is required to make a definitive diagnosis of leprosy in combination with clinical and pathological features. Respiratory transmission is the main route of infection with Mycobacterium leprae. Therefore, it is necessary to develop a non-invasive detection kit for the detection of Mycobacterium leprae nucleic acid in human nasal swabs.

[0005] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention

[0006] The purpose of the present invention is to provide a primer probe, a kit, a method of use and an application for detecting Mycobacterium leprae, which can detect Mycobacterium leprae nucleic acid in human nasal swab specimens based on multiplex fluorescence PCR technology, and can quickly predict the infection risk of leprosy patients who have not developed disability or patients suspected of leprosy in the early stage, thereby helping to improve the accuracy of diagnosis and confirmation, provide timely intervention or treatment, and effectively prevent the spread of the disease and the occurrence of disability.

[0007] In order to achieve the above object, a technical solution provided by a specific embodiment of the present invention is as follows:

[0008] The primer probe for detecting Mycobacterium leprae comprises at least a primer probe pair for detecting Mycobacterium leprae, wherein:

[0009] The nucleotide sequence of the forward primer MF-F is shown in SEQ ID NO.1;

[0010] The nucleotide sequence of the reverse primer MF-R is shown in SEQ ID NO.2;

[0011] The nucleotide sequence of the primer probe MF-P is shown in SEQ ID NO.3.

[0012] In one or more embodiments of the present invention, a primer probe pair for detecting the human internal reference gene RnaseP is also included, wherein:

[0013] The nucleotide sequence of the forward primer RnaseP-F is shown in SEQ ID NO.4;

[0014] The reverse primer nucleotide sequence RnaseP-R is shown in SEQ ID NO.5;

[0015] The nucleotide sequence of the primer probe RnaseP-P is shown in SEQ ID NO.6.

[0016] In one or more embodiments of the present invention, the 3' end and / or 5' end of the primer probe nucleotide sequence MF-P and / or the primer probe nucleotide sequence RnaseP-P are also connected to a fluorescent group, and both the 3' end and the 5' end are connected to fluorescent groups, and the fluorescent groups at both ends may be different.

[0017] In one or more embodiments of the present invention, the fluorescent group is selected from FAM, BHQ1, VIC, CY5, BHQ3, ROX, and BHQ2.

[0018] In one or more embodiments of the present invention, in a kit for detecting Mycobacterium leprae, the total concentration of the forward primer nucleotide sequence MF-F and the reverse primer nucleotide sequence MF-R in the primer probe pair for detecting Mycobacterium leprae in the kit is 12 μM, and the concentration of the primer probe nucleotide sequence MF-P is 6 μM.

[0019] In one or more embodiments of the present invention, the total concentration of the forward primer nucleotide sequence RnaseP-F and the reverse primer nucleotide sequence RnaseP-R for detecting the human internal reference gene RnaseP in the kit is 6 μM, and the concentration of the primer probe nucleotide sequence RnaseP-P is 3 μM.

[0020] In one or more embodiments of the present invention, the method for using the kit for detecting Mycobacterium leprae comprises the following steps:

[0021] S1. Extraction of genomic DNA to be tested from samples;

[0022] S2. Using the kit, perform fluorescence quantitative amplification detection on the genomic DNA.

[0023] In one or more embodiments of the present invention, the reaction conditions of the fluorescence quantitative amplification described in S2 are as follows:

[0024]

[0025] In one or more embodiments of the present invention, the sample is selected from a human nasal swab specimen.

[0026] In one or more embodiments of the present invention, a kit for detecting Mycobacterium leprae is used in early risk assessment of infection in a population infected with Mycobacterium leprae.

[0027] Compared with the prior art, the primer probe, kit, method of use and application of the Mycobacterium leprae detection of the present invention have the advantages of non-invasiveness, simple operation, high accuracy, high sensitivity, fast speed, high throughput and low cost, etc., and detect Mycobacterium leprae nucleic acid in human nasal swab specimens based on multiple fluorescence PCR technology, which can quickly predict the infection risk of leprosy patients who have not developed disability or suspected leprosy patients in the early stage, thereby helping to improve the accuracy of diagnosis and diagnosis, provide timely intervention or treatment, and effectively prevent the spread of the disease and the occurrence of risks such as disability. And this kit also includes an endogenous internal standard detection system for monitoring the specimen collection, nucleic acid extraction process and PCR amplification process, which can reduce the occurrence of false negative results. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0029] Figure 1These are the test results of the kit in one embodiment of the present invention on 8 leprosy sensitivity standard products, from left to right: 10^6 copies / 10μL, 10^5 copies / 10μL, 10^4 copies / 10μL, 10^3 copies / 10μL, 10^2 copies / 10μL, 10 copies / 10μL, 5 copies / 10μL, and 1 copy / 10μL. DETAILED DESCRIPTION

[0030] In order to enable those skilled in the art to better understand the technical solutions in the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0031] Embodiment 1:

[0032] The preparation of specific PCR primers and fluorescent probes for detecting Mycobacterium leprae includes the following steps:

[0033] 1. Sequence acquisition: The source of the gene sequence used is NCBI (National Center for Biotechnology Information)

[0034] 2. Design method:

[0035] 2.1 According to the reference genome sequence of Mycobacterium leprae and the human reference genome sequence published in the NCBI database, a specific region was selected, which included the leprosy-specific high-copy sequence and the human internal reference gene RNaseP sequence, for designing appropriate primers and probes. The sequence information obtained by screening is as follows:

[0036] SEQ ID NO.7-leprosy-specific high copy sequence:

[0037] GGGCACCTGGGCTGTGCTGAAGGCGATATCGATGCAGGCGTGAGTGTGAGGATAGTTGTTAGCGCCGC

[0038] GGGGTAGGGGCGTTTTAGTGTGCATGTCATGGCCTTGAGGTGTCGGCGTGGTCAATGTGGCCGCACCT

[0039] GAACAGGCACGTCCCCGTGCACGGTATAACTATTCGCACCTGATGTTATCCCTTGCACCATTTCTGCC

[0040] GCTGGTATCGGTGTCGGCGGCTTGTTGACCGGCCCTCAGCCAGCAAGCAGGCATGCCGCCGGGTGCAG

[0041] CAGTATCGTGTTAGTGAACAGTGCATCGATGATCCGGCCGTCGGCGGCACATACGGCAACCTMycobacteriμM leprae Kyoto-2 DNA,Sequence ID:AP014567.1

[0042] SEQ ID NO.8-human RNaseP gene:

[0043] AGTCAACTGGAGGTAGAGACGGACTGCGCAGGTTAACTACAGCTCCCAGCATGCCTGAGGGGCGGGCT

[0044] CAGCGGCTGCGCAGACTGGCGCGCGCGGACGGTCATGGGACTTCAGCATGGCGGTGTTTGCAGATTTG

[0045] GACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACCGTGAGTT

[0046] GCCCCGGCTTCGCGCCTGGCCAACCTCATGCCACCCAGACCATCGGGCCACACTCCGGAGTAACTATT

[0047] TCCTGATGGGTCTCGGTCAGGTCTCCCAGHμMan(GRCh37 / hg19)

[0048] 2.2 Design of primers and primers using PrimerExpress3.0:

[0049] Taqman probe design principles:

[0050] Prioritize probe location;

[0051] The first base at the 5' end of the probe cannot be G;

[0052] Gene expression probe Tm value: 68-70C; genotyping probe Tm value: 65-67C;

[0053] The length of TaqMan probe is 13-30 bp, and the length of TaqMan-MGB probe is 13-25 bp;

[0054] Avoid too many repetitions of the same base, especially 4 or more consecutive Gs;

[0055] Probes with more C than G work better. If there are fewer Cs than Gs, the complementary strand is selected.

[0056] The polymorphic site should be located in the center of the probe as much as possible, and can be ±3 bases;

[0057] Primer design principles:

[0058] The primer should be as close as possible to the probe, but should not overlap with the probe.

[0059] Primer length is 9-40 bp, with an optimal value of 20 bp, and the GC content is maintained between 30-80%;

[0060] Avoid too many repetitions of the same base, especially 4 or more consecutive Gs;

[0061] Primer Tm value is between 58-60C, and the Tm of upstream and downstream primers should not exceed 2C;

[0062] ·In the 5 bases at the 3' end of the primer, the total number of G and C should not exceed 2;

[0063] The 3' end of the primer should not be base A, and more than 3 identical bases should be avoided;

[0064] Avoid forming 4 or more consecutive pairs between primers or between primers;

[0065] Avoid the primers from forming a circular hairpin structure;

[0066] The length of the amplified fragment is between 50-500 bp;

[0067] The primer and probe sequence information designed by PrimerExpress3.0 are shown in Tables 1-1 and 1-2:

[0068] Table 1-1 Specific PCR primers and probe sequences

[0069]

[0070] Table 1-2 Sequence table of specific PCR primers and probes with fluorescent groups introduced into the ends of primers and probes

[0071]

[0072]

[0073] 3. The obtained sequence was commissioned to be synthesized by Integrated DNA Technologies (IDT) of the United States.

[0074] Example 2

[0075] Verification of experimental method accuracy

[0076] 1. Materials: 10 accuracy reference samples, consisting of 4 Mycobacterium leprae genomic DNA, 2 Mycobacterium tuberculosis genomic DNA, 2 Mycobacterium marinum genomic DNA, and 2 Mycobacterium kansasii genomic DNA;

[0077] 2. Method: The above-mentioned genomic DNA was detected using the above-mentioned Mycobacterium leprae detection kit. The specific PCR primers and fluorescent probes used for Mycobacterium leprae detection in the kit were prepared in Example 1.

[0078] A. Sample preparation: Four samples of Mycobacterium leprae genomic DNA were provided by the Institute of Dermatology, Chinese Academy of Medical Sciences. The Mycobacterium tuberculosis genomic DNA, Mycobacterium marinum genomic DNA, and Mycobacterium kansasii genomic DNA were developed by the Henan Industrial Microbial Strain Engineering Technology Research Center and purchased for future use.

[0079] B. Prepare the leprosy bacillus detection amplification reaction solution according to Table 2, vortex mix, and centrifuge instantaneously;

[0080] Table 2 Configuration of reaction solution for detection and amplification of Bacillaceae

[0081] Components Each reaction / μL Samples to be tested 10.0 MFPCR reaction solution 16.8 MF enzyme mixture 0.8 MF test fluid 2.4 Total volume 30μL

[0082] C. Place the amplification reaction solution in the MA6000 fluorescence quantitative PCR instrument, set the following probe detection mode, and run the fluorescence quantitative detection reaction conditions according to Table 3:

[0083] Probe detection mode:

[0084] Marker 1: FAM, target gene 1: MF;

[0085] Marker 3: CY5, target gene 4: RNaseP;

[0086] Table 3 Fluorescence quantitative detection reaction conditions

[0087]

[0088] D. Result analysis: There were fluorescence signals in the FAM fluorescence channels of P1, P2, P3, and P4 wells, indicating that Mycobacterium leprae was positive. There were no fluorescence signals in the FAM fluorescence channels of J1, J2, H1, H2, K1, and K2 wells, indicating that Mycobacterium leprae was negative. The accuracy of the test result was 100%. At the same time, it was proved that this kit had no cross reaction with Mycobacterium tuberculosis, Mycobacterium marinum, Mycobacterium kansasii, etc. The test results are shown in Table 4.

[0089] Table 410 accuracy reference test results

[0090]

[0091]

[0092] 3. Analysis of experimental results: The experimental results show that the kit provided by the present invention can accurately detect Mycobacterium leprae, indicating that the detection method is successfully established.

[0093] Example 3

[0094] Experimental method sensitivity verification

[0095] 1. Materials: Mycobacterium leprae sensitivity standard

[0096] 2. Methods: The Mycobacterium leprae sensitivity standard was tested using the above-mentioned Mycobacterium leprae detection kit. Each standard plate was repeated 3 times. The detection experiment was completed on a MA6000 fluorescence quantitative PCR instrument.

[0097] A. The sensitivity reference was prepared by diluting the artificially synthesized plasmid. The plasmid mother solution was quantified by Qubit4 fluorometer, the copy number was calculated, and the 1xTE solution was diluted in a gradient to obtain 8 sensitivity standards including 10^6 copies / 10μL, 10^5 copies / 10μL, 10^4 copies / 10μL, 10^3 copies / 10μL, 10^2 copies / 10μL, 10 copies / 10μL, 5 copies / 10μL, and 1 copy / 10μL. This plasmid contains the sequence information of the target gene and was commissioned to be synthesized by Jinweizhi Biotechnology Co., Ltd.

[0098] B. The above sensitivity standard was tested, and the test steps and result analysis were the same as in Example 2. The test results were as follows: Figure 1 As shown, the detailed results are shown in Table 5. The detection results show that the kit of the present invention can achieve high-quality stable detection at ≥1 copy / 10μL sample.

[0099] Table 58 Sensitivity Reference Test Results

[0100]

[0101]

[0102]

[0103] Analysis of experimental results: Based on the above-mentioned Mycobacterium leprae detection kit, 8 Mycobacterium leprae sensitivity standards were tested and analyzed. Figure 1 As shown, this kit has excellent linearity and high sensitivity, and the minimum detection limit can reach 1 copy / 10μL.

[0104] Example 4

[0105] Clinical sample validation 1

[0106] 1. Materials: 20 clinical skin lesion tissue specimens with known results

[0107] 2. Methods: The above kit was used to detect 20 clinical skin lesion tissue specimens with known results, and the detection test was completed on a MA6000 fluorescence quantitative PCR instrument.

[0108] A. Use the blood / tissue genomic DNA extraction kit (column method) (SuSu Medical Equipment No. 20231196) to extract nucleic acid from the above-mentioned clinical skin lesion tissue specimens. The extraction steps are carried out according to the product instructions to obtain 50 μL of DNA solution, which is directly tested or temporarily stored at -20°C. At the same time, quality control products are tested.

[0109] B. The detection steps and result analysis were carried out according to Example 2. The detailed results are shown in Table 6.

[0110] Table 6 Test results of 20 clinical specimens

[0111]

[0112]

[0113] Experimental result analysis: According to the above-mentioned kit for detecting Mycobacterium leprae, 20 clinical skin lesion tissues with known results were tested and analyzed. As shown in Table 6, 100% of multibacillary specimens can be detected, and the detection rate of 90% of paucibacillary specimens can be further explained, which further illustrates that the kit of the present invention can simply, quickly and accurately detect and determine Mycobacterium leprae, and meet the application requirements of clinical early diagnosis.

[0114] Example 5

[0115] Clinical sample validation 2

[0116] 3. Materials: Nasal swab specimens from 10 leprosy-infected patients

[0117] 4. Methods: The above kit was used to detect nasal swab specimens from the 10 leprosy-infected patients, and the detection test was completed on a MA6000 fluorescent quantitative PCR instrument.

[0118] A. Use the blood / tissue genomic DNA extraction kit (column method) (Susu Instrument No. 20231196) to extract nucleic acid from the above nasal swab specimens. The extraction steps are carried out according to the product instructions to obtain 50 μL

[0119] DNA solution can be tested directly or stored at -20℃ while quality control products are tested.

[0120] B. The detection steps and result analysis were carried out according to Example 2. The detailed results are shown in Table 7.

[0121] Table 7 Test results of 10 clinical specimens

[0122]

[0123]

[0124] Analysis of experimental results: According to the above-mentioned kit for detecting Mycobacterium leprae, nasal swab specimens of 10 leprosy-infected patients were tested and analyzed. As shown in Table 7, the positive detection rate was 70%, which further illustrates that the kit of the present invention can be used to quickly diagnose leprosy patients who have not developed disability or suspected leprosy patients in the early stage, give timely treatment, effectively prevent the spread of the disease and the occurrence of disability, and meet clinical needs.

[0125] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

[0126] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A primer probe for detecting Mycobacterium leprae, comprising at least a primer probe pair for detecting Mycobacterium leprae, wherein: The nucleotide sequence of the forward primer MF-F is shown in SEQ ID NO.1; The nucleotide sequence of the reverse primer MF-R is shown in SEQ ID NO.2; The nucleotide sequence of the primer probe MF-P is shown in SEQ ID NO.

3.

2. The primer probe for detecting Mycobacterium leprae according to claim 1, characterized in that: Also included is a primer probe pair for detecting the human internal reference gene RnaseP, wherein: The nucleotide sequence of the forward primer RnaseP-F is shown in SEQ ID NO.4; The reverse primer nucleotide sequence RnaseP-R is shown in SEQ ID NO.5; The nucleotide sequence of the primer probe RnaseP-P is shown in SEQ ID NO.

6.

3. The primer probe for detecting Mycobacterium leprae according to claim 1 or 2, characterized in that: The 3' end and / or 5' end of the primer probe nucleotide sequence MF-P and / or the primer probe nucleotide sequence RnaseP-P are also connected to a fluorescent group.

4. The primer probe for detecting Mycobacterium leprae according to claim 3, characterized in that: The fluorescent group is selected from FAM, BHQ1, VIC, CY5, BHQ3, ROX, and BHQ2.

5. A kit for detecting Mycobacterium leprae, characterized in that: At least comprises the primer probe for detecting Mycobacterium leprae according to any one of claims 1-4.

6. The kit for detecting Mycobacterium leprae according to claim 5, characterized in that: The total concentration of the forward primer nucleotide sequence MF-F and the reverse primer nucleotide sequence MF-R in the primer probe pair for detecting Mycobacterium leprae in the kit is 12 μM, and the concentration of the primer probe nucleotide sequence MF-P is 6 μM.

7. The kit for detecting Mycobacterium leprae according to claim 5, characterized in that: The total concentration of the forward primer nucleotide sequence RnaseP-F and the reverse primer nucleotide sequence RnaseP-R for detecting the human internal reference gene RnaseP in the kit is 6 μM, and the concentration of the primer probe nucleotide sequence RnaseP-P is 3 μM.

8. The method for using the kit for detecting Mycobacterium leprae according to any one of claims 5 to 7, characterized in that: The following steps are involved: S1. Extraction of genomic DNA to be tested from samples; S2. Using the kit, perform fluorescence quantitative amplification detection on the genomic DNA.

9. The method of use according to claim 8, characterized in that: The reaction conditions for the fluorescence quantitative amplification described in S2 are as follows:

10. The method of use according to claim 9, characterized in that: The sample is selected from a human nasal swab specimen.

11. Use of the Mycobacterium leprae detection kit according to any one of claims 5 to 7 in determining the early risk of infection in a population infected with Mycobacterium leprae.

Images