Application of rice OsHAK22 gene in regulating tolerance of rice drought stress

Abstract

The invention discloses an application of a rice OsHAK22 gene in regulating tolerance of rice drought stress. The invention discloses a high-affinity potassium ion transporter coding gene OsHAK22, and the sequence of the high-affinity potassium ion transporter coding gene OsHAK22 is shown as SEQ ID NO. The gene can be applied to the aspects of controlling drought stress tolerance of rice and the like. The biological function of the high-affinity potassium ion transporter coding gene OsHAK22 in rice is found through a large number of experiments, and after the gene is over-expressed, the drought stress tolerance of the rice in the seedling stage and the booting stage can be enhanced; after the gene is knocked out, the rice is sensitive to drought stress in the seedling stage and the booting stage.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to the application of a rice low-potassium response high-affinity potassium ion transporter encoding gene OsHAK22 in drought stress tolerance. Background Art

[0002] Drought is one of the most common environmental conditions that causes a dramatic decline in plant growth and crop yield (Zhu, 2002). Throughout evolution, plants have acquired a range of strategies to avoid water shortages by reducing water loss or increasing water uptake. Even so, other strategies to prevent cell damage are necessary when water is depleted and tissues become dehydrated (Verslues et al., 2006). Under environmental stresses such as drought, the accumulation of reactive oxygen species (ROS) is essential (Verslues et al., 2006). In plant cells, ROS such as hydrogen peroxide (H2O2), hydroxyl radicals, and superoxides are produced through aerobic metabolism and, as harmful oxygen derivatives, they can damage lipids, nucleic acids, proteins, and carbohydrates, ultimately leading to cell death (Mittler et al., 2004). To reduce oxidative stress, organisms have evolved effective antioxidant defense mechanisms involving the induction of stress-related genes (Gasch et al., 2000; Desikan et al., 2002). The maintenance of cellular homeostasis in plant cells is usually achieved through ROS scavenging systems, mainly with the assistance of enzyme systems such as catalase (CAT) and peroxidases (POXs) (Mittler et al., 2004).

[0003] Potassium (K + ) is a major cation in plants and affects various aspects of crop production, including yield, tolerance to pathogens and abiotic stresses, including salt and drought (Ahmad et al., 2016b). + Nutrition is closely related to water homeostasis and water use efficiency (Kuchenbuch et al., 1986; Tanguilig et al., 1987). An important mechanism for plants to respond to drought stress is to absorb K. + Solutes such as (Andersen et al., 1992; Wang et al., 2004; Mahouachi et al., 2006). + The loss of α helps with osmotic regulation, maintains cell expansion, ensures proper stomatal regulation, and helps maintain photosynthetic activity through photosynthetic transport ( and Kirkby, 2010; et al., 2014), therefore, under stimulation conditions, K+ Regulation of transport is crucial.

[0004] The KT / HAK / KUP transporter has been predicted to play a key role in maintaining K + plays a key role in homeostasis ( et al., 2002; Gierth et al., 2005; Nieves-Cordones et al., 2007; Fulgenzi et al., 2008; Yang et al., 2014; Chen et al., 2015b; Li et al., 2017). In Arabidopsis, KUP6 subfamily transporters may play a role in balancing K in cell growth and drought stress. + HAK5 plays a key role in osmotic regulation (Osakabe et al., 2013). The perception of osmotic stress can trigger transient K + outflow (Brauer et al., 2016). Chen et al. found that the OsHAK1 transporter regulates the positive response of rice to drought stress (Chen et al., 2017). Therefore, how the KT / HAK / KUP transporter affects K + The mechanism by which rice responds to drought stress deserves further exploration. Summary of the invention

[0005] The purpose of the present invention is to provide an application of rice high-affinity potassium ion transporter encoding gene OsHAK22 in drought stress tolerance, mainly that overexpression material can increase rice tolerance to drought stress at the seedling stage and the booting stage, while knockout leads to reduced tolerance to drought stress at the seedling stage and the booting stage.

[0006] The purpose of the present invention is achieved through the following technologies:

[0007]

[0008] As a preferred embodiment of the present invention, overexpression of the rice high affinity potassium ion transporter encoding gene OsHAK22 can enhance rice tolerance to drought stress. Preferably, any one or more of the following:

[0009] (1) Increase the tolerance of rice seedlings to drought stress;

[0010] (2) increasing the potassium content of rice stems and leaf sheaths under drought stress during the rice booting stage;

[0011] (3) Improve the relative yield of rice under drought stress during the heading stage.

[0012] As a preferred embodiment of the present invention, knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22 will reduce the tolerance of rice to drought stress.

[0013] A recombinant expression vector containing the rice high-affinity potassium ion transporter encoding gene OsHAK22.

[0014] As a preferred embodiment of the present invention, the recombinant expression vector is obtained by inserting the rice high-affinity potassium ion transporter encoding gene OsHAK22 into the SacI and BamHI restriction sites of the starting vector pTCK303.

[0015] The recombinant expression vector is used to improve the tolerance of rice to drought stress.

[0016] As a preferred embodiment of the present invention, the recombinant expression vector is used to increase the relative yield of rice under drought stress, thereby improving the drought resistance of rice.

[0017] The invention relates to an application of knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22 in reducing the tolerance of rice to drought stress.

[0018] The knockout of the rice high-affinity potassium ion transporter encoding gene OsHAK22 is used to reduce the relative yield under drought stress, ultimately leading to high sensitivity of rice to drought stress.

[0019] As a preferred embodiment of the present invention, the knockout vector for knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22 is based on the pOs-sgRNA vector, and primers are designed and synthesized for the target sequences T1 (SEQ ID No.2: CCCACTCTACGTCTACTCCA) and T2 (SEQ ID No.3: CTGTTCGCGG TGCAGAGGTT) of the rice high-affinity potassium ion transporter encoding gene OsHAK 22. After annealing, the primers are inserted between the BsaI restriction sites of the basic vector to obtain a U3:: Spacer expression vector. The U3:: Spacer expression vector plasmid and the pH-Ubi-cas9-7 expression vector plasmid are then subjected to a gateway reaction to obtain an expression vector containing U3:: Spacer and Ubi:: Cas9 dual expression.

[0020] Beneficial effects of the present invention:

[0021] 1. In the present invention, for the first time in the world, a recombinant expression vector constructed by the rice high-affinity potassium ion transporter encoding gene OsHAK22 was found, which was transfected into the wild-type rice Nipponbare (Oryza sativa.ssp.

[0022] Japonica), we found that the tolerance of OsHAK22 overexpressing materials to drought stress at the seedling stage was significantly improved compared with that of wild-type rice.

[0023] 2. The OsHAK22 gene in the present invention is derived from rice. The constructed rice high-affinity potassium ion transporter encoding gene OsHAK22 plant expression vector can be directly used for Agrobacterium-mediated plant genetic transformation to obtain new germplasm that can enhance rice tolerance to drought stress.

[0024] 3. The overexpression of the OsHAK22 gene in the present invention can enhance the tolerance of rice to drought stress at the seedling and booting stages, and ultimately increase the relative yield of the crop by increasing the potassium absorption of the leaf sheath under drought stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Expression of OsHAK22 in different tissues of rice during the whole growth period

[0026] Figure 2 , OsHAK22 expression is upregulated by mannitol and ABA stress

[0027] Figure AB: OsHAK22 gene was affected by 120.4 g L -1Figure CD: The expression levels of OsHAK22 gene in the root and aboveground at different time points after Mannitol stress; Figure CD: The expression levels of OsHAK22 gene in the root and aboveground at different time points after 30 μM ABA stress.

[0028] Figure 3 The expression of OsHAK22 in different rice tissues is upregulated by drought stress

[0029] Figure 4 Differences in tolerance to drought stress among OsHAK22 overexpression, knockout and corresponding wild-type materials at the seedling stage

[0030] Figure 5 Leaf curling phenotypes of OsHAK22 overexpression, knockout and corresponding wild-type materials under drought stress

[0031] Figure 6 Figure A: Single plant yield of WT and OsHAK22 overexpression and knockout materials under drought stress; Figure B: Relative yield of WT and OsHAK22 overexpression and knockout materials under drought stress.

[0032] Figure 7 Potassium content in different tissues of WT, OsHAK22 overexpression, knockout and corresponding wild-type materials under drought stress. Figure A: Potassium content in roots of WT and OsHAK22 overexpression and knockout materials under drought stress; Figure B: Potassium content in stems and leaf sheaths of WT and OsHAK22 overexpression and knockout materials under drought stress; Figure C: Potassium content in leaves of WT and OsHAK22 overexpression and knockout materials under drought stress.

[0033] Figure 8 , map of pTCK303 expression vector.

[0034] Fig. 9 , pH-Ubi-cas9-7 and pOs-sgRNA vector maps. DETAILED DESCRIPTION

[0035] Example 1. Construction of OsHAK22 overexpression vector

[0036] According to the full-length ORF (open reading frame) sequence of the OsHAK22 gene, specific primers were designed using Primer 5.0 software (Table 1), and then SacI and BamHI were added to the 5' and 3' ends of the primers. The total RNA extracted from rice leaves was reverse transcribed into cDNA, and the cDNA was used as a template to amplify the OsHAK22 open reading frame sequence. The obtained PCR product was purified by gel recovery and connected to the pEASY-Blunt simple cloning vector, and then transferred to E. coli for overnight culture. The next day, the positive single clone was picked and shaken, the plasmid was extracted, and the enzyme digestion verification was performed before sending it to the company for sequencing verification. The clone vector plasmid and pTCK303 vector plasmid with correct sequencing were double-digested with restriction endonucleases SacI and BamHI, and the digestion products were gel recovered. Then the target gene and expression vector were subjected to T4 enzyme ligation reaction and transferred to E. coli for overnight culture. The next day, the single clone was picked and shaken, the plasmid was extracted, and the sequencing verification was performed.

[0037] Table 1 Primers for OsHAK22 overexpression

[0038]

[0039] Note: The underlined base sequences are restriction enzyme cleavage sites

[0040] The 50 μl double enzyme digestion reaction system is as follows:

[0041]

[0042] Example 2. Construction of OsHAK22 knockout material

[0043] The OsHAK22 genome sequence in Nipponbare rice was used as a template, and the sequences T1 (SEQ ID No. 2: CCCACTCTACGTCTACTCCA) and T2 (SEQ ID No. 3: CTGTTCGCGGTGCAGAGGTT) in the OsHAK22 gene were used as targets to construct a CRISPR-Cas9 mutant expression vector. The specific construction process is as follows: First, specific primers for the targets T1 and T2 were designed (Table 2), and then the designed Spacer was sent to the company for synthesis, and the annealing temperature gradient was set to obtain a double-stranded product. The vector pOs-sgRNA was linearized by BsaI endonuclease, and the double-stranded product and the linearized vector were subjected to enzyme ligation reaction with T4 ligase. The enzyme ligation product was transferred into Escherichia coli for overnight culture. The next day, the positive single clone was picked and the plasmid was extracted and sent to the company for sequencing. After the sequencing was correct, the U3::Spacer expression vector was obtained. The U3::Spacer expression vector plasmid and the pH-Ubi-cas9-7 expression vector plasmid were then subjected to a gateway reaction to obtain an expression vector containing dual expression of U3::Spacer and Ubi::Cas9. The dual expression vector was then transferred into Escherichia coli for overnight culture. The next day, a single clone was picked out, the plasmid was extracted, and sequencing was performed for verification.

[0044] Table 2 Primer sequences used for knockout of OsHAK22 using the CRISPR-Cas9 system

[0045]

[0046] Example 3. Acquisition and identification of OsHAK22 rice transgenic material

[0047] The expression vector obtained above is transferred into Agrobacterium competent cells by electroporation, and then antibiotics are used for preliminary screening and positive single clones are picked, the plasmid is extracted and Escherichia coli is transformed for verification. After the verification is correct, the corresponding Agrobacterium bacterial solution is preserved with 30% glycerol and stored in a -80°C refrigerator for standby use. The OsHAK22 overexpression vector and the CRISPR-Cas9 mutant expression vector are transferred into fresh rice callus tissue by the Agrobacterium-mediated method, and preliminary screening is performed by selecting one and selecting two, and then the target transgenic rice material can be successfully obtained through differentiation, rooting and other processes. The target transgenic positive rice seedlings successfully screened are planted at the Archway Experimental Base of Nanjing Agricultural University for breeding, and the individual plants are harvested after the seeds are fully mature.

[0048] In order to detect whether the expression of OsHAK22 has been enhanced, we performed RT-PCR identification on T1 generation seeds. Seedlings were grown using 1 / 2MS solid culture medium and cultured in the dark in an artificial tissue culture room for about 3 days. After the seeds germinated, they were cultured in the light in the artificial tissue culture room. When the rice seedlings reached the lid of the differentiation tank, the lid was opened and an appropriate amount of sterile deionized water was poured for 7 days. Then, the positive seedlings of rice seedlings were identified. A small section of the root tip was placed in the GUS dye solution and placed in a 37°C constant temperature incubator overnight. The next day, the positive strains with blue root tips were selected and transferred to normal rice nutrient solution for continued culture for 2 weeks. During this period, the nutrient solution was changed every 2 days, and the pH value of the nutrient solution was adjusted between 5.0-5.5. The leaves of the overexpression and wild-type plants were sampled and quickly placed in liquid nitrogen and stored in a -80°C refrigerator. RNA was then extracted and cDNA was synthesized. The expression of OsHAK22 overexpression seedlings was identified by semi-quantitative PCR (RT-PCR). The semi-quantitative primers and internal reference primers of OsHAK22 are shown in Table 3.

[0049] Table 3 Primer sequences of OsActin and OsHAK22 used for RT-PCR

[0050]

[0051] Healthy wild-type and overexpressed seeds were selected, soaked in 30% sodium hypochlorite solution for 30 minutes, then rinsed with clean water 5 times, placed in a paper cup covered with a 20-mesh nylon mesh, and half of the seeds were immersed in clean water, and then placed in a 37°C constant temperature incubator for 24-36 hours. During this period, it was ensured that the amount of water in the paper cup had to be immersed in half of the seeds, and finally placed in an artificial climate chamber for cultivation. Ten days after emergence, all overexpressed rice seedlings were preliminarily identified by GUS staining, and the strains with positive seedlings were selected, and leaves were taken for RNA extraction and cDNA synthesis. The semi-quantitative PCR (RT-PCR) method was used to further identify the expression of OsHAK22 overexpressed rice seedlings. Two representative overexpression strains were further selected through physiological experiments, named OsHAK22-Ox1 and OsHAK22-Ox2 for subsequent experiments.

[0052] In order to detect the mutation effect of OsHAK22 CRISPR-Cas9 transgenic seedlings, we sequenced and identified OsHAK22 in T1 seedlings. Seedlings were grown using 1 / 2MS solid culture medium and cultured in the dark in an artificial tissue culture room for about 3 days. After the seeds germinated, they were cultured in the light in the artificial tissue culture room. When the rice seedlings reached the lid of the differentiation tank, the lid was opened and an appropriate amount of sterile deionized water was poured for 7 days. Then they were transferred to full IRRI rice nutrient solution for 2 weeks. The leaves of CRISPR-Cas9 transgenic seedlings and wild-type plants were sampled and quickly placed in liquid nitrogen and stored in a -80°C refrigerator. The DNA in the leaves was extracted, and then two PCR amplifications were performed using identification primers. First, the mutant material and the corresponding wild-type gDNA samples were extracted. The Cas9 sequence was verified with Cas9 universal primers (Table 3) in the first round, and the OsHAK22-CRISPR-F / R primers (Table 3) were used in the second round to amplify the gDNA of the transgenic strain as a template. The product was sent to the company for sequencing and homozygous knockout materials were selected. By sequencing and verifying the mutant material, we obtained several OsHAK22 knockout homozygous strains. Further through physiological and quantitative experimental data, we screened two strains with similar phenotypes and named them OsHAK22-1 and OsHAK22-2 for subsequent experiments.

[0053] Table 3 Primer sequences used for identification of the knockout effect of OsHAK22 by CRISPR-Cas9 system

[0054]

[0055] Example 4. Identification of the response of rice OsHAK22 to environmental stresses such as drought using RT-qPCR technology

[0056] In order to explore the expression of OsHAK22 gene in rice during the whole growth period, we extracted total RNA from samples of Nipponbare wild-type rice at different growth periods and different tissues for RT-qPCR analysis. The quantitative primers are shown in Table 2 in Example 3. The experimental results showed that OsHAK22 gene was highly expressed in rice leaves, leaf sheaths, stems, inner and outer palea during the whole growth period, while the expression level in other parts such as roots was relatively low ( Figure 1 ).

[0057] In order to determine whether the expression of OsHAK22 is affected by low K + or drought stress, we used Nipponbare wild type material to perform low K + (0.05mM K + ), mannitol (120.4 g L -1Mannitol) and ABA (30uM ABA) at different time points, and normal nutrition (1mM K + ) as a control. RT-qPCR results showed that + At 6 h of treatment, the expression of OsHAK22 in rice roots was upregulated by about 3 times compared with WT, but there was no significant difference in the aboveground part. + After 24 hours of treatment, the expression levels in rice roots and aboveground parts increased by about 2 times; + At 72 h of treatment, the expression of OsHAK22 in both the root and the aerial part of rice was significantly upregulated, reaching about 10 times that of WT, and there was no significant change at other time points ( Figure 2 AB). When treated with mannitol for 24 h, the expression of OsHAK22 in the root was significantly upregulated, about 15 times that of WT; when treated with mannitol for 72 h, the expression of OsHAK22 in the root of rice was upregulated by about 5 times, and the expression in the aboveground part was upregulated by about 40 times, while there was no significant change when treated with mannitol for 6 h ( Figure 2 CD). We also observed that when treated with 30uM ABA for 24h, the expression of OsHAK22 in rice roots increased by about 10 times, and there was no significant difference in the aboveground part; when treated with 30uM ABA for 72h, the expression of OsHAK22 in rice roots and aboveground parts increased by about 15-20 times ( Figure 2 EF). The results showed that the expression of OsHAK22 in the aboveground part of rice was affected by low K + , mannitol and ABA stress induced upregulation.

[0058] At the same time, we used barrel-cultured seedlings at the booting stage under drought stress for 7 days and detected that the expression level of OsHAK22 in various tissues reached about 100 times that of WT ( Figure 3 ). This indicates that the expression of OsHAK22 is induced by environmental stresses such as drought.

[0059] Example 5 Water loss test of wild type and transgenic rice seedlings

[0060] We found through RT-qPCR that the expression of OsHAK22 was upregulated in response to drought and abscisic acid stress. To further explore the role of OsHAK22 in controlling rice tolerance to drought stress, we first conducted a rice seedling dehydration experiment. 10-day-old transgenic and wild-type rice seedlings were exposed to 1 mM K + After culturing in IRRI nutrient solution for 4 weeks, the rice transgenic and wild-type seedlings were placed back into the IRRI nutrient solution containing 1 mM K. +After continuing to culture in IRRI nutrient solution for 12 hours, the survival rates of OsHAK22 overexpression, knockout and wild-type rice seedlings were counted. The experimental results showed that the survival rate of OsHAK22 overexpression lines after water supply restoration was significantly higher than that of wild-type ( Figure 4 ), while the survival rate of the OsHAK22 knockout strain after water supply restoration was only about 50% of that of the wild type ( Figure 4 ), indicating that overexpression of OsHAK22 can enhance the tolerance of rice seedlings to drought stress, while knockout of OsHAK22 can increase the sensitivity of rice seedlings to drought stress.

[0061] Example 6 Differential responses of wild-type and transgenic rice to drought stress

[0062] To further examine whether the overexpression material is resistant to drought stress environment during natural self-pollination (rice is prone to drought stress during its growth period). First, prepare a 20L barrel, each barrel is filled with 19kg of mixed soil and river sand, and 12.5g of basal fertilizer (2g each of N, P2O5 and K2O) is applied for standby use. 10-day-old OsHAK22 overexpression, knockout and Nipponbare wild-type rice seedlings are cultured in normal nutrient solution for 2-4 weeks and then transplanted into barrels, with 3 seedlings per barrel. Drought stress treatment was started at the early stage of booting until all leaves of the drought-stressed plants rolled up (this situation usually occurs at noon, when the soil moisture content is about 72-75%). The second round of drought stress treatment was carried out 24 hours after the water supply was restored. The curling degree of leaves of OsHAK22 overexpression, knockout and Nipponbare wild-type rice during drought stress was observed and counted. The results showed that when rice faced drought stress, the leaves of wild-type rice curled up completely, while the leaves of OsHAK22 overexpressing materials were fully extended; while the leaves of OsHAK22 knockout materials curled up completely, while the leaves of wild-type rice were fully extended ( Figure 5 ). This indicates that overexpression of OsHAK22 enhances the tolerance of rice to drought stress at the booting stage, while knockout of OsHAK22 leads to high sensitivity of rice to drought stress at the booting stage.

[0063] After two rounds of drought stress treatment, the rice was cultured normally until it was fully mature, and relevant agronomic statistics were performed on OsHAK22 overexpression, knockout and Nipponbare wild-type rice. The results showed that after drought stress, the relative yield of the OsHAK22 overexpression line was about 24% higher than that of the wild type ( Figure 6 AB), while the phenotype of OsHAK22 knockout material was opposite to that of overexpression strain. OsHAK22 knockout resulted in a significant decrease in rice relative yield compared with wild type ( Figure 6 AB). The K content of roots, leaves, stems and leaf sheaths of OsHAK22 overexpression, knockout and WT materials at full maturity was detected. +The results showed that the K content in the stems and leaf sheaths of the OsHAK22 overexpression lines + The content was significantly higher than that of the wild type, about 12%, and the K + The content is significantly lower than that of the wild type, about 15% ( Figure 7 The above results showed that OsHAK22 overexpression enhanced the resistance of rice stems and leaf sheaths to K + The absorption of nutrient elements enhances the tolerance of rice to drought stress, ultimately leading to an increase in the relative yield of crops under drought stress.

Claims

1. Application of rice high affinity potassium ion transporter encoding gene OsHAK22 in regulating rice tolerance to drought stress, characterized in that: The CDS sequence of the rice high-affinity potassium ion transporter encoding gene OsHAK22 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: Overexpression of the rice high-affinity potassium ion transporter encoding gene OsHAK22 can enhance rice tolerance to drought stress.

3. The use according to claim 1, characterized in that: Knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22 will reduce rice's tolerance to drought stress.

4. A recombinant expression vector containing the rice high affinity potassium ion transporter encoding gene OsHAK22 as claimed in claim 1.

5. The recombinant expression vector according to claim 4, characterized in that: The recombinant expression vector is obtained by inserting the rice high-affinity potassium ion transporter encoding gene OsHAK22 described in claim 1 into the SacI and BamHI restriction sites of the starting vector pTCK303.

6. Use of the recombinant expression vector according to claim 4 or 5 in improving the tolerance of rice to drought stress.

7. The use according to claim 6, characterized in that The recombinant expression vector is used to increase the relative yield of rice under drought stress, thereby improving the drought resistance of rice.

8. Use of knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22 described in claim 1 in reducing rice tolerance to drought stress.

9. Use of knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22 described in claim 1 in reducing the relative yield under drought stress, ultimately leading to high sensitivity of rice to drought stress.

10. The use according to claim 9, characterized in that: The knockout vector for knocking out the rice high-affinity potassium ion transporter encoding gene OsHAK22 described in claim 1 is based on the pOs-sgRNA vector, and primers are designed and synthesized for the target sequences T1 and T2 of the rice high-affinity potassium ion transporter encoding gene OsHAK22. After annealing, the primers are inserted between the BsaI restriction sites of the basic vector to obtain a U3::Spacer expression vector, and the U3::Spacer expression vector plasmid and the pH-Ubi-cas9-7 expression vector plasmid are further subjected to a gateway reaction to obtain an expression vector containing U3::Spacer and Ubi::Cas9 dual expression, wherein the T1 sequence is shown in SEQ ID NO.2, and the T2 sequence is shown in SEQ ID NO.3.

Images