Application of willow natural resistance related macrophage protein SsNramp1 in cadmium-contaminated soil remediation genetic engineering

Abstract

The invention discloses an application of a willow natural resistance related macrophage protein SsNramp1 in cadmium contaminated soil remediation genetic engineering. The willow SsNramp1 disclosed by the invention has the activity of transporting cadmium, and the SsNramp1 is a membrane transport protein positioned on a plasma membrane. After an agrobacterium tumefaciens mediated genetic transformation technology and a 35S strong promoter are utilized to start SsNramp1 to express the protein in tobacco, in a cadmium exposure environment, compared with a wild type, the growth of the tobacco with the transgenic SsNramp1 gene is not obviously influenced, the cadmium concentration of the root system is increased by 64%-128%, and the cadmium concentration of the overground part is increased by 35%-51%. The invention shows that the willow SsNramp1 has important significance in the remediation engineering of the cadmium-polluted soil.

Description

Technical Field

[0001] The invention relates to genetic engineering technology, and in particular to a willow natural resistance-related macrophage protein SsNramp1 used for remediation of cadmium-contaminated soil and an application thereof. Background Art

[0002] Soil cadmium pollution is a major environmental problem facing the world, which seriously endangers soil quality and human health. Phytoremediation is the process of removing heavy metals from soil by plant fixation, volatilization, filtration and extraction. It has been widely used in soil heavy metal pollution remediation because of its low cost, environmental friendliness and in-situ remediation. Willow grows rapidly, has strong adaptability, large biomass, and high cadmium absorption capacity. Studies have shown that willow can effectively remove 30-50% of cadmium in the soil. It has been widely used in cadmium-contaminated soil remediation projects at home and abroad. Genetic transformation is an efficient and targeted plant breeding method. There is great potential to enhance the cadmium absorption capacity of willow through genetic engineering. So far, the key genes and their functions responsible for the cadmium absorption process of willow are still unclear, which has become a bottleneck that needs to be broken through to further improve the efficiency of willow remediation. Therefore, exploring and analyzing the biological functions of the key genes responsible for willow cadmium absorption can not only clarify the molecular mechanism of willow cadmium absorption, but also provide important genetic resources for improving the remediation capacity of willow by genetic engineering, which has important practical potential. Summary of the invention

[0003] Purpose of the invention: In order to solve the above technical problems, the present invention provides the application of willow natural resistance-related macrophage protein SsNramp1 in cadmium-contaminated soil remediation, providing important gene resources for using genetic engineering to improve the efficiency of plants such as willow and tobacco in remediating cadmium pollution in soil.

[0004] Technical solution: In order to achieve the above-mentioned purpose, the willow natural resistance-related macrophage protein gene used for cadmium-contaminated soil remediation described in the present invention is SsNramp1, and the SsNramp1 gene sequence is shown in SEQ ID NO 1.

[0005] Analysis of the expression pattern of SsNramp1 in willow, using SsEF1α in willow as the internal reference gene, and the primer sequences are:

[0006] SsEF1a-F (SEQ ID NO 2):TGAAGAACGGAGATGCTGGT

[0007] SsEF1a-R (SEQ ID NO 3):TTGGCAGCAGATTTGGTCAC

[0008] SsNramp1-F (SEQ ID NO 4):GTGGCATTAACGATGCCTGT

[0009] SsNramp1-R (SEQ ID NO 5): TAGCTGAGCAAACAGTCCCA.

[0010] To verify the heterologous function of willow SsNramp1 in yeast, the restriction enzyme cleavage site analysis was performed on the coding region sequence of the SsNramp1 gene, and the PCR amplification primers with restriction enzyme cleavage sites were designed as follows:

[0011] SsNramp1-F (SEQ ID NO 6):AAGCTTTATGGCTGCTGAAAAAGTT

[0012] SsNramp1-R (SEQ ID NO 7): GAATTCCTAGCTCTGAACACCATCT.

[0013] Subcellular localization analysis of SsNramp1. DNAMAN software was used to analyze the restriction enzyme sites in the coding region of the SsNramp1 gene, and PCR amplification primers containing two restriction enzyme sites, Hind III and EcoR I, were designed:

[0014] pSAT6-EGFP-C1

[0015] GFP-SsNramp1-F (SEQ ID NO 8): AAGCTTCCATGGCTGCTGAAAAAGTT

[0016] GFP-SsNramp1-R (SEQ ID NO 9):GAATTCCTAGCTCTGAACACCATC;

[0017] Using the intermediate expression vector plasmid containing the SsNramp1 gene fragment as a template, homologous recombination primers were designed according to the pRCS2-2288 vector sequence:

[0018] PF(SEQ ID NO 10):ACCACCCATAATACCCATAATAGCTGTTTTGCCAACC

[0019] PR (SEQ ID NO 11): CGATGGCAAACAGCTATTATGGGTATTATGGGTCG.

[0020] SsNramp1 transgenic tobacco, design of PCR amplification primers:

[0021] SsNramp1-F (SEQ ID NO 12):

[0022] CGGGGATCCTCTAGAGTCGACATGGCTGCTGAAAAAGTTTCTTC

[0023] SsNramp1-R (SEQ ID NO 13):

[0024] GTGATTTTTGCGGACCTGCAGCTAGCTCTGAACACCATCTATTCTGG.

[0025] Transgenic tobacco expressing willow SsNramp1 was constructed through genetic engineering to improve the ability of transgenic plants to enrich soil heavy metal cadmium.

[0026] The vector of willow SsNramp1 of the present invention.

[0027] Furthermore, the vector is a vector that connects the target gene fragment to the expression vector pCAMBIA1305.

[0028] The cell line or host bacteria expressing willow SsNramp1 of the present invention.

[0029] Furthermore, the host bacteria is Agrobacterium tumefaciens.

[0030] The willow SsNramp1, the expression vector, the vector or the host bacteria of the present invention are used in improving plant enrichment of soil heavy metal cadmium.

[0031] The willow transporter gene SsNramp1, the expression cassette, the vector or the host bacteria of the present invention are used in cultivating transgenic plants capable of accumulating soil heavy metal cadmium.

[0032] The invention discloses an application of transgenic tobacco expressing the willow transporter gene SsNramp1 in improving the transgenic plant's enrichment of soil heavy metal cadmium.

[0033] Furthermore, the transgenic tobacco with the willow transporter gene SsNramp1 improves the transgenic plant's ability to enrich soil heavy metal cadmium, including the following steps:

[0034] (1) constructing the expression vector of the willow SsNramp1;

[0035] (2) transforming the constructed willow SsNramp1 expression vector into plants;

[0036] (3) Cultivate, screen and obtain transgenic plants that enrich soil heavy metal cadmium.

[0037] Furthermore, the plant is tobacco.

[0038] Transgenic tobacco expressing willow SsNramp1 was constructed by genetic engineering. The SsNramp1 transgenic plant materials include Nramp1-Ex1, Nramp1-Ex2, Nramp1-Ex3, and Nramp1-Ex4.

[0039] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0040] The willow SsNramp1 of the present invention has the activity of transporting cadmium, and SsNramp1 is a membrane transport protein located on the cytoplasmic membrane. After SsNramp1 was expressed in tobacco using Agrobacterium tumefaciens-mediated genetic transformation technology and a 35S strong promoter, the growth of tobacco expressing SsNramp1 was not significantly affected compared with the wild type under cadmium exposure conditions, and the cadmium concentration of the root system of the transgenic plant increased by 64%-128%, and the cadmium concentration of the aboveground part increased by 35%-51%, indicating that willow SsNramp1 is of great significance in the remediation of cadmium-contaminated soil. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 :Analysis of gene expression patterns of SsNramps family in willow;

[0042] Figure 2 : Functional validation of willow SsNramps in yeast heterologous system;

[0043] Figure 3 :Subcellular localization analysis of SsNramp1 and SsNramp5 in willow;

[0044] Figure 4 :Creation and identification of SsNramp1 and SsNramp5 transgenic tobacco plants;

[0045] Figure 5 :Analysis on the cadmium accumulation ability of SsNramp1 and SsNramp5 transgenic plants under cadmium exposure environment.

[0046] WT and Trans(-) in the above figures represent wild-type and transgenic negative seedlings of transgenic tobacco, respectively. Nramp1-Ex1, Nramp1-Ex2, Nramp1-Ex3, and Nramp1-Ex4 represent four transgenic materials driven by 35S promoter to drive SsNramp1, respectively. Nramp5-Ex1, Nramp5-Ex2, Nramp5-Ex3, and Nramp5-Ex4 represent four transgenic materials driven by 35S promoter to drive SsNramp5, respectively. DETAILED DESCRIPTION

[0047] Example 1

[0048] Analysis of gene expression patterns of SsNramps family in willow

[0049] The gene sequences of the willow SsNramps family are as follows:

[0050] SsNramp1 (SEQ ID NO 1), SsNramp2 (SEQ ID NO 14), SsNramp3 (SEQ ID NO 15), SsNramp4 (SEQ ID NO 16), SsNramp5 (SEQ ID NO 17), SsNramp6 (SEQ ID NO 18).

[0051] Willow cuttings with a length of 12 cm and a diameter of 0.8 cm were selected and fixed aerated hydroponics was used. After the cuttings took root, the willow cuttings were cultured in 1 / 4 Hoagland nutrient solution, and the nutrient solution was replaced every 3 days. After 5-week-old Salixsuchowensis seedlings were treated with 0Cd and 20μM Cd for 24 hours, the roots, stems, new leaves and old leaves were collected and stored in a -80°C refrigerator. The MiniBEST Plant RNA Extraction Kit (Takara) kit was used to extract total RNA from each part, and the PrimeScriptRT kit was used to reverse transcribe cDNA. After the ChamQ SYBR qPCR Master Mix kit was used to quantitatively amplify the gene, Real-Time PCR was used to detect the expression of SsNramp1-6 genes, with willow SsEF1α as the internal reference gene. Specific quantitative primers were designed according to the gene sequence, and the primer sequences are shown in SEQ ID NOs 2-5, 19-28, respectively:

[0052]

[0053] According to the Ct values ​​of the internal reference genes and SsNramps family genes, -ΔCt The gene expression levels were calculated. The results showed that SsNramp1-6 was expressed in willow roots, stems, new leaves and old leaves ( Figure 1 A). The expression abundance of SsNramps in leaves is much higher than that in roots, and the expression levels of SsNramp4 and SsNramp5 are higher than those of other SsNramps ( Figure 1 BE). In the root system, SsNramp5 expression was the highest ( Figure 1 B). In the stem, the expression abundance of SsNramp4-6 was higher than that of SsNramp1-3, among which SsNramp3 was upregulated by Cd ( Figure 1C). In addition, SsNramps showed different expression patterns between new leaves and old leaves. The expression abundance of SsNramps in old leaves was higher than that in new leaves. SsNramp1 was upregulated in new leaves under Cd induction ( Figure 1 DE).

[0054] Example 2

[0055] Functional validation of willow SsNramps family proteins in a yeast heterologous system

[0056] DNAMAN8.0 was used to analyze the restriction enzyme cleavage sites of the coding region sequence of the SsNramps gene, and PCR amplification primers containing restriction enzyme cleavage sites were designed:

[0057]

[0058]

[0059] Using willow root or leaf cDNA as a template, PCR amplification with high-fidelity enzyme 2×Phanta Max Master Mix (DyePlus) (Vazyme, China) was used to obtain the complete coding region of SsNramp1 / 2 / 4 / 5 containing restriction sites. After double enzyme digestion, it was ligated to the yeast expression vector pYES2 (Tan, L., Qu, M., Zhu, Y., Peng, C., Wang, J., Gao, D., et al., 2020. ZINC TRANSPORTER5 and ZINC TRANSPORTER9 function synergistically in zinc / cadmium uptake. Plant Physiol 183, 1235–1249.) with T4 ligase (TransGen, China). After sequencing verification, it was saved for later use. Prepare competent cells according to the instructions of YeastmakerYeast Transformation Kit (TaKaRa, Japan), and transfer the empty vector and the expression vector containing the target gene to the wild-type strain BY4741 of Saccharomyces cerevisiae (Tan, L., Qu, M., Zhu, Y., Peng, C., Wang, J., Gao, D., et al., 2020. ZINC TRANSPORTER5 and ZINC TRANSPORTER9 function synergistically in zinc / cadmium uptake. Plant Physiol 183, 1235–1249.). Pick a single yeast colony and culture it in liquid SD-Ura medium until the logarithmic growth phase, then aggregate the cells to remove the supernatant, wash with sterile water 3-5 times, and adjust the OD 600 to 1.0, and then dilute the four concentration gradients at a ratio of 1:10, and dot the plate with different concentrations of cadmium for a dot experiment. The plate was cultured at 30℃ for 3 days, and the yeast growth was recorded by taking photos. The results showed that Figure 2 As shown, with the increase of cadmium concentration in the culture medium, yeast strains transformed with empty pYES2, SsNramp2, SsNramp4 and SsNramp6 were still able to grow, while yeast strains transformed with SsNramp1 and SsNramp5 were inhibited to varying degrees in the culture medium containing 30 μM CdCl2, indicating that SsNramp2, SsNramp4 and SsNramp6 do not have the activity of transporting cadmium, while SsNramp1 and SsNramp5 have the activity of transporting cadmium in yeast cells.

[0060] Example 3

[0061] Subcellular localization analysis of SsNramp1 and SsNramp5 in willow

[0062] DNAMAN software was used to analyze the restriction enzyme sites in the coding regions of SsNramp1 and SsNramp5 genes, and PCR amplification primers containing Hind III and EcoR I restriction enzyme sites were designed:

[0063] pSAT6-EGFP-C1

[0064] GFP-SsNramp1-F (SEQ ID NO 8): AAGCTTCCATGGCTGCTGAAAAAGTT

[0065] GFP-SsNramp1-R (SEQ ID NO 9):GAATTCCTAGCTCTGAACACCATC

[0066] pSAT6-EGFP-N1

[0067] SsNramp5-GFP-F (SEQ ID NO 37):AAGCTTTATGTCTTTAGATGAAAACCAGC

[0068] SsNramp5-GFP-R (SEQ ID NO 38): GAATTCTCTGTTTAGGTGGGCCG

[0069] Willow cDNA was used as a template and PCR amplification was performed using the high-fidelity enzyme 2×PhantaMax Master Mix (Dye Plus) (Vazyme, China). The PCR product was purified by gel recovery and cloned into pCE2 TA / Blunt-Zerocloning Vector (C601, vazyme, China). The correctly sequenced plasmid was double-digested and connected to the intermediate vectors pSAT6-EGFP-C1 and pSAT6-EGFP-N1 (Chang, MX, Gu, M., Xia, YW, Dai, XL, Dai, CR, Zhang, J., et al., 2019. OsPHT1; 3 mediates uptake, translocation, and remobilization of phosphate under extremely low phosphate regimes. Plant Physiol 179, 656–670.) to obtain the recombinant plasmid with GFP fused to the C-terminus and N-terminus of the target gene. Using the intermediate expression vector plasmid containing SsNramp1 and SsNramp5 gene fragments as a template, homologous recombination primers were designed according to the pRCS2-2288 vector (Chang, MX, Gu, M., Xia, YW, Dai, XL, Dai, CR, Zhang, J., et al., 2019. OsPHT1; 3 mediates uptake, translocation, and remobilization of phosphate under extremely low phosphate regimes. Plant Physiol 179, 656–670.) sequence:

[0070] pF(SEQ ID NO 10):ACCACCCATAATACCCATAATAGCTGTTTTGCCAACC

[0071] pR(SEQ ID NO 11):CGATGGCAAACAGCTATTATGGGTATTATGGGTCG

[0072] After PCR amplification, the product was recovered and connected to the expression vector pRCS2-2288 using ClonExpress II One Step Cloning Kit (C112-01, Vazyme, China). At the same time, a marker expression vector pm-rbCD3-1008 located at the cell membrane was constructed (Nelson, BK, Cai, X., Nebenfuhr, A., 2007. A multicolored set of invivo organelle markers for co-localization studies in Arabidopsis and other plants. Plant J 51, 1126–1136). The obtained recombinant plasmid was verified to be correct by sequencing and stored for future use.

[0073] The empty expression vector, the expression vector connected with the target gene, and the pm-rbCD3-1008 plasmid were respectively transferred into Agrobacterium GV3101 competent cells (TSC-A01, Tsingke, China), ice-bathed for 30 min, frozen in liquid nitrogen for 5 min, heat-shocked at 37°C for 5 min, added to LB liquid medium, and cultured at 28°C, 200 rpm for 5 h. Agrobacterium containing functional plasmids was selected using Spec, Str and Rif resistance. Agrobacterium monoclone was inoculated into LB liquid medium containing antibiotics and cultured with shaking at 28℃ until the OD600 of the bacterial solution reached 0.8-1.0. The bacterial cells were collected by centrifugation and suspended in 1mL of Induction medium (10mM MES, 10mM MgCl2 and 200μMacetosyringone). The OD600 was diluted to between 0.1-0.2 and injected into tobacco leaves through the lower epidermis. After culturing in the dark for 2-3 days, the fluorescence signal was observed with a laser confocal microscope. The excitation wavelength of GFP was 488nm and that of RFP was 561nm. Figure 3 As shown in the figure, the results of transient expression studies in tobacco leaf epidermal cells showed that after SsNramp1 and SsNramp5 were fused with GFP to infect tobacco, fluorescence signals were detected in tobacco epidermal cells, and the signals coincided with the red fluorescence signals emitted by the plasma membrane marker, indicating that SsNramp1 and SsNramp5 are both located on the plasma membrane and are membrane transporters that mediate cadmium transmembrane transport in willow.

[0074] Example 4

[0075] Creation and identification of SsNramp1 and SsNramp5 transgenic tobacco plants

[0076] 1. Creation of SsNramp1 and SsNramp5 transgenic tobacco plants

[0077] Design primers:

[0078] SsNramp1-F (SEQ ID NO 12):

[0079] CGGGGATCCTCTAGAGTCGACATGGCTGCTGAAAAAGTTTCTTC

[0080] SsNramp1-R (SEQ ID NO 13):

[0081] GTGATTTTTGCGGACCTGCAGCTAGCTCTGAACACCATCTATTCTGG

[0082] SsNramp5-F (SEQ ID NO 39):

[0083] CGGGGATCCTCTAGAGTCGACATGTCTTTAGATGAAAACCAGCAACC

[0084] SsNramp5-R (SEQ ID NO 40):

[0085] GTGATTTTTGCGGACCTGCAGCTATCTGTTTAGGTGGGCCGC

[0086] Using the cDNA of Salix pseudostellaria leaves as a template, PCR was performed with the high-fidelity enzyme 2×Phanta Max Master Mix (Dye Plus) (Vazyme, China), and the homologous arms were cloned into the CDS sequences of SsNramp1 and SsNramp5 to amplify the complete coding regions of SsNramp1 and SsNramp5. After purification, the obtained PCR products were ligated to the expression vector pCAMBIA1305 (Chang, MX, Gu, M., Xia, YW, Dai, XL, Dai, CR, Zhang, J., et al., 2019. OsPHT1; 3 mediates uptake, translocation, and remobilization of phosphate under extremely low phosphate regimes. Plant Physiol 179, 656–670.) to obtain the recombinant plasmid, which was transferred into Agrobacterium tumefaciens GV3101 (TSC-A01, Tsingke, China). Agrobacterium tumefaciens was used to infect tobacco, and the target gene fragment was integrated into the tobacco genome to obtain transgenic tobacco plants expressing SsNramp1 and SsNramp5.

[0087] II. Identification of SsNramp1 and SsNramp5 transgenic tobacco plants

[0088] The expression levels of SsNramp1 and SsNramp5 genes in wild-type, negative seedlings and SsNramp1 / SsNramp5 transgenic tobacco plants were detected by hygromycin screening and DNA verification. Figure 4 As shown, in the wild-type and negative tobacco plants, the SsNramp1 and SsNramp5 genes were hardly expressed, while their expression levels were significantly higher in transgenic tobacco, indicating that SsNramp1 and SsNramp5 were successfully introduced into the model plant tobacco, and 4 overexpression strains were obtained, named Nramp1-Ex1, Nramp1-Ex2, Nramp1-Ex3, Nramp1-Ex4 and Nramp5-Ex1, Nramp5-Ex2, Nramp5-Ex3, Nramp5-Ex4.

[0089] Example 5

[0090] Analysis of cadmium absorption and accumulation ability of SsNramp1 and SsNramp5 transgenic plants

[0091] Natural cadmium contaminated soil arrangement experiment:

[0092] When the wild type and transgenic plants obtained in Example 4 had 4-5 leaves, they were transferred to natural cadmium-contaminated soil with a Cd concentration of 6.46 mg / kg for cultivation. Water was irrigated every 2 days, and the field water holding capacity of the soil was maintained at about 60%. After growing in the cadmium exposure environment for one month, photos were taken to record the growth of the plants. The tobacco roots were rinsed in 0.5 mM CaCl2 for 5 min, and then rinsed with deionized water to remove the Cd on the surface. The roots and aboveground parts of the plants were collected, dried in an oven at 70°C to constant weight, weighed and ground, and the Cd concentration in the tissues was determined using an inductively coupled plasma mass spectrometer (ICP-OES). The results showed that Figure 5 As shown in AC, there was no significant difference in the fresh weight and dry weight of SsNramp1 and SsNramp5 transgenic plants compared with the wild type, indicating that SsNramp1 and SsNramp5 did not affect plant growth. Figure 5 As shown in Figure 5D, compared with the wild type, the transgenic plants expressing SsNramp1 accumulated higher concentrations of Cd in both the roots and aboveground parts. The cadmium concentration in the roots increased by 64%-128%, and the cadmium concentration in the aboveground tissues increased by 35%-51%. However, there was no significant difference in the cadmium concentration in the tissues of the transgenic plants expressing SsNramp5 between the wild type and the plants. This indicates that the expression of willow SsNramp1 can significantly enhance the absorption and accumulation of cadmium in plants and is an excellent candidate gene for phytoremediation.

Claims

1. Willow natural resistance-related macrophage protein gene SsNramp1 for cadmium-contaminated soil remediation, characterized in that: The SsNramp1 gene CDS sequence is shown as SEQ ID NO 1.

2. The use according to claim 1, characterized in that: For the analysis of the expression pattern of willow SsNramp1, willow SsEF1a was used as the internal reference gene, and the primer sequences were designed as follows: SsEF1a-F (SEQ ID NO 2):TGAAGAACGGAGATGCTGGT SsEF1a-R (SEQ ID NO 3):TTGGCAGCAGATTTGGTCAC SsNramp1-F (SEQ ID NO 4):GTGGCATTAACGATGCCTGT SsNramp1-R (SEQ ID NO 5): TAGCTGAGCAAACAGTCCCA.

3. The use according to claim 1, characterized in that: For the verification of the heterologous function of the willow SsNramp1 yeast, the restriction enzyme site analysis was performed on the SsNramp1 coding region sequence, and the PCR amplification primers containing two restriction enzyme sites, Hind III and EcoR I, were designed as follows: SsNramp1-F (SEQ ID NO 6):AAGCTTTATGGCTGCTGAAAAAGTT SsNramp1-R (SEQ ID NO 7): GAATTCCTAGCTCTGAACACCATCT.

4. The use according to claim 1, characterized in that: For the subcellular localization analysis of SsNramp1, the restriction enzyme site analysis was performed on the coding region of the SsNramp1 gene, and the PCR amplification primers containing two restriction enzyme sites, Hind III and EcoR I, were designed as follows: pSAT6-EGFP-C1 GFP-SsNramp1-F (SEQ ID NO 8): AAGCTTCCATGGCTGCTGAAAAAGTT GFP-SsNramp1-R (SEQ ID NO 9):GAATTCCTAGCTCTGAACACCATC; Using the intermediate expression vector plasmid containing the SsNramp1 gene fragment as a template, homologous recombination primers were designed: pF(SEQ ID NO 10):ACCACCCATAATACCCATAATAGCTGTTTTGCCAACC pR (SEQ ID NO 11): CGATGGCAAACAGCTATTATGGGTATTATGGGTCG.

5. The use according to claim 1, characterized in that: The primers used to create the SsNramp1 transgenic tobacco are: SsNramp1-F (SEQ ID NO 12): CGGGGATCCTCTAGAGTCGACATGGCTGCTGAAAAAGTTTCTTC SsNramp1-R (SEQ ID NO 13): GTGATTTTTGCGGACCTGCAGCTAGCTCTGAACACCATCTATTCTGG.

6. A vector containing the willow transporter gene SsNramp1 according to claim 1.

7. The carrier according to claim 6, characterized in that The vector is to connect the target gene fragment to the expression vector pCAMBIA1305.

8. Use of the willow transporter gene SsNramp1 according to claim 1 or the vector according to claim 6 in improving plant enrichment of soil heavy metal cadmium.

9. Use of the willow transporter gene SsNramp1 according to claim 1 or the vector according to claim 6 in cultivating transgenic plants capable of enriching soil heavy metal cadmium.

10. The use according to claim 8 or 9, characterized in that: The plant is tobacco or willow.

Images