Wheat leaf blight real-time fluorescence PCR (polymerase chain reaction) probe primer group, detection kit and application

Abstract

The invention discloses a real-time fluorescent PCR (Polymerase Chain Reaction) probe primer group for wheat leaf blight, a detection kit and application of the real-time fluorescent PCR probe primer group and the detection kit. In particular discloses a wheat leaf blight specific target sequence (SEQ ID No.1) and a primer probe composition (SEQ ID No.2-4) for detecting wheat leaf blight. The invention further discloses a wheat leaf blight nucleic acid rapid detection method based on real-time fluorescent quantitative PCR. Compared with the prior art, the wheat leaf blight specific target sequence (SEQ ID No.1) identified by the invention is more accurate, the wheat leaf blight nucleic acid rapid detection method and the kit thereof developed by aiming at the wheat leaf blight specific target sequence are simple to operate, low in cost and good in specificity, have negative reaction aiming at various similar strains, and are high in sensitivity, and the lowest detection limit is 20pg; and false positive and false negative can be effectively avoided.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the field of detection of plant pathogenic fungi, and specifically relates to a real-time fluorescent PCR probe primer set and a detection kit for wheat leaf blight pathogen and an application thereof. Background Art

[0002] Alternaria triticina Prasada & Prabhu, also known as wheat leaf blight, has a major host population of oats (Avena sativa), barley (Hordeum vulgare), rye (Secale cereale), sesame (Sesamumindicum), triticale (×Triticosecale), wheat (Triticum aestivum), and other Triticum spp. Alternaria triticina causes wheat leaf blight, initially causing small oval, discolored, and scattered lesions. As the lesions enlarge, they become dark brown to gray, irregular in shape, and can reach 1 cm or more in diameter. Some lesions are surrounded by a bright yellow marginal zone. As the disease progresses, several lesions merge to form large spots, leading to the death of the entire leaf. In some cases, once the lesions appear, the leaves begin to dry out prematurely from the tip. In severe cases, similar symptoms can occur on the sheath and stem as well as the awn and stem if the sheath and stem are infected.

[0003] The pathogen is a type of pathogen that is seriously harmful to wheat yield. In severe cases, the damage to wheat yield can reach 60%-75%. As a seed-borne pathogen of wheat and durum wheat, wheat leaf blight pathogens may be introduced together with wheat seeds, agricultural machinery and bulk feed grains, or even accidentally (intentionally or unintentionally as passenger cargo), which can cause serious economic losses. So far, some rapid detection methods for wheat leaf blight pathogens have been established at home and abroad. For example, the current entry-exit inspection and quarantine standard SN / T 4733-2016 quarantine and identification method for wheat leaf blight pathogens uses LJY1 / LJY2 specific primer amplification, sequencing and GenBank similarity (98%-100%) comparison methods to identify wheat leaf blight pathogens. However, through analysis, it was found that the standard did not specify the design principles of LJY1 / LJY2 specific primers. By comparing the similarity of the primer sequences in NCBI, it was found that the species with the highest similarity to the primers was not A. triticina. At the same time, the identification characteristics of this standard "At the same time, the amplification and sequence comparison results of this standard: a fragment of about 520bp was amplified using LJY1 / LJY2 specific primers, and the fragment was sequenced. The sequencing results were compared with the sequences of related strains in GenBank on the NCBI website, and the homology was 98-100%. There are also problems. There are a large number of sequences of Alternaria alternata in GenBank, including misidentified sequences, and the current standard does not clearly define reliable reference sequences. This standard cannot be used for accuracy judgment.

[0004] According to the revised classification system of Alternaria, A. triticina belongs to the Infectoriae group. However, we noticed that there were inconsistencies in the sequences of the type strains of A. triticina (ATCC 36205, CGMCC 3.9868, IMI 289962, EGS17-061, MUCL 44210, ITCC F 1186) published in different articles. For example, the ITS sequence of MUCL 44210 / IMI 289962 / EGS17-061 (AY714476) differed from that of AY762948 (EGS17-061) by 9 nucleotides; the gapdh sequence of CBS 763.84 (FJ214846) differed from that of JQ646281 (EGS17-061) by 22 nucleotides. It can be seen that the sequences in GenBank are unreliable in many cases, and the previously published sequences of this species may contain errors. In a previous study conducted by us, the type strains of A. triticina deposited in three bacterial collection centers were sequenced, namely CBS 763.84, CGMCC 3.9868 and ATCC 36205. As expected, the sequences of these three strains were consistent, and phylogenetic analysis showed that A. triticina was closely related to A. ventricosa. The sequence results of EGS17-061 reported were incorrect.

[0005] Conventional PCR detection methods require subsequent processing such as gel running, which is cumbersome and time-consuming. It is impossible to distinguish closely related species such as wheat leaf blight pathogen and its similar species in one step, and it requires high professional quality of the detection personnel, which is difficult to meet the detection requirements of rapid, accurate and sensitive identification. Therefore, it is urgent to use the correct sequence to design specific primers and develop new specific, sensitive, accurate and rapid detection methods. Summary of the invention

[0006] The technical problem to be solved by the present invention is how to detect wheat leaf blight pathogen quickly, sensitively, specifically and accurately. The technical problem to be solved is not limited to the technical subject described, and those skilled in the art can clearly understand other technical subjects not mentioned in this article through the following description.

[0007] To solve the above technical problems, the present invention first provides a primer pair for detecting wheat leaf blight pathogen (Alternariatriticina), wherein the primer pair is a pair of primers for detecting or amplifying a wheat leaf blight pathogen-specific target sequence, and the nucleotide sequence of the wheat leaf blight pathogen-specific target sequence can be SEQ ID No.1.

[0008] Furthermore, the primer pair may consist of primer ATF and primer ATR, the primer ATF may be a single-stranded DNA molecule shown in SEQ ID No.2; the primer ATR may be a single-stranded DNA molecule shown in SEQ ID No.3.

[0009] The present invention also provides a composition for detecting wheat leaf blight pathogen, the composition comprising the primer pair and a probe, and the probe specifically binds to the wheat leaf blight pathogen-specific target sequence (SEQ ID No. 1).

[0010] The probes include, but are not limited to, hydrolysis probes (such as TaqMan probes, TaqMan MGB probes), dual hybridization probes, molecular beacons or composite probes.

[0011] Furthermore, the probe may be a TaqMan MGB probe.

[0012] In the above composition, the nucleotide sequence of the probe may be SEQ ID No.4.

[0013] In the above composition, the 5' end of the probe may be labeled with a fluorescent group, and the 3' end may be labeled with a quenching group.

[0014] Further, the fluorescent group can be selected from FAM, VIC, HEX, TET, CY3, CY5, CY5.5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705, Quasar 570, Quasar670, TexasRed, Pacific Blue, Atto 425, Atto 590 and AquaPhluor 593.

[0015] Further, the quenching group can be selected from TAMRA, BHQ1, BHQ2, BHQ3, MGB, Dabcy1, Eclipse, BBQ 650, DDQ-1 and QSY21.

[0016] Furthermore, the 5' end of the probe contains a FAM reporter gene, and the 3' end contains a non-fluorescent quenching group and has an MGB molecule.

[0017] The present invention also provides a kit for detecting wheat leaf blight pathogen, wherein the kit comprises the primer pair described herein or any composition described herein.

[0018] Furthermore, the kit may also include reagents required for fluorescence quantitative PCR detection.

[0019] Furthermore, the kit may also include a nucleic acid extraction reagent, a DNA polymerase (such as Taq DNA polymerase, Tth DNA polymerase, Vent DNA polymerase, and Pfu DNA polymerase, etc.), dNTPs, Mg 2+ Solution (such as MgSO 4 or MgCl 2 solution), PCR buffer (such as Tris-HCl), positive control, negative control and one or more of the standards.

[0020] The nucleic acid extraction reagent is well known to those skilled in the art and is used to extract nucleic acids from the sample to be tested. For example, the nucleic acid extraction reagent may include a lysing solution (such as any one or more of guanidine isothiocyanate, guanidine hydrochloride and trisodium citrate), lysozyme, proteinase K, a washing solution (such as ethanol and / or guanidine salt) and / or an eluent (such as TE buffer), etc.

[0021] The positive control substance or the standard substance may be any of the following:

[0022] A1) Translation elongation factor (tef1) gene of Psoralea coli;

[0023] A2) a specific fragment of the translation elongation factor (tef1) gene of Psoralea corylifolia (such as SEQ ID No.1 or the DNA molecule shown at positions 28 to 120 of SEQ ID No.1);

[0024] A3) A DNA molecule represented by a sequence obtained by extending one to several bases toward the 5' end and / or the 3' end or deleting one to several bases based on SEQ ID No. 1;

[0025] A4) A recombinant vector (positive plasmid) containing any one of the genes, specific fragments or DNA molecules described in A1) to A3).

[0026] The nucleotide sequence of the translation elongation factor (tef1) gene of wheat leaf blight pathogenic bacteria can be shown as positions 1-491 of GenBank Accession No. MZ073960 (Update Date 2021-11-7).

[0027] The negative control substance can be selected from double distilled water (ddH 2 O), triple distilled water, distilled water, ultrapure water and deionized water.

[0028] Furthermore, the test samples of the kit include but are not limited to plant samples (such as plants, plant tissues or plant seeds, etc.), microbial samples (such as plant pathogenic fungi, etc.) and environmental samples (such as water, soil, air and objects).

[0029] Furthermore, the plant sample may be a wheat plant sample (such as raw wheat, field wheat, wheat seeds, etc.).

[0030] Such objects include, but are not limited to, agricultural machinery, passenger cargo, the ground, walls, containers, packaging, fabrics, food and feed.

[0031] The various reagent components of the kit may be present in separate containers, or may be pre-combined in whole or in part into a reagent mixture.

[0032] The components of the kit may be provided in the form of a solution, such as an aqueous solution. In the case of being in the form of an aqueous solution, the concentration or content of these components can be easily determined by those skilled in the art according to different needs. For example, for storage purposes, the concentration of the components may be present in a higher form, and when in working state or use, the concentration may be reduced to the working concentration by diluting the above-mentioned higher concentration solution.

[0033] Furthermore, the kit may also include a readable carrier recording a method for detecting wheat leaf blight pathogen. The readable carrier may be a kit instruction sheet (e.g., a printed instruction sheet) for practicing the method of the present invention or a computer-readable medium (e.g., a floppy disk, a CD, etc.) on which information has been recorded.

[0034] The kit described herein may be a detection kit based on real-time fluorescence quantitative PCR.

[0035] The present invention also provides the use of the primer pair, the composition or the kit in detecting wheat leaf blight pathogens.

[0036] The present invention also provides application of the primer pair or the composition in preparing a product for detecting wheat leaf blight pathogen.

[0037] The products described herein are selected from reagents, test kits, chips, test strips and test cards.

[0038] The present invention also provides a method for detecting wheat leaf blight pathogens, which comprises using the DNA of the sample to be tested as a template, performing real-time fluorescent PCR using the primer pair, the composition or the kit, and judging the detection result according to the amplified product.

[0039] Further, judging the detection result according to the amplification product includes judging the detection result according to the amplification curve and / or Ct value of the amplification product.

[0040] Furthermore, judging the detection result according to the amplification product includes determining whether the sample to be tested contains wheat leaf blight pathogenic bacteria according to the amplification product or performing quantitative detection on the wheat leaf blight pathogenic bacteria in the sample to be tested.

[0041] In the above method, the reaction conditions of the real-time fluorescence PCR may be: 95°C for 10 min; 94°C for 15 s, 60°C for 60 s, for a total of 40 cycles.

[0042] In the above method, in the reaction system of the real-time fluorescent PCR, the molar ratio of primer ATF (SEQ ID No. 2), primer ATR (SEQ ID No. 3) and probe (SEQ ID No. 4) can be 1:1:(1-1.5).

[0043] Furthermore, the 1 to 1.5 may be 1, 1.1, 1.2, 1.3, 1.4 or 1.5.

[0044] Furthermore, the molar ratio of the primer ATF, the primer ATR and the probe in the reaction system of the real-time fluorescent PCR may be 7:7:9.

[0045] Furthermore, the real-time fluorescence PCR reaction system may also include: DNA of the sample to be tested (template DNA) and real-time fluorescence PCR reaction buffer.

[0046] The real-time fluorescent PCR reaction buffer may include Taq DNA polymerase, dNTPs, Mg 2+ Solution (such as MgSO 4 or MgCl 2 solution) and PCR buffer (such as Tris-HCl).

[0047] In one or more embodiments of the present invention, the real-time fluorescent PCR reaction buffer is 2× Universal PCR Master Mix.

[0048] Furthermore, the reaction system (10 μL) of the real-time fluorescence PCR can be: reaction buffer (2× Universal PCR Master Mix) 5 μL, forward primer ATF and reverse primer ATR (both at a concentration of 10 μM) 0.7 μL each, probe ATP (concentration 10 μM) 0.9 μL, 1 μL template DNA, double distilled water to 10 μL.

[0049] Furthermore, judging the detection result based on the amplification product may include any of the following:

[0050] (1) determining whether the sample to be tested contains wheat leaf blight pathogenic bacteria according to the amplification curve of the PCR amplification product: if the amplification curve of the real-time fluorescent PCR is an S-shaped curve, it is determined that the sample to be tested contains wheat leaf blight pathogenic bacteria; if the amplification curve of the real-time fluorescent PCR is not an S-shaped curve, it is determined that the sample to be tested does not contain wheat leaf blight pathogenic bacteria;

[0051] (2) Determine whether the sample to be tested contains wheat leaf blight pathogenic bacteria according to the Ct value of the PCR amplification product: if the Ct value is ≤ t, it is determined that the sample to be tested contains wheat leaf blight pathogenic bacteria; if the Ct value is > 35, it is determined that the sample to be tested does not contain wheat leaf blight pathogenic bacteria.

[0052] Furthermore, the sample to be tested can be quantitatively analyzed, for example, a standard with a known content is diluted into samples of different concentrations, and real-time fluorescence quantitative PCR amplification is performed simultaneously with the sample to be tested, and a standard curve is drawn according to the detection data (the horizontal axis is the logarithm of the starting copy number of the standard, and the vertical axis is the Ct value). When the sample to be tested is quantitatively analyzed, the starting copy number of the sample to be tested can be calculated from the standard curve equation according to the Ct value of the sample to be tested.

[0053] The samples to be tested described herein include, but are not limited to, plant samples (such as plants, plant tissues or plant seeds, etc.), microbial samples (such as plant pathogenic fungi, etc.) and environmental samples (such as water, soil, air and objects).

[0054] Furthermore, the plant sample may be a wheat plant sample (such as raw wheat, field wheat, wheat seeds, etc.).

[0055] Such objects include, but are not limited to, agricultural machinery, passenger cargo, the ground, walls, containers, packaging, fabrics, food and feed.

[0056] The detection of wheat leaf blight pathogen in the present invention may also be identification or auxiliary identification of wheat leaf blight pathogen.

[0057] In order to detect wheat leaf blight pathogen more quickly, sensitively and specifically, the present invention identifies a translation elongation factor (translation_elongation_factor_1alpha, tef1) gene-specific target sequence (SEQ ID No. 1) for wheat leaf blight pathogen from GenBank through analysis, and designs and screens a primer-probe combination for detecting wheat leaf blight pathogen with high specificity and high sensitivity for the target sequence, the primer-probe combination comprising a specific primer pair for wheat leaf blight pathogen for amplifying a target gene fragment (target sequence), and a fluorescent probe that can be complementary to a template. Using the designed primer-probe combination, the present invention establishes a rapid detection method for wheat leaf blight pathogen nucleic acid based on real-time fluorescence quantitative PCR, and the method has good repeatability and stability. Compared with the prior art, the wheat leaf blight pathogen-specific target sequence (SEQ ID No. 1) identified by the present invention is more accurate, and the wheat leaf blight pathogen nucleic acid rapid detection method and kit developed for the method are simple to operate, low in cost, and have good specificity. They all show negative reactions to strains of multiple similar species, and have high sensitivity, with a minimum detection limit of 20 pg, which can effectively avoid false positives and false negatives.

[0058] The present invention only requires a small amount of mycelium or plant samples to obtain accurate results within a few hours, and can sensitively detect a DNA content of 20pg. It can quickly and accurately identify wheat leaf blight pathogens or plants infected therewith, and has low requirements for operators. It has broad application prospects in the field of wheat leaf blight pathogen detection.

[0059] Definition of terms

[0060] In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Meanwhile, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below.

[0061] The term "fluorescent group" generally refers to the chromophore in a fluorescent compound, ie, a group that can produce fluorescence.

[0062] The term "quencher" generally refers to a chemical substance used to eliminate a fluorescent signal. When a fluorescent group is close to a quencher, the quencher absorbs the fluorescence emitted by the fluorescent group, causing the fluorescent signal to weaken or disappear.

[0063] The term "amplification curve" generally refers to the amplification curve obtained by fluorescence quantitative PCR. As the PCR reaction proceeds, the amplification product accumulates and the intensity of the fluorescence signal increases. After each cycle, the fluorescence signal is collected and the change in the amount of the amplification product is monitored by the change in fluorescence intensity. Usually, the ordinate of the amplification curve is the fluorescence value and the abscissa is the number of cycles.

[0064] The term "Ct value" generally refers to the number of PCR cycles corresponding to the fluorescence value when the fluorescence signal of the amplified product reaches the set threshold during the PCR amplification process. It can also be understood as the horizontal coordinate corresponding to the intersection of the amplification curve and the threshold line. Generally, when the same template is amplified in the same cycle, the Ct value is relatively fixed.

[0065] The term "positive control (also called amplification positive control)" usually refers to a set of controls that can be detected for sure, such as target genes (such as genomic DNA or cDNA), target gene fragments (such as specific conserved fragments), plasmids containing target genes or target gene fragments, pseudoviruses, etc., and positive sample controls (such as known infected samples or samples known to definitely produce expected results). The role of positive controls is to prevent false negatives in PCR detection due to problems such as loss or degradation of target DNA, inactivation of DNA polymerase, and PCR instrument failure.

[0066] The term "negative control (also called amplification negative control)" usually refers to a set of controls that will definitely not be detected, such as a no-template control (NTC, water is used instead of nucleic acid in the PCR reaction, and other reagents are added in normal proportions), or a negative sample control (such as a sample that does not express the target gene). The role of negative controls is to prevent false positives in PCR detection due to product contamination, reagent contamination, cross-contamination between samples, sample collection and transportation contamination, etc.

[0067] The term "real-time fluorescence PCR (qPCR)", also known as real-time fluorescence quantitative PCR or real-time quantitative PCR, generally refers to a technology that uses fluorescent dyes or fluorescently labeled specific probes to label and track PCR products, monitor the reaction process in real time online, and perform qualitative or quantitative analysis of the products.

[0068] The term "target sequence" generally refers to any sequence of interest, to be detected or analyzed, such as any sequence whose presence or absence is expected to be detected, or any sequence whose function, interaction or any characteristic is expected to be studied. In the present invention, it refers to a nucleic acid sequence whose presence or absence is expected to be detected.

[0069] The term "primer" generally refers to an oligonucleotide that stimulates synthesis at the initiation of nucleotide polymerization, which may be natural or synthetic. In the present invention, primers may refer to artificially synthesized oligonucleotides that can complementarily bind to two template DNAs, one of which is an upstream primer (also called a forward primer or a positive strand primer), and the other is a downstream primer (also called a reverse primer or a negative strand primer). The term "probe" generally refers to a small segment of single-stranded DNA or RNA fragments used to detect a nucleic acid sequence complementary thereto, and may include DNA probes, cDNA probes, RNA probes, and oligonucleotide probes. In the present invention, a probe may refer to an oligonucleotide that is complementary to a portion of a target sequence, specifically binds to a target sequence through molecular hybridization, generates a hybridization signal, and thereby detects the target sequence. The present invention does not impose any restrictions on the method for synthesizing primers and probes. If the nucleotide sequences of the primers and probes are known, conventional methods for synthesizing primers and probes may be used.

[0070] The term "MGB" (minor groove binder) generally refers to a dihydrocyclopyrrole tripeptide. Its unique structure enables it to selectively bind to the minor groove of the DNA molecule, which is the shallow groove in the DNA helix.

[0071] The term "sample" may refer to any material suspected of containing a particular microorganism or group of microorganisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1It is a comparison chart of the translation elongation factor sequences of the probe of the present invention and other Alternaria strains.

[0073] Figure 2 This is the specific detection result of the real-time fluorescence PCR method for detecting wheat leaf blight pathogen in Example 2.

[0074] Figure 3 This is the optimization test result of the primer concentration in Example 3.

[0075] Figure 4 This is the optimized detection result of the probe concentration in Example 3.

[0076] Figure 5 This is the sensitivity test result of the real-time fluorescence PCR method for detecting wheat leaf blight pathogen in Example 4.

[0077] Figure 6 This is the standard curve for real-time fluorescence PCR detection in Example 4. DETAILED DESCRIPTION

[0078] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0079] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0080] The quantitative experiments in the following examples were performed three times, unless otherwise specified, and the results were averaged.

[0081] The 62 test strains in the following examples were derived from isolates collected by Ningbo Institute of Inspection and Quarantine Science and Technology from bacterial culture preservation institutions around the world (wheat leaf blight pathogen CBS121461 was from the Royal Netherlands Culture Collection, wheat leaf blight pathogen CGMCC 3.9868 was from the China General Microbiological Culture Collection Administration Center, and wheat leaf blight pathogen ATCC 36205 was from the American Culture Collection), and from samples isolated and identified at Ningbo Port.

[0082] The probes and primer pairs in the following examples were synthesized by Shanghai Sangon Biotechnology Service Co., Ltd.

[0083] Example 1. Selection of target sequence and design of primers and probes

[0084] Based on the latest verified translation elongation factor translation_elongation_factor_1alpha_(tef1) sequence of Pseudomonas aeruginosa (GenBank accession number: MZ073960), a BLAST analysis was performed in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) to identify a specific nucleic acid fragment with strong specificity that can effectively distinguish Pseudomonas aeruginosa (i.e., a Pseudomonas aeruginosa-specific target sequence) as follows:

[0085] 5'-CTCGACAAGTTGAAGGCCGAGCGTGAGCGTGGTATCACCATCGATATCGCTCTC TGGAAGTTCGAAACCCCCAAATACTACGTCACCGTTAGTACGTACTTCCTGCTGACTCTC CTCATGACGATCTTTGATCGCTAACAATTCATTTAGTTGACGCCCCCGGTCACCGTGACT TCATCAAGAACATGATC-3' (SEQ ID No. 1).

[0086] The inventors of the present invention conducted a large number of studies and analyses on the target sequence (SEQ ID No. 1), including sequence specificity comparison, amplification efficiency comparison, quantitative accuracy comparison, etc., and finally screened out an ideal primer-probe combination with strong specificity, high sensitivity and good repeatability. The designed primer and probe sequences are shown in Table 1.

[0087] Table 1. Primer and probe sequences

[0088] Primer name sequence Forward primer ATF 5'-TCGCTCTCTGGAAGTTCGAAA-3'(SEQ ID No.2) Reverse primer ATR 5'-CATGAGGAGAGTCAGCAGGAAGT-3'(SEQ ID No.3) Probe ATP 5'-FAM-CCCCAAATACTACGTCACC-MGB-3'(SEQ ID No.4)

[0089] The sequence of the probe is significantly different from the translation elongation factor sequences of other Alternaria strains, which can ensure the specificity of the detection method, such as Figure 1 As shown, ATP is the probe sequence.

[0090] Example 2: Real-time fluorescence PCR detection of wheat leaf blight pathogen and specificity test

[0091] 1. Sample source

[0092] A total of 62 strains were tested, see Table 2.

[0093] Table 2 Test strains and real-time fluorescence PCR detection results

[0094]

[0095]

[0096]

[0097] 2. DNA Extraction

[0098] Mycelial DNA extraction: The mycelium of the strain cultured on the PDA plate for about 10 days was scraped with a sterilized pipette tip, and DNA was extracted using a nucleic acid automatic extractor (ThermoFisher, Kingfisher mL model) according to the operating instructions of the MAGPlant DNA Extraction Kit (purchased from Zhuhai Lifei Technology Service Co., Ltd.). The extracted DNA was tested for concentration by an ultra-micro spectrophotometer (ThermoFisher, NanoDrop 2000C model) and stored at -20°C for future use.

[0099] 3. Real-time fluorescence PCR detection (specific detection)

[0100] The primers and probes designed in Example 1 were used to perform real-time fluorescence PCR detection with the extracted DNA of 62 strains as templates, and water was used as a blank control. Reaction system: reaction buffer (2× Universal PCR Master Mix, purchased from Applied Biosystems, catalog number 4324018) 5 μL, forward primer ATF and reverse primer ATR (both at a concentration of 10 μM) 0.5 μL, probe (concentration 10 μM) 0.5 μL, add 1 μL template DNA solution, dilute to 10 μL with sterile double distilled water, and perform real-time fluorescence PCR reaction on a real-time fluorescence PCR instrument. The reaction conditions are: 95°C for 10 min; then 94°C for 15 s, 60°C for 60 s, for a total of 40 cycles.

[0101] 4. Result determination

[0102] Determine whether the sample to be tested contains wheat leaf blight pathogenic bacteria based on the amplification curve of the PCR amplification product: if the amplification curve of the real-time fluorescent PCR is an S-shaped curve, it is determined that the sample to be tested contains wheat leaf blight pathogenic bacteria; if the amplification curve of the real-time fluorescent PCR is not an S-shaped curve, it is determined that the sample to be tested does not contain wheat leaf blight pathogenic bacteria.

[0103] It is also possible to determine whether the sample to be tested contains wheat leaf blight pathogenic bacteria based on the Ct value of the PCR amplification product: if the Ct value is ≤ t, it is determined that the sample to be tested contains wheat leaf blight pathogenic bacteria; if the Ct value is > 35, it is determined that the sample to be tested does not contain wheat leaf blight pathogenic bacteria.

[0104] 5. Results Analysis

[0105] The results are as follows Figure 2As shown: the three wheat leaf blight pathogen samples can detect specific amplification curves and the specific amplification exceeds the threshold line, while other samples have no specific amplification curves ( Figure 2 ). The results show that the primers and probes designed by the present invention have strong specificity, and only 3 strains of wheat leaf blight pathogens can be detected among 62 fungal samples, and other fungi and water cannot be detected. The detection results of this example show that the primers and probes of the present invention and the detection method thereof are specific and sensitive to wheat leaf blight pathogens.

[0106] Example 3: Optimization of primer and probe concentrations for real-time fluorescence PCR detection of wheat leaf blight pathogen

[0107] 1. Primer concentration optimization

[0108] The primers and probes designed in Example 1 were used to perform real-time fluorescence PCR detection with CGMCC 3.9868 strain DNA as template, and water as blank control. Reaction system: reaction buffer (2× Universal PCR Master Mix) 5μL, increase the forward primer and reverse primer concentration from 0.1μM to 1.0μM in 0.1μM increments, probe (10μM) 0.5μL, add 1μL template DNA solution, dilute to 10μL with sterile double distilled water, and perform real-time fluorescence PCR reaction on a real-time fluorescence PCR instrument. The reaction conditions are: 95℃10min; then 94℃15s, 60℃60s, for a total of 40 cycles.

[0109] Depend on Figure 3 It can be seen that when the primer concentration is 0.7μM, the △Rn value reaches the maximum and the Ct value is the minimum. After 3 repeated experiments, 0.7μM was determined to be the optimal primer concentration.

[0110] 2. Probe concentration optimization

[0111] The primers and probes designed in Example 1 were used to perform real-time fluorescence PCR detection with the CGMCC 3.9868 strain DNA as a template, and water was used as a blank control. Reaction system: reaction buffer (2× Universal PCR Master Mix) 5μL, forward primer and reverse primer (both at 10μM) 0.7μL, probe concentration from 0.1μM to 1.0μM in 0.1μM increments, add 1μL template DNA solution, dilute to 10μL with sterile double distilled water, and perform real-time fluorescence PCR reaction on a real-time fluorescence PCR instrument. The reaction conditions are: 95℃10min; then 94℃15s, 60℃60s, for a total of 40 cycles.

[0112] Depend on Figure 4It can be seen that when the probe concentration is 0.9 μM, the △Rn value reaches the maximum and the Ct value is the minimum. After three repeated experiments, 0.9 μM was determined to be the optimal probe concentration.

[0113] 3. Optimized reaction system

[0114] After optimizing the concentrations of primers and probes, the optimal reaction system for real-time fluorescence PCR was determined, that is, reaction buffer (2× Universal PCR Master Mix) 5 μL, forward primer and reverse primer (both at a concentration of 10 μM) 0.7 μL each, probe (10 μM) 0.9 μL, add 1 μL template DNA solution, and dilute to 10 μL with sterile double distilled water.

[0115] Example 4: Sensitivity test of real-time fluorescence PCR method for detecting wheat leaf blight pathogen

[0116] The DNA concentration of CGMCC 3.9868 strain was adjusted to 10 ng / μL, and a 10-fold gradient dilution was performed to obtain dilutions of 10 -1 , 10 -2 , 10 -3 and 10 -4 , 10 -5 , 10 -6 , 10 -7 (The corresponding concentrations are 20 ng / μL, 2 ng / μL, 200 pg / μL, 20 pg / μL, 2 pg / μL, 0.2 pg / μL, and 0.02 pg / μL, respectively. The optimized system was used for real-time fluorescence PCR detection.

[0117] The sensitivity test results showed that ( Figure 5 ), the minimum detection limit of the real-time fluorescence PCR method established by the present invention is 20pg, that is, the minimum detection limit of the method is 2pg / μL. By performing real-time fluorescence PCR detection on total DNA with known concentration gradients, it was found that the higher the DNA concentration, the smaller the Ct value. The results of three parallel tests showed that the DNA template concentration was extremely correlated with the Ct value, y=-3.91x+28.07 (R2=0.9963), where x represents the logarithm of the DNA concentration and y represents the corresponding Ct value ( Figure 6 ).

[0118] Example 5: Real-time fluorescence PCR repeatability detection

[0119] Four concentrations (20 ng / μL, 2.0 ng / μL, 0.20 ng / μL, and 0.02 ng / μL) of CGMCC 3.9868 strain DNA were used as reaction templates, and real-time fluorescence PCR detection was performed using the optimized system.

[0120] The intra-group repeated CV values ​​were between 0.47% and 0.77%, and the inter-group repeated CV values ​​were between 0.22% and 0.71%, both less than 1% (Table 3). This indicates that the TaqMan MGB real-time fluorescence PCR detection method for wheat leaf blight pathogen established in the present invention has good repeatability and stability.

[0121] Table 3 Repeatability test results

[0122]

[0123] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A primer pair for detecting wheat leaf blight pathogen, characterized in that: The primer pair is a pair of primers for detecting or amplifying a wheat leaf blight pathogen-specific target sequence, and the nucleotide sequence of the wheat leaf blight pathogen-specific target sequence is SEQ ID No.

1.

2. The primer pair according to claim 1, characterized in that The primer pair consists of primer ATF and primer ATR, wherein the primer ATF is a single-stranded DNA molecule shown in SEQ ID No.2; and the primer ATR is a single-stranded DNA molecule shown in SEQ ID No.

3.

3. A composition for detecting wheat leaf blight pathogen, characterized in that: The composition comprises the primer pair and the probe according to claim 1 or 2, and the probe specifically binds to the wheat leaf blight pathogen-specific target sequence according to claim 1.

4. The composition according to claim 3, characterized in that The nucleotide sequence of the probe is SEQ ID No.

4.

5. The composition according to claim 4, characterized in that The 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

6. A kit for detecting wheat leaf blight pathogen, characterized in that: The kit comprises the primer pair according to claim 1 or 2 or the composition according to any one of claims 3-5.

7. Use of the primer pair according to claim 1 or 2, the composition according to any one of claims 3 to 5, or the kit according to claim 6 in detecting wheat leaf blight pathogen.

8. Use of the primer pair according to claim 1 or 2 or the composition according to any one of claims 3 to 5 in the preparation of a product for detecting wheat leaf blight pathogen.

9. A method for detecting wheat leaf blight pathogen, characterized in that: The method comprises using the DNA of the sample to be tested as a template, performing real-time fluorescent PCR using the primer pair described in claim 1 or 2, the composition described in any one of claims 3 to 5, or the kit described in claim 6, and determining the test result based on the amplified product.

10. The method according to claim 9, characterized in that In the reaction system of the real-time fluorescent PCR, the molar ratio of the primer ATF, the primer ATR and the probe is 1:1:(1-1.5).

Images