TGM2-targeted agonist and application thereof

Abstract

The invention relates to a TGM2-targeting agonist and application thereof, and relates to the technical field of biological medicine, and the TGM2-targeting agonist comprises GDP-D-Mannose or a tautomer, a stereoisomer, a pharmaceutically acceptable salt, a hydrate or a solvate thereof. A key molecule TGM2 which is closely related to abnormal regeneration of diabetic bone defects and can regulate and control osteogenic differentiation potential of BMMSC is found, and a series of small molecule compounds which can target TGM2 and improve protein expression level and enzymatic activity of the TGM2 are further obtained through high-throughput virtual screening of the small molecule compounds of the TGM2. A new thought can be provided for promoting the regeneration of the diabetic bone defect.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an agonist targeting TGM2 and application thereof. Background Art

[0002] Diabetes mellitus (DM) is a chronic metabolic disease characterized by long-term hyperglycemia, affecting tens of millions of patients and placing tremendous pressure on the global medical system. Poor blood sugar control leads to the accumulation of reactive oxygen species (ROS) and advanced glycosylation end products (AGEs), immune abnormalities, etc., which causes increased bone fragility and hindered bone defect regeneration in diabetic patients. Bone marrow mesenchymal stem cells (BMMSCs) can differentiate into osteoblasts under appropriate conditions and play an important role in regulating bone metabolism stability. At the same time, previous studies have shown that delayed bone defect regeneration in diabetic patients is related to abnormal osteogenic differentiation potential of BMMSCs.

[0003] Diabetic bone regeneration disorder is the result of the combined action of multiple pathological mechanisms. However, current diabetic bone regeneration treatment strategies, including various stem cells, drugs and biomaterials, still have difficulties in clinical transformation. Therefore, there is an urgent need to develop a new and effective method to promote the regeneration of diabetic bone defects. At present, it is known that type 2 glutamine aminotransferase (TGM2, also known as transglutaminase 2 or tissue transglutaminase) plays an important role in the osteogenic differentiation of cells, but whether it is involved in regulating the osteogenic differentiation potential of cells under diabetic conditions is still unknown. Moreover, the research related to TGM2 is mainly focused on its related inhibitors, and there has been no in-depth study on activators targeting TGM2, which has failed to provide a new treatment strategy for diabetic bone defect regeneration. Summary of the invention

[0004] In order to solve the above problems, the present invention provides an agonist targeting TGM2 and application thereof.

[0005] In a first aspect, the present invention provides an agonist targeting TGM2, wherein the agonist targeting TGM2 comprises GDP-D-Mannose (also known as GDP-Man) or its tautomers, stereoisomers, pharmaceutically acceptable salts, hydrates or solvates.

[0006] Furthermore, the agonist targeting TGM2 is GDP-D-Mannose.

[0007] Furthermore, the agonist targeting TGM2 can target TGM2 and increase its protein expression level and its enzyme activity.

[0008] In a second aspect, the present invention provides a use of an agonist targeting TGM2 as described in any one of the first aspects in the preparation of a drug for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and the regeneration of bone defects in diabetic patients.

[0009] In a third aspect, the present invention provides a drug for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients, wherein the drug for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients comprises: 1) an agonist targeting TGM2 as described in any one of the first aspects; 2) a pharmaceutically acceptable carrier or excipient.

[0010] In a fourth aspect, the present invention provides a drug for treating bone defect regeneration in diabetic patients, wherein the drug for treating bone defect regeneration in diabetic patients comprises: 1) an agonist targeting TGM2 as described in any one of the first aspects; and 2) a pharmaceutically acceptable carrier or excipient.

[0011] In a fifth aspect, the present invention provides a drug delivery system for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and the regeneration of bone defects in diabetic patients, wherein the drug delivery system for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and the regeneration of bone defects in diabetic patients comprises: 1) an agonist targeting TGM2 as described in any one of the first aspects; 2) a pharmaceutically acceptable carrier or excipient.

[0012] The above technical solution provided by the embodiment of the present invention has at least the following advantages compared with the prior art:

[0013] The embodiment of the present invention provides an agonist targeting TGM2 and its application. The present invention discovered for the first time a molecule TGM2 that is closely related to the regulation of osteogenic differentiation in diabetic patients and the regeneration of bone defects in diabetic patients. The experimental results show that the expression of TGM2 protein in stem cells undergoing osteogenic differentiation under diabetic conditions is significantly reduced. Through functional studies, TGM2 downregulation damages the osteogenic differentiation potential of BMMSCs, and after overexpressing TGM2 levels under diabetic conditions, the damage to the osteogenic differentiation potential of BMMSCs can be reversed. And further, through high-throughput virtual screening of small molecule compounds targeting TGM2, a series of small molecule compounds that can target TGM2 and increase its protein expression level and its enzyme activity are obtained, which can provide new ideas for promoting the regeneration of diabetic bone defects. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0016] Figure 1 This is a graph showing the test results of mRNA microarray chips screening for differentially expressed mRNAs in BMMSCs derived from normal rats and type 2 diabetic rats in an embodiment of the present invention.

[0017] Figure 2 This is a graph showing the test results of mRNAs molecules screened by qRT-PCR low-throughput verification in an embodiment of the present invention.

[0018] Figure 3 This is a graph showing the expression trend of TGM2 verified by Western blot in an embodiment of the present invention.

[0019] Figure 4 This is a graph showing the effect of silencing TGM2 on the osteogenic differentiation of BMMSCs from type 2 diabetic rats in an example of the present invention.

[0020] Figure 5 This is a graph showing the effect of overexpression of TGM2 on osteogenic differentiation of BMMSCs from normal rats in an example of the present invention.

[0021] Figure 6 This is a result diagram of the specific information of 37 small molecule compounds screened out in the examples of the present invention.

[0022] Figure 7 This is a graph showing the evaluation test results of the cytotoxicity of small molecule compounds in the examples of the present invention.

[0023] Figure 8 This is a graph showing the test results of the effect of small molecule compounds on the expression level of BMMSC TGM2 protein in an example of the present invention.

[0024] Fig. 9 This is a graph showing the test results of the effect of small molecule compounds in an example of the present invention on the osteogenic differentiation of BMMSCs from T2DM rats.

[0025] Fig.10 This is a diagram showing the results of molecular dynamics simulation to verify the interaction between GDP-Man and TGM2 proteins in an embodiment of the present invention.

[0026] Fig.11 This is a graph showing the effect of GDP-Man on TGM2 transglutaminase activity in an embodiment of the present invention.

[0027] Fig.12This is a graph showing the gelation and sustained-release function test results of the GDP-Man loaded GelMA hydrogel in an embodiment of the present invention.

[0028] Fig.13 This is a diagram showing the results of an in vivo experiment evaluating the promoting effect of GDP-Man on bone defect regeneration in type 2 diabetic rats in an example of the present invention. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0031] The technical solution provided by the present invention is as follows:

[0032] In a first aspect, the present invention provides an agonist targeting TGM2, wherein the agonist targeting TGM2 comprises GDP-D-Mannose or a tautomer, a stereoisomer, a pharmaceutically acceptable salt, a hydrate or a solvate thereof.

[0033] In some specific embodiments, the agonist targeting TGM2 is GDP-D-Mannose.

[0034] In some specific embodiments, the agonist targeting TGM2 can target TGM2 and increase its protein expression level and its enzyme activity.

[0035] In a second aspect, the present invention provides a use of an agonist targeting TGM2 as described in any one of the first aspects in the preparation of a drug for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and the regeneration of bone defects in diabetic patients.

[0036] In a third aspect, the present invention provides a drug for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients, wherein the drug for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients comprises: 1) an agonist targeting TGM2 as described in any one of the first aspects; 2) a pharmaceutically acceptable carrier or excipient.

[0037] In a fourth aspect, the present invention provides a drug for treating bone defect regeneration in diabetic patients, wherein the drug for treating bone defect regeneration in diabetic patients comprises: 1) an agonist targeting TGM2 as described in any one of the first aspects; and 2) a pharmaceutically acceptable carrier or excipient.

[0038] In a fifth aspect, the present invention provides a drug delivery system for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and the regeneration of bone defects in diabetic patients, wherein the drug delivery system for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and the regeneration of bone defects in diabetic patients comprises: 1) an agonist targeting TGM2 as described in any one of the first aspects; 2) a pharmaceutically acceptable carrier or excipient.

[0039] It should be noted that, the components and raw materials involved in the agonist targeting TGM2 and its application provided in the embodiments of the present invention, unless otherwise specified or specified, can be directly commercially available products or homemade using existing public preparation methods; at the same time, the steps and parameters involved, unless otherwise specified or specified, can be carried out according to the methods and parameters disclosed in the prior art or directly using existing equipment, and the present invention document will not describe them one by one.

[0040] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually measured according to national standards. If there is no corresponding national standard, then the conditions recommended by the manufacturer are followed.

[0041] The information of the main reagents and equipment involved in the following examples is as follows:

[0042] Rat bone marrow mesenchymal stem cell osteogenic differentiation kit (Cyagen, China).

[0043] Rat mRNA Array chip (ArrayStar, USA).

[0044] Micropoly TransfecterTM Cell Reagent (Micropoly, China).

[0045] Ⅱ1st Strand cDNASynthesis SuperMix (Yisheng, China).

[0046] qPCR SYBR Green Master Mix (Yisheng, China).

[0047] CFX96 real-time fluorescence quantitative PCR system (Bio-Rad, USA).

[0048] Primers and small interfering RNA were ordered from Qingke Biotechnology Co., Ltd. The sequences are as follows:

[0049] β-actin(Forward),CCCATCTATGAGGGTTACGC;

[0050] β-actin(Reverse),TTTAATGTCACGCACGATTTC;

[0051] GAPDH(Forward),ACAGCAACAGGGTGGTGGAC;

[0052] GAPDH(Reverse),TTTGAGGGTGCAGCGAACTT;

[0053] ALP(Forward),GACAGACCCTCCCCACTCC;

[0054] ALP(Reverse),GGGTCTTTCTCTTTCTCTGGCA;

[0055] BSP(Forward),AGGACTGCCGAAGGAAGAAAT;

[0056] BSP(Reverse),TAGCGTGGCCGGTACTTAAA;

[0057] SP7(Forward),GTCCTCTCTGCTTGAGGAAG;

[0058] SP7(Reverse),CTCCTTTTCCCAGGGCTGTT;

[0059] TGM2(Forward),CATGGCCGAGGAGCTGAA;

[0060] TGM2(Reverse),GCAGCACCAGTTTCTGTTGG;

[0061] si-TGM2,5'-GGCUGACACUGUACUUCGA-3',3'-UCGAAGUACAGUGUCAGCC-5.

[0062] TGM2 overexpression plasmid (TSINGKE, China).

[0063] Nikon confocal laser microscope (Nikon, Japan).

[0064] Cell Counting Kit-8 (Deeyee, China).

[0065] NP-40 lysis buffer (Beyotime, China).

[0066] Recombinant TGM2 protein (TSINGKE, China).

[0067] BPA (MedChemExpress, USA).

[0068] Calcium chloride solution (Beyotime, China).

[0069] Dithiothreitol (Beyotime, China).

[0070] Tri-HCl buffer (Beyotime, China).

[0071] Protein tracer loading buffer (Zhonghui Hecai, China).

[0072] Horseradish peroxidase-labeled Streptavidin (Beyotime, China).

[0073] Methacrylated gelatin-60 (Engineering For Life, China).

[0074] Micro-CT (Aoying Technology, China).

[0075] Example

[0076] This example provides an agonist targeting TGM2 and its application. The present invention discovered for the first time a molecule TGM2 that is closely related to the regulation of osteogenic differentiation in diabetic patients and the regeneration of bone defects in diabetic patients. Experimental results show that the expression of TGM2 protein is significantly reduced in stem cells undergoing osteogenic differentiation under diabetic conditions. Through functional studies, downregulation of TGM2 damages the osteogenic differentiation potential of BMMSCs, and overexpression of TGM2 levels under diabetic conditions can reverse the damage to the osteogenic differentiation potential of BMMSCs. Therefore, the present invention provides a new and precise molecular target TGM2 for regulating the differentiation potential of stem cells in the diabetic microenvironment and preparing drugs for the regeneration of bone defects in diabetic patients, providing a theoretical basis for achieving diabetic bone defect regeneration and other aspects, and specifically includes the following steps:

[0077] 1. Screening and identification of molecules (TGM2 protein) closely related to osteogenic differentiation of stem cells under diabetic conditions

[0078] 1.1 mRNA microarray

[0079] The present invention constructs a rat model of type 2 diabetes mellitus (T2DM), extracts BMMSCs from its femur, and induces osteogenic differentiation of stem cells by adding osteogenic induction solution. After culturing stem cells from normal rats (normal group, marked as Nor in the figure) and stem cells from T2DM rats (type 2 diabetes group, T2DM in the figure) for 7 days, samples are collected and sent to mRNA microarray chip sequencing (Kangcheng Biology), and the key molecules closely related to the osteogenic differentiation of BMMSC under diabetic conditions are preliminarily screened and identified according to the sequencing results.

[0080] The specific steps of chip sequencing are as follows: After incubating the cells, add an appropriate amount of Trizol to extract total cell RNA. Then use the spectrophotometer NanoDropND-1000 to control RNA quality (OD260 / 280 is qualified when it is between 1.8-2.0). After the sample quality control is qualified, cDNA is obtained by reverse transcription, and then transcribed into labeled cRNA. The chip hybridization is completed by using the Agilent GeneExpression Hybridization Kit, and the hybridization chip is scanned by using the Agilent Microarray Scanner. Finally, the original data and standardized data are obtained. The above experiment has been commissioned to Shanghai Kangcheng Biotechnology Co., Ltd.

[0081] 1.2 Analysis of chip data to screen key differential mRNA molecules

[0082] Analysis of the sequencing results revealed that 1,678 mRNA molecules were differentially expressed in BMMSCs from type 2 diabetic rats, of which 894 mRNA molecules were upregulated and 784 mRNA molecules were downregulated.

[0083] Based on the above differentially expressed mRNA molecules, the 10 mRNA molecules with the highest up- and down-regulation fold changes were selected for subsequent quantitative real-time polymerase chain reaction (qRT-PCR) verification. The results showed that only 8 mRNA molecules had consistent qRT-PCR results with the chip results in terms of change trend, among which TGM2 had the highest fold change, suggesting that it may play an important role in the osteogenic differentiation of stem cells from T2DM rats.

[0084] Western blot was used to further verify the expression level of TGM2 protein. The results showed that, inconsistent with the expression trend of TGM2 mRNA, its protein level was significantly reduced in BMMSCs derived from T2DM rats.

[0085] 2. Functional verification of the effect of TGM2 on osteogenic differentiation of BMMSCs

[0086] In order to determine whether TGM2 is involved in the process of diabetes affecting BMMSC osteogenic differentiation, the present invention transfected BMMSCs with siRNA of the target molecule, silenced the expression of TGM2 molecules, and observed its effect on the osteogenic differentiation of stem cells.

[0087] 2.1 siRNA transfection into BMMSCs and evaluation of transfection efficiency

[0088] ① In order to silence the expression of TGM2 molecules, siRNA targeting the target molecule TGM2 and negative control (si-NC) were ordered from Qingke Biotechnology. The sequence of siRNA was si-TGM2, 5'-GGCUGACACUGUACUUCGA-3', 3'-UCGAAGUACAGUGUCAGCC-5'. After the test tube containing siRNA freeze-dried powder was centrifuged at low speed, sterile RNase-free ddH 2 O, prepare a 20μM working solution. ② Use 1×10 5 BMMSCs were seeded into 6-well plates at a density of 100 μL / well. When the BMMSCs confluence reached 60%, 1200 μL of fresh culture medium was replaced and transient transfection was performed. ③ Preparation of transfection complex: First, 6 μL Micropoly Transfecter TM Cell Reagent transfection reagent was mixed with 6 μL si-NC or target siRNA (both at 20 μM) at a ratio of 1:1, and the mixture was gently pipetted 15 times to mix, and the mixture was allowed to stand at room temperature for 10 min. ④ The prepared transfection complex was added to the 6-well plate, mixed thoroughly with the culture medium, and placed in a 37°C, 5% CO 2 ⑤ Evaluation of transfection efficiency: After 24-72h, the silencing efficiency of TGM2 in BMMSCs was evaluated by qRT-PCR. The results showed that siRNA could successfully transfect BMMSCs and silence the expression of TGM2, that is, compared with the control group (si-NC group) cells, the siRNA group (si-TGM2 group) could significantly reduce the expression level of TGM2 in BMMSCs 24-72h after transfection of BMMSCs.

[0089] 2.2 Effect of silencing TGM2 on osteogenic differentiation of BMMSCs

[0090] After successfully verifying the interference effect of siRNA, si-TGM2 was used to silence the expression of TGM2 in BMMSCs. Since it was a transient transfection, the culture medium had to be replaced every 3 days and then re-transfected. After 7 days, qRT-PCR and Western blot were used to detect the effect of silencing TGM2 molecules on the expression of BMMSC osteogenic differentiation-related genes and protein markers (ALP, BSP and SP7). The results showed that compared with the control group (si-NC), silencing of TGM2 (si-TGM2) significantly inhibited the expression levels of BMMSC osteogenic differentiation-related genes and proteins.

[0091] 3. Further functional verification of the role of TGM2 in osteogenic differentiation of BMMSCs

[0092] The above experimental results have confirmed that silencing the expression of TGM2 significantly inhibits the osteogenic differentiation of BMMSCs. Next, the present invention will study the effect of TGM2 overexpression on BMMSCs.

[0093] 3.1 Transfection of BMMSCs with TGM2 overexpression plasmid

[0094] ① In order to overexpress TGM2, the TGM2 sequence was inserted into the plasmid vector TK-PCDH-copGFP-T2A-Puro downstream of the TK promoter, and then the Micropoly Transfecter TM Cell Reagent Transfection Reagent Instructions Use the above overexpression plasmid to transfect BMMSCs. The plasmid TK-PCDH-copGFP-T2A-Puro lacking the TGM2 sequence but with the same structure was used as a negative control vector (ov-NC). ② Use 1×10 5 / well in a 6-well plate. When the BMMSCs confluence reaches 60%, replace with 1200 μL of fresh culture medium and perform transient transfection. ③Prepare transfection complex: First, prepare 8 μL Micropoly Transfecter TM Mix Cell Reagent transfection reagent with 8 μg ov-NC or ov-TGM2 plasmid in a ratio of 1:1, pipette gently 15 times to mix, and let the mixture stand at room temperature for 10 minutes. ④ Add the prepared transfection complex to a 6-well plate, mix it thoroughly with the culture medium, and place it at 37°C, 5% CO 2⑤ Evaluation of transfection efficiency: After 24-72h, the overexpression efficiency of TGM2 in BMMSCs was evaluated by qRT-PCR. The results showed that ov-TGM2 could successfully transfect BMMSCs and increase the expression of TGM2, that is, compared with the control group (ov-NC group), the overexpression group (ov-TGM2 group) could significantly increase the expression level of TGM2 in BMMSCs 24-72h after transfection of BMMSCs.

[0095] 3.2 Effect of TGM2 overexpression on osteogenic differentiation of BMMSCs

[0096] After successfully verifying the overexpression effect of the TGM2 overexpression plasmid, the ov-TGM2 plasmid was used to overexpress TGM2 expression in BMMSCs. Because it was a transient transfection, the culture medium needed to be replaced every 3 days and then re-transfected. After 7 days, qRT-PCR and Western blot were used to detect the effect of overexpression of TGM2 molecules on the expression of BMMSC osteogenic differentiation-related genes (ALP, BSP and SP7). The results showed that compared with the control group (ov-NC), the overexpression of TGM2 (ov-TGM2) significantly promoted the expression level of BMMSC osteogenic differentiation-related genes.

[0097] 4. High-throughput virtual screening of small molecule compounds targeting TGM2 protein

[0098] Preliminary research found that Rat TGM2 has no resolved protein 3D structure, only the 3D structure predicted by AlphaFold (AlphaFoldID: AF-Q9WVJ6-F1), with a high confidence score and good structural reliability. The Schrödinger software predicted a high-scoring Site1. Therefore, this project will conduct computer virtual screening on the pocket where Site1 of Rat TGM2 protein (nearby amino acids: VAL402 / GLU469 / ASN463 / ARG453, etc.) is located, hoping to obtain small molecule compounds with strong binding to the target protein.

[0099] 4.1 TGM2 protein preparation

[0100] The three-dimensional structure of Rat TGM2 was downloaded from the AlphaFold database (AlphaFold ID: AF-Q9WVJ6-F1). The protein was hydrogenated using the ProteinPreparationWizard module, followed by energy optimization (OPLS2005 force field, RMSD ). The processed protein was used to generate a grid file using the Receptor Grid Generation module. The grid file was generated with Site1 (nearby amino acids VAL402 / GLU469 / ASN463 / ARG453) as the center, and the box size was set to

[0101] 4.2 Compound preparation

[0102] The 2D format of HY-L001V (MCE Bioactive Compound Library, containing 20868 compounds) was converted into The software LigPrep Module performs hydrogenation, energy optimization and other processing, and outputs 3D structures for virtual screening.

[0103] 4.3 Molecular docking

[0104] The Virtual Screening Workflow module was used for virtual screening, the prepared compounds were imported, and the Glide module was used for molecular docking, that is, the receptor and ligand molecules were docked with each other through geometric matching and energy matching.

[0105] First, the prepared molecules were screened using the high-throughput screening (HTVS) mode in the Glide module, and the molecules with the top 15% of the scores were selected for the second round of screening using the standard (SP) mode; then the molecules with the top 15% of the scores were selected for the third round of screening using the high-precision (XP) mode, and all screening results were output. The binding force between the target and the compound, the compound structure, etc. were manually reviewed, and the top 200 compounds in the MCE Bioactive Compound Library were selected and output as the final screening results.

[0106] 5. Validation and identification of small molecule compounds targeting TGM2 protein

[0107] In order to verify whether the small molecule compounds screened out in the above experiments can target and activate TGM2 in cells, the present invention selects the top 37 small molecule compounds with the absolute value of docking score for subsequent research.

[0108] 5.1 Evaluation of cytotoxicity of small molecule compounds

[0109] ① In order to detect the toxicity of small molecule compounds to cells, the above 37 small molecule compounds (all at a concentration of 10 mM) were ordered from MCE, left to melt at room temperature, and then treated with cells at a final concentration of 10 μM. ② 3×10 3BMMSCs were seeded into 96-well plates at a density of 1 / well, and 200 μL of complete culture medium was added to each well. After the cells adhered to the wall, small molecule compounds were added. ③ 0.2 μL of different small molecule compounds were added respectively, mixed thoroughly with the culture medium, and placed at 37°C and 5% CO 2 ④ Cytotoxicity evaluation: After 72 hours, the cytotoxicity of different small molecule compounds was evaluated by using CCK-8 reagent. Small molecule compounds with obvious cytotoxicity were excluded, and the remaining small molecule compounds were subjected to subsequent research.

[0110] 5.2 Effects of small molecule compounds on BMMSC TGM2 expression

[0111] ① In order to detect the effect of the remaining small molecules in the above experiment on the expression level of BMMSC TGM2 protein, 1×10 5 BMMSCs were seeded in 6-well plates at a density of 100 μg / well, and 2 mL of complete medium was added to each well. When the BMMSCs confluence reached 80%, 2 μL of different small molecule compounds were added. ② After 72 hours, the effects of different small molecule compounds on the expression level of BMMSC TGM2 protein were evaluated by Western blot. Three small molecule compounds (Salvianolic acid C, Glycol chitosan and GDP-Man) that could significantly increase the expression level of BMMSC TGM2 protein were screened for subsequent studies.

[0112] 5.3 Further verification of the effect of small molecule compounds on osteogenic differentiation of BMMSCs from T2DM rats

[0113] ① In order to detect whether the small molecule compounds screened in the above experiment can improve the damage of BMMSC osteogenic differentiation under diabetic conditions, 1×10 5 BMMSCs were seeded in 6-well plates at a density of 1 / well. ② When the BMMSCs confluence reached 80%, it was replaced with 2 mL of osteogenic induction solution, and 2 μL of different small molecule compounds were added respectively. ③ After replacing the new osteogenic induction solution every 3 days, small molecule compounds need to be added again. ④ After 7 days, the effects of different small molecule compounds on the expression of BMMSC osteogenic differentiation-related genes and protein markers (ALP, BSP and SP7) were detected by qRT-PCR and Western blot. It was found that only GDP-Man could improve the osteogenic differentiation damage of BMMSCs from T2DM rats.

[0114] 6. Molecular dynamics simulation to verify the interaction between GDP-Man and TGM2 protein

[0115] Gromacs 2022 software was used to perform molecular dynamics simulations on the complex of TGM2 protein and ligand as well as pure TGM2 protein. Amber14sb was selected as the protein force field, Gaff2 was selected as the ligand force field, and the SPC / E water model was used to add solvent to the protein-ligand system and establish a water box with a periodic boundary of 1.2 nm. The particle mesh (PME) method was used to calculate long-range electrostatic interactions, and the Monte Carlo ion placement method was used to introduce an appropriate number of sodium ions and chloride ions to neutralize the charge of the entire system. Before the formal simulation, the system energy was minimized and balanced by performing the following three steps: (1) The energy of each system was minimized using the steepest descent algorithm for 50,000 steps. (Stop minimization when the maximum force < 1000 kJ / mol). (2) Keeping the number of particles, volume and temperature constant (from 0 to 310 K and maintaining), each system was pre-balanced for 50,000 steps with a step size of 2 fs. (3) Keeping constant the number of particles, pressure (one atmosphere) and temperature (310K), the whole system was pre-equilibrated for 50,000 steps with a step size of 2 fs. After the system energy was minimized and balanced, a molecular dynamics simulation was performed for 100 ns with a step size of 2 fs without any constraints, and the structural coordinates were saved every 10 ps.

[0116] The root mean square deviation (RMSD) and root mean square fluctuation (RMSF) in the molecular dynamics simulation trajectories of the complex of TGM2 protein and ligand and pure TGM2 protein were analyzed.

[0117] 7. In vitro transglutaminase activity experiment verifies the effect of small molecule compound GDP-Man on TGM2 enzyme activity

[0118] ① The total protein of BMMSCs was collected by lysis with NP-40 lysis buffer. ② The recombinant TGM2 protein was synthesized by Qingke Biotechnology, and the recombinant TGM2 protein (100 μg / mL) was incubated with different concentrations of GDP-Man (0.78-50 μM) at 4°C for 1 h. ③ The reaction buffer was prepared by mixing 2 mM BPA, 40 mM CaCl 2, 40mM dithiothreitol and 1M Tri-HCl buffer (pH=8.0) were fully mixed to prepare the reaction buffer. ④ 10μL GDP-Man / TGM2 complex and 10μL BMMSCs lysate were fully mixed with 180μL reaction buffer, incubated at 37℃ for 20min, added protein tracer loading buffer, and boiled at 98℃ to terminate the reaction. ⑤ In vitro transglutaminase activity assessment: Western blot analysis of biotinylated protein content was performed using horseradish peroxidase-labeled Streptavidin. The results showed that as the concentration of GDP-Man increased, the transglutaminase activity of TGM2 also increased.

[0119] 8. In vivo experiments to evaluate the effect of GDP-Man on bone defect regeneration in T2DM rats

[0120] The above experimental results have confirmed that GDP-Man can effectively increase the expression level of TGM2 protein and its enzyme activity in BMMSCs, and effectively improve the damage of BMMSC osteogenic differentiation under diabetic conditions. Next, the present invention will study the therapeutic effect of GDP-Man in the lateral femoral condyle bone defect model of T2DM rats.

[0121] 8.1 Preparation of GDP-Man@GelMA drug delivery system

[0122] GDP-Man@GelMA was prepared by adding GDP-Man (concentration of 100 μM) to methacryloyl gelatin with an amino substitution degree of 60%. In vitro gelation experiments and drug sustained release experiments were conducted, and the results showed that the addition of GDP-Man did not affect the gelation properties of GDP-Man@GelMA, and it had the sustained release function of GDP-Man.

[0123] 8.2 Construction of bone defect model in T2DM rats

[0124] Under sterile conditions, a lateral femoral condyle bone defect model was constructed using a T2DM rat model. ① After general anesthesia with 3-4% isoflurane, the hair at the surgical site was shaved and disinfected, the skin was incised, the muscles were bluntly separated, and the distal femur was exposed. ② A cylindrical defect with a diameter of 2.5 mm and a depth of 3 mm was milled out in the lateral femoral condyle using a slow-speed handpiece. ③ The defect site did not receive any treatment as the blank group (Control group), the control group (GelMA group) that received pure GelMA, and the experimental group (GDP-Man@GelMA group) that received GDP-Man@GelMA, with at least 3 rats in each group. ④ After UV cross-linking for 30 seconds, the surgical part was sutured in layers, and penicillin was injected continuously for 3 days after surgery to prevent infection.

[0125] 8.3 Evaluation of GDP-Man@GelMA biocompatibility

[0126] On the 28th day after surgery, the main organs of the rats, including liver, spleen, lung, heart, and kidney, were collected for hematoxylin-eosin (H&E) staining to evaluate the in vivo biocompatibility of GDP-Man@GelMA. The results showed that GDP-Man@GelMA had no toxicity to important organs.

[0127] 8.4 Evaluation of Bone Defect Regeneration in Rats

[0128] On the 7th day after surgery, rats were intraperitoneally injected with calcein dye; on the 21st day after surgery, rats were intraperitoneally injected with alizarin red dye. On the 28th day after surgery, femoral samples of rats were collected. ① Micro-CT was used to reconstruct 3D images to evaluate the new bone tissue at the defect site. ② The femur was prepared into a hard tissue membrane, and confocal laser microscopy was used to evaluate the new bone tissue at different stages of 7-21d and 21-28d. ③ The results showed that compared with the blank group (Control group) and the control group (GelMA group), the experimental group (GDP-Man@GelMA group) had more new bone tissue at the defect site.

[0129] 9. Experimental Results

[0130] Figure 1 This is the test result diagram of mRNA microarray chip screening of differentially expressed mRNAs in BMMSCs from normal rats and T2DM rats. BMMSCs from normal rats and T2DM rats were subjected to osteogenic differentiation, and the volcano plot of differentially expressed mRNAs in BMMSCs from two different sources (P<0.05 and Fold change>=1.5 were considered to be statistically different, red indicates up-regulated mRNAs, and green indicates down-regulated mRNAs).

[0131] Figure 2 This is a graph showing the test results of mRNA molecules screened out by low-throughput qRT-PCR. The mRNA molecules screened out by high-throughput were verified. The qRT-PCR results of TGM2 were consistent with the chip results in terms of change trend, and the change multiple was the highest.

[0132] Figure 3 In order to verify the expression trend result diagram of TGM2 by Western blot, the protein level of TGM2 was verified, which was inconsistent with the trend of chip and qRT-PCR results. The protein level of TGM2 was significantly reduced in BMMSCs derived from T2DM rats.

[0133] Figure 4The results of the effect of silencing TGM2 on the osteogenic differentiation of BMMSCs from type 2 diabetic rats are shown in Figure 2. After siRNA transfection of BMMSCs, qRT-PCR was used to detect the expression of the TGM2 gene in BMMSCs, confirming that siRNA can successfully transfect BMMSCs and silence the expression of TGM2. After si-TGM2 interfered with BMMSCs from T2DM rats, the silencing of TGM2 (si-TGM2) significantly inhibited the expression levels of osteogenic-related genes and proteins in BMMSCs compared with the control group (si-NC).

[0134] Figure 5 This figure shows the effect of overexpression of TGM2 on the osteogenic differentiation of BMMSCs derived from normal rats. After successfully verifying the overexpression effect of the TGM2 overexpression plasmid, compared with the control group (ov-NC), the overexpression of TGM2 (ov-TGM2) significantly promoted the expression levels of osteogenic differentiation-related genes in BMMSCs derived from normal rats.

[0135] Figure 6 The following is the detailed information of the 37 small molecule compounds screened in the present invention.

[0136] Figure 7 This is a test result diagram for evaluating the cytotoxicity of small molecule compounds. The CCK-8 reagent was used to detect the cytotoxicity of different small molecule compounds, and small molecule compounds that had a significant inhibitory effect on the proliferation of BMMSCs were excluded.

[0137] Figure 8 This is a test result diagram of the effect of small molecule compounds on the expression level of BMMSC TGM2 protein. Western blot was used to verify the effect of different small molecule compounds on the expression level of BMMSC TGM2 protein after treatment, and small molecule compounds (Salvianolic acid C, Glycol chitosan and GDP-Man) that can significantly increase the expression level of TGM2 protein were screened out.

[0138] Fig. 9 This is a test result of the effect of small molecule compounds on the osteogenic differentiation of BMMSCs derived from T2DM rats. Compared with the control group (CON group), the GDP-Man treatment group (GDP-Man group) significantly improved the expression level of osteogenic differentiation-related genes in BMMSCs derived from T2DM rats.

[0139] Fig.10 This is the result of molecular dynamics simulation to verify the interaction between GDP-Man and TGM2 protein. The RMSD curves of TGM2 pure protein and TGM2 / GDP-Man complex have no obvious fluctuations, and the RMSF curves are almost overlapping, indicating that the complex formed by GDP-Man and TGM2 protein has good stability.

[0140] Fig.11 This is the result diagram of the effect of GDP-Man on TGM2 transglutaminase activity. In the in vitro transglutaminase activity experiment, with the increase of GDP-Man concentration, TGM2 transglutaminase activity increased and the expression of biotinylated protein increased.

[0141] Fig.12 This is a graph showing the gelation and sustained-release function test results of GelMA hydrogel loaded with GDP-Man. 100 μM GDP-Man was added to the GelMA hydrogel to prepare GDP-Man@GelMA, which has good gelation properties and sustained-release effects of GDP-Man.

[0142] Fig.13 The results of the in vivo experiment evaluating the effect of GDP-Man on bone defect regeneration in rats with type 2 diabetes successfully evaluated the good biocompatibility of GDP-Man@GelMA. Compared with the blank group (Control group) and the control group (GelMA group), the experimental group (GDP-Man@GelMA group) had more new bone tissue at the defect site.

[0143] Various embodiments of the present invention may be presented in the form of a range; it should be understood that the description in the form of a range is only for convenience and brevity, and should not be understood as a rigid limitation on the scope of the present invention; therefore, the range description should be considered to have specifically disclosed all possible sub-ranges and single numerical values ​​within the range. For example, the range description from 1 to 6 should be considered to have specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 3, 4, 5 and 6, which apply regardless of the range. In addition, whenever a numerical range is indicated herein, it is meant to include any cited number (fractional or integer) within the indicated range.

[0144] The foregoing is merely a specific embodiment of the present invention, which enables those skilled in the art to understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features claimed herein.

Claims

1. An agonist targeting TGM2, characterized in that The agonist targeting TGM2 includes GDP-D-Mannose or its tautomer, stereoisomer, pharmaceutically acceptable salt, hydrate or solvate.

2. The agonist targeting TGM2 according to claim 1, characterized in that The agonist targeting TGM2 is GDP-D-Mannose.

3. The agonist targeting TGM2 according to any one of claims 1 to 2, characterized in that The TGM2-targeted agonist can target TGM2 and increase its protein expression level and enzyme activity.

4. Use of the TGM2-targeting agonist according to any one of claims 1 to 3 in the preparation of a drug for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and regeneration of bone defects in diabetic patients.

5. A drug for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients, characterized in that: The drug for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients comprises: 1) the agonist targeting TGM2 according to any one of claims 1 to 3; and 2) a pharmaceutically acceptable carrier or excipient.

6. A drug for treating bone defect regeneration in diabetic patients, characterized in that: The drug for treating bone defect regeneration in diabetic patients comprises: 1) the agonist targeting TGM2 according to any one of claims 1 to 3; and 2) a pharmaceutically acceptable carrier or excipient.

7. A drug delivery system for regulating the osteogenic differentiation potential of BMMSCs in diabetic patients and the regeneration of bone defects in diabetic patients, characterized in that: The drug delivery system for regulating the osteogenic differentiation potential of BMMSCs of diabetic patients and the regeneration of bone defects in diabetic patients comprises: 1) the agonist targeting TGM2 according to any one of claims 1 to 3; and 2) a pharmaceutically acceptable carrier or excipient.

Images