Model cell for detecting pyrogen, construction method, detection kit and application

Abstract

The invention relates to the technical field of pyrogen detection, in particular to a pyrogen detection model cell, a construction method, a detection kit and application. The model cell is constructed by transfecting an HL-60 cell with a recombinant lentivirus plasmid carrying nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2. The cell can highly express IRF3 and TBK1, the detection sensitivity on common pyrogens is improved, the detection range is expanded, and the pyrogen reactivity is good. The cell can also be used as a model cell for screening acute leukemia resisting drugs.

Description

Technical Field

[0001] The present invention relates to the technical field of pyrogen detection, and in particular to pyrogen detection model cells, construction methods, detection kits and uses. Background Art

[0002] All substances that cause pyrogenic reactions are called pyrogens, including bacteria, viruses, fungi, parasites and their components. Pyrogen testing for drugs used parenterally and medical devices that come into contact with the body is an essential quality control indicator for clinical drug use. Currently, the pyrogen testing methods included in the Chinese Pharmacopoeia include the rabbit pyrogen test and the bacterial endotoxin test (BET). The rabbit pyrogen test was first included in the 12th edition of the United States Pharmacopoeia in 1942, and has been used as the gold standard for statutory pyrogen testing by pharmacopoeias of various countries for half a century. Due to the limitations of the rabbit pyrogen test and the BET method, as well as the growing public calls for animal welfare and animal protection in recent years.

[0003] Almost all exogenous pyrogenic substances cause fever by stimulating immune cells to secrete cytokines. Therefore, using immune cells in vitro to simulate the body's response and conduct pyrogen detection is the basis for conducting new method research. After external stimulation, immune cells produce endogenous pyrogens, namely related cytokines, such as IL-1β, IL-6, TNF-α, etc. With the establishment of human monocytic cell lines THP-1 and MONOMAC6 (MM6), cell line methods have become a research hotspot. Currently, there are 7 methods: fresh human whole blood-IL-1β, fresh human whole blood-IL-6, PBMC-IL-6, MM6-IL-6, THP1-neopterin (Neo), THP1-TNFα and frozen human whole blood-IL-1β, which were formally verified and recommended by European authoritative organizations including the European Center for Alternative Methods Validation and the National Institute for Biological Products Control in the United Kingdom in 2004 and 2005 respectively. However, it is still necessary to select new cell lines as a supplement or substitute for pyrogen detection methods. Summary of the invention

[0004] In view of this, the present invention provides a pyrogen detection model cell, a construction method, a detection kit and uses, so as to provide one of the supplementary or alternative technical approaches to the pyrogen detection method.

[0005] One of the purposes of the present invention is to disclose a method for constructing a model cell, comprising:

[0006] Step 1: preparing a recombinant lentiviral plasmid, wherein the recombinant lentiviral plasmid carries the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2;

[0007] Step 2: transfecting the recombinant lentiviral plasmid and the auxiliary plasmid into 293T cells to package a lentivirus, wherein the lentivirus carries the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2;

[0008] Step 3: transducing the lentivirus into HL-60 cells;

[0009] Step 4: Use the limiting dilution method to establish a monoclonal model cell line.

[0010] Specifically, the method for constructing the recombinant lentiviral plasmid includes:

[0011] The template as described in SEQ ID NO.1 was amplified by PCR using primers F1 and R1, and the PCR products were separated by 1% agarose gel electrophoresis and recovered by a gel recovery kit to obtain a PCR amplified fragment of IRF3; wherein the nucleotide sequence of primer F1 is shown in SEQ ID NO:3, and the nucleotide sequence of primer R1 is shown in SEQ ID NO:4;

[0012] Primers F2 and R2 were used to perform PCR amplification on the template as described in SEQ ID NO.2, and the PCR products were separated by 1% agarose gel electrophoresis and recovered using a gel recovery kit to obtain a PCR amplified fragment of TBK1; wherein the nucleotide sequence of primer F2 is shown in SEQ ID NO:5, and the nucleotide sequence of primer R2 is shown in SEQ ID NO:6.

[0013] Specifically, the method for constructing the recombinant lentiviral plasmid further includes:

[0014] pLenti6.3 / V5-DEST-GFP was double-digested with BsmBI and SpeI, and the digested fragments were separated by gel electrophoresis. The digested fragments of pLenti6.3 / V5-DEST-GFP were recovered and ligated with the PCR amplified fragment of IRF3 by T4 DNA ligase. The ligated product was transformed into E. coli DH5α and spread on LA plates for overnight culture for 24 hours. Positive colonies were screened and cultured with shaking for 24 hours. The plasmids were extracted and identified by enzyme digestion. The positive plasmids were further sequenced and verified. The correct plasmid was the pLenti6.3 / V5-DEST-GFP plasmid with SEQ ID NO:1 sequence, named pLenti6.3-IRF3-GFP.

[0015] Specifically, the method for constructing the recombinant lentiviral plasmid further includes:

[0016] The pLenti6.3 / V5-DEST-GFP plasmid carrying the SEQ ID NO:1 sequence was double-digested with SalI and mLuI, and the digested fragments were separated by gel electrophoresis. The digested fragments were recovered and ligated with the PCR amplified fragment of TBK1 by T4 DNA ligase. The ligated product was transformed into E.coliDH5α and spread on LA plates for overnight culture for 24 hours. Positive colonies were screened and cultured with shaking for 24 hours. The plasmids were extracted and identified by enzyme digestion. The positive plasmids were further sequenced and verified. The correct plasmid was the pLenti6.3 / V5-DEST-GFP plasmid carrying the SEQ ID NO:1 sequence and the SEQ ID NO:2 sequence, and was named pLenti6.3-IRF3-GFP-TBK1.

[0017] Specifically, the step 2 specifically includes:

[0018] 1) Half an hour before transfection, preheat serum-free and antibiotic-free DMEM and complete DMEM medium containing 10% FBS at 37°C;

[0019] 2) Extract the recombinant lentiviral plasmid pLenti6.3-IRF3-GFP-TBK1, and ensure that the concentration is above 1 μg / μL and the A260 / A280 of DNA is between 1.8 and 2.0;

[0020] 3) Dilute 2.3 μg of pLenti6.3-IRF3-GFP-TBK1 and 2.36 μg of packaging plasmid in 100 μL of serum-free and antibiotic-free DMEM and mix at room temperature;

[0021] 4) Take 9.2 μL PEI (polyetherimide) and dilute it in 100 μL serum-free and antibiotic-free DMEM, and mix at room temperature;

[0022] 5) Mix the two solutions of step 3) and step 4) and incubate at room temperature for 20 to 25 minutes to form a DNA-PEI complex;

[0023] 6) Take 3 mL of the solution obtained in step 5) and evenly drip it into a 293T cell culture dish in good condition and place it in a 37°C, 5% CO2 cell culture incubator for culture. Collect the cell supernatant after 48h, 72h, and 80h, centrifuge it at 4°C, 3000r / min for 10min, and gently filter the supernatant through a 0.45μm membrane filter into a centrifuge tube, then centrifuge it at 4°C, 22000r / min for 2h, discard the supernatant, dissolve the precipitate thoroughly with pre-cooled phosphate buffer, and finally collect it into 1.5mL EP tubes, divide it into aliquots and store it in a -80°C refrigerator. The lentivirus titer was determined by fluorescence microscopy.

[0024] Specifically, the step 3 specifically includes: collecting the lentiviral particles, filtering with a 0.22 um filter membrane to obtain a virus solution; adding a serum solution containing 10 μg / mL polybrene and 50% by volume to 10 6 The HL-60 cells cultured in each passage were infected by adding the virus solution at a ratio of MOI=10; 48 hours after infection, the cell fluorescence was observed.

[0025] Specifically, the subculture of the HL-60 cells comprises:

[0026] When the cell density in the culture dish reaches 80%, take out the culture dish, pour out the culture medium, wash it with PBS three times, absorb the residual liquid, add 1mL 0.25% trypsin solution to each dish, and incubate it in a 37℃ incubator for 5min;

[0027] Take out the culture dish, add 2 mL of complete culture medium containing serum to terminate trypsin digestion, use a pipette to gently blow off the cells adsorbed on the bottom of the culture dish, and transfer them to a centrifuge tube;

[0028] Place the centrifuge tube in a centrifuge and centrifuge at 800 rpm for 5 min;

[0029] Take the precipitate, which is the cells, and resuspend it in culture medium;

[0030] The resuspended cell solution was divided into culture dishes at a ratio of one dish to three dishes, culture medium was added, and the mixture was mixed and placed in a 37°C constant temperature CO2 incubator for cultivation.

[0031] Specifically, the step 4 specifically includes:

[0032] The transduced HL-60 cells were digested, counted and adjusted to a concentration of 10 5 cells / mL, repeatedly blow the cell suspension with a glass pipette to make it uniform, then add 100 μL of cell suspension to each well of the 96-well plate and continue to culture for 20 days;

[0033] When the cells grow into obvious colonies, positive clone wells are screened according to the fluorescence, and after trypsin digestion, they are transferred to 24-wells for further culture, and then expanded step by step;

[0034] When the number of cells reaches 10 5 After counting cells per well, cells with good growth status were selected for cell freezing.

[0035] One of the purposes of the present invention is to disclose the model cells prepared by the preparation method.

[0036] One of the purposes of the present invention is to disclose a pyrogen detection kit, comprising the model cells prepared by the preparation method.

[0037] One of the purposes of the present invention is to disclose the use of the model cells prepared by the preparation method in constructing a pyrogen detection kit, constructing a leukemia model cell, constructing a leukemia model mouse and in vitro anti-acute leukemia drug screening.

[0038] Beneficial effects:

[0039] The present invention constructs a lentiviral vector capable of simultaneously expressing IRF3 and TBK1, and transfects the vector into HL-60 cells to obtain a model cell stably expressing IRF3 and TBK1. The model cell can highly express IRF3 and TBK1, improves the detection sensitivity of common pyrogens, expands the detection range, and has good pyrogen reactivity.

[0040] In addition, it was found that this cell can also be used as a model cell for screening anti-acute leukemia drugs. Compared with HL-60, it has improved sensitivity to drugs and is more suitable as a model cell for screening anti-acute leukemia drugs. It is also more conducive to constructing acute leukemia model mice to test drug intervention or treatment on model mice with poor survival conditions and high mortality rates.

[0041] The cells provided by the present invention are used as test cells for constructing acute leukemia model mice, which can enable the model mice to quickly form model mice with poor survival conditions and high mortality rates, resulting in increased expression of inflammatory factors in the spleen cells of the model mice, which is more conducive to constructing acute leukemia model mice, so as to facilitate testing of the intervention or treatment of drugs on leukemia model mice with increased expression of inflammatory factors. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 Electrophoresis detection of restriction products of pLenti6.3-IRF3-GFP plasmid (lane 1), pLenti6.3-IRF3-GFP-TBK1 plasmid (lane 2), pLenti6.3-IRF3'-GFP plasmid (lane 3) and pLenti6.3-IRF3'-GFP-TBK1 plasmid (lane 4)

[0043] Figure 2 This graph shows the detection results of IRF3 and TBK1 mRNA expression levels in HL-60 monoclonal cells that were transformed with pLenti6.3-IRF3-GFP plasmid, pLenti6.3-IRF3-GFP-TBK1 plasmid, pLenti6.3-IRF3'-GFP plasmid, pLenti6.3-IRF3'-GFP-TBK1 plasmid and pLenti6.3 / V5-DEST-GFP plasmid, respectively.

[0044] Figure 3 The graph shows the results of inflammatory factors when different test cells were incubated in vitro with pyrogen solutions of different concentrations. Figure 3 A is the OD450 results of IL-6 in different test cells stimulated by LPS. Figure 3 B is the OD450 results of TNF-α of different test cells stimulated by yeast polysaccharide. Figure 3 C is the OD450 result of IFN-β in different test cells stimulated by lipoteichoic acid.

[0045] Figure 4 The graph shows the CCK-8 test results of different test cells incubated with different concentrations of midostaurin in vitro.

[0046] Figure 5 Mouse survival curves during the construction of an acute leukemia model were constructed by injecting SCIDbeige female mice with different test cells. Figure 5 A is the survival curve of mice with HL-60 cells and the control group. Figure 5 B is the survival curve of mice in the pLenti6.3 / V5-DEST-GFP plasmid HL-60 cells and HL-60 cell groups. Figure 5 C is the survival curve of mice in the pLenti6.3-IRF3-GFP plasmid HL-60 cell group and the HL-60 cell group. Figure 5 D is the survival curve of mice in the pLenti6.3-IRF3-GFP-TBK1 plasmid HL-60 cells and HL-60 cell groups. Figure 5 E is the survival curve of mice in the pLenti6.3-IRF3'-GFP plasmid HL-60 cell group and the HL-60 cell group. Figure 5 F is the survival curve of mice in the pLenti6.3-IRF3'-GFP-TBK1 plasmid HL-60 cell group and the HL-60 cell group.

[0047] Figure 6 This is the result of detecting the content of inflammatory factors in the spleen cells of the mice that died in each group on the 16th day during the acute leukemia model. DETAILED DESCRIPTION

[0048] In order to make the purpose, technical scheme and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The reagents not described separately in detail in the present invention are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0049] Example 1: Construction of lentiviral vector

[0050] The mRNA sequence of IRF3 (interferon regulatory factor 3) (SEQ ID NO: 1) was synthesized in vitro, and PCR amplified using primers F1 and R1. The PCR products were separated by 1% agarose gel electrophoresis and recovered using a gel recovery kit to obtain the PCR amplified fragment of IRF3.

[0051] F1:CG CGTCTCG ATAGGGCGGGAACAGCCCAGCGGGCCGTCCCATCG; SEQ ID NO:3

[0052] R1:CCG ACTAGT TCATAGCAGGAACCAGTTTATTGGTTGAGGTGGTGGGGAACAGGG; SEQ ID NO:4

[0053] The CDS sequence of TBK1 (TANKbinding kinase1) (SEQ ID NO: 2) was synthesized in vitro, and PCR amplified using primers F2 and R2. The PCR products were separated by 1% agarose gel electrophoresis and recovered using a gel recovery kit to obtain the PCR amplified fragment of TBK1.

[0054] F2:CG GTCGAC ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCC; SEQ IDNO: 5

[0055] R2:CCG ACGCGT CTAAAGACAGTCAACGTTGCGAAGGCCACCATCCATGGTTAAAGAGCCAAACCTTTC; SEQ ID NO: 6

[0056] pLenti6.3 / V5-DEST-GFP (#40125, addgene) was double-digested with BsmBI and SpeI, and the digested fragments were separated by gel electrophoresis. The digested fragments of pLenti6.3 / V5-DEST-GFP were recovered and ligated with the PCR amplified fragment of IRF3 by T4 DNA ligase. The ligated product was transformed into E. coli DH5α and spread on LA plates for overnight culture for 24 hours. Positive colonies were screened and cultured with shaking for 24 hours. The plasmids were extracted and identified by enzyme digestion. The positive plasmids were further sequenced and verified to be the pLenti6.3 / V5-DEST-GFP plasmid with SEQ ID NO:1 sequence (named pLenti6.3-IRF3-GFP), and the SEQ ID NO:1 sequence was inserted between the CMV promoter and the EGRP sequence.

[0057] The pLenti6.3 / V5-DEST-GFP plasmid carrying the SEQ ID NO:1 sequence was double-digested with SalI and mLuI, and the digested fragments were separated by gel electrophoresis. The digested fragments were recovered and ligated with the PCR amplified fragment of TBK1 by T4 DNA ligase. The ligated product was transformed into E. coli DH5α, spread on LA plates and cultured overnight for 24 hours, positive colonies were screened, and the bacteria were shaken and cultured for 24 hours. The plasmid was extracted and identified by enzyme digestion. The positive plasmid was further sequenced and verified. The correct plasmid was pLenti6.3 / V5-DEST-GFP plasmid carrying SEQ ID NO:1 and SEQ ID NO:2 (named pLenti6.3-IRF3-GFP-TBK1), and the SEQ ID NO:1 sequence was inserted between the CMV promoter and the EGRP sequence, and the SEQ ID NO:2 sequence was inserted at the MCS site.

[0058] The CDS sequence of IRF3 (SEQ ID NO: 7) was synthesized in vitro, and PCR amplified using primers F3 and R3. The PCR product was separated by 1% agarose gel electrophoresis and recovered using a gel recovery kit to obtain the PCR amplified fragment of IRF3. The PCR amplified fragment of IRF3 was inserted into the pLenti6.3 / V5-DEST-GFP plasmid using the same method as above to obtain the pLenti6.3-IRF3'-GFP plasmid; the SEQ ID NO: 2 sequence was inserted into the pLenti6.3-IRF3'-GFP plasmid using the same method as above to obtain the pLenti6.3-IRF3'-GFP-TBK1 plasmid.

[0059] F3:CG CGTCTCGATGGGAACCCCAAAGCCACGGATCCTGCCCTGGCTGGTG; SEQ ID NO:8

[0060] R3:CCG ACTAGT TTATTGGTTGAGGTGGTGGGGAACAGGGGGGTTGGAGGCACACCATGAGG; SEQ IDNO:9

[0061] like Figure 1 As shown, the pLenti6.3-IRF3-GFP plasmid was digested with BsmBI and SpeI, the pLenti6.3-IRF3-GFP-TBK1 plasmid was digested with SalI and mLuI, the pLenti6.3-IRF3'-GFP plasmid was digested with BsmBI and SpeI, and the pLenti6.3-IRF3'-GFP-TBK1 plasmid was digested with SalI and mLuI, and the digestion products were detected by electrophoresis. Lane 1 showed bands of about 8500 bp and 1600 bp, lane 2 showed bands of about 10000 bp and 2200 bp, lane 3 showed bands of about 8500 bp and 1360 bp, and lane 4 showed bands of about 10000 bp and 2200 bp, indicating that the obtained pLenti6.3-IRF3-GFP plasmid, pLenti6.3-IRF3-GFP-TBK1 plasmid, pLenti6.3-IRF3'-GFP plasmid and pLenti6.3-IRF3'-GFP-TBK1 plasmid were all successfully constructed.

[0062] Example 2: Virus packaging

[0063] (1) Half an hour before transfection, preheat serum-free and antibiotic-free DMEM and complete DMEM medium (containing 10% FBS) at 37°C.

[0064] (2) Extract the recombinant lentiviral plasmid pLenti6.3-IRF3-GFP-TBK1, and ensure that the concentration is above 1 μg / μL and the A260 / A280 of DNA is between 1.8 and 2.0.

[0065] (3) Take 2.3 μg pLenti6.3-IRF3-GFP-TBK1 and 2.36 μg packaging plasmid (ViraPower TM PackgingMix, Invitrogen, USA) was diluted in 100 μL of serum-free and antibiotic-free DMEM and mixed at room temperature;

[0066] (4) Dilute 9.2 μL PEI in 100 μL serum-free and antibiotic-free DMEM and mix at room temperature;

[0067] (5) mixing the two solutions of step (3) and step (4), and incubating at room temperature for 20 to 25 minutes to form a DNA-PEI complex;

[0068] (6) Take 3 mL of the solution obtained in step (5) and evenly drip it into a 293T cell culture dish in good condition and place it in a 37°C, 5% CO2 cell culture incubator for culture. Collect the cell supernatant after 48 h, 72 h, and 80 h, respectively, centrifuge it at 4°C, 3000 r / min for 10 min, and gently filter the supernatant through a 0.45 μm membrane filter into a centrifuge tube, then centrifuge it at 4°C, 22000 r / min for 2 h, discard the supernatant, and dissolve the precipitate thoroughly with pre-cooled phosphate buffer (, finally collect it into a 1.5 mL EP tube, divide it into aliquots and store it in a -80°C refrigerator. The lentivirus titer was determined by fluorescence microscopy.

[0069] Example 3: Establishment of Stable Cells

[0070] (1) Cell recovery

[0071] Take out a tube of HL-60 cells (ATCC; AC340046) frozen in liquid nitrogen, quickly place it in a 37°C water bath to shake and thaw, and transfer the cells to a centrifuge tube in a clean bench. Add 10 times the volume of 1640 culture medium containing 10% fetal bovine serum to the centrifuge tube, and use a pipette to slowly and repeatedly blow and aspirate to evenly disperse the cells in the culture medium. Place the centrifuge tube in a centrifuge and centrifuge at 800 rpm / min for 5 minutes.

[0072] Take out the centrifuge tube, pour out the supernatant, the bottom is the precipitated cells, add 3mL culture medium, use a pipette to slowly and repeatedly blow and suck to mix the cells. Divide the mixed cells evenly into culture dishes, add culture medium, mix well, and place in a 37℃ constant temperature CO2 incubator for cultivation.

[0073] (2) Cell culture medium replacement

[0074] After the cells were revived and cultured for 24 hours, the culture dish was taken out, the culture medium was discarded, the cells were washed three times with PBS, fresh 1640 culture medium containing 10% fetal bovine serum was added, and the cells were placed in an incubator for further culture.

[0075] (3) Cell passaging

[0076] When the cell density in the culture dish reaches 80%, take out the culture dish, pour out the culture medium, wash it with PBS three times, absorb the residual liquid, add 1mL0.25% trypsin solution to each dish, put it in 37℃ culture, and incubate it in an incubator for 5min. Take out the culture dish, add 2mL of complete culture medium containing serum to terminate trypsin digestion, use a pipette to gently blow off the cells adsorbed on the bottom of the culture dish, and move them to a centrifuge tube. Place the centrifuge tube in a centrifuge and centrifuge at 800rpm / min for 5 minutes. Take out the centrifuge tube, pour out the supernatant, the bottom is the precipitated cells, add culture medium, and use a pipette to slowly and repeatedly blow and suck to mix the cells. Divide the mixed cells into culture dishes according to the ratio of one dish to three dishes, add culture medium, mix well, and place in a 37℃ constant temperature CO2 incubator for cultivation.

[0077] (4) Lentiviral transduction of HL-60 cells

[0078] The collected lentiviral particles were filtered through a 0.22 μm filter membrane to remove cell debris and impurities to obtain a virus solution. A serum solution containing 10 μg / mL polybrene and 50% by volume was added to 10 6 HL-60 cells were subcultured and infected with virus solution at a ratio of MOI = 10. After 48 hours of infection, the cell fluorescence was observed.

[0079] (5) Establishment of monoclonal cells

[0080] The monoclonal model cell line was established by limiting dilution method. The transduced HL-60 cells were digested, counted and the concentration was adjusted to 10 5 cells / mL, use a glass pipette to repeatedly blow the cell suspension to make it uniform, and then add 100 μL of cell suspension to each well of the 96-well plate, so that theoretically there will be 1 single cell in each well. Continue routine culture for 20 days, observe the cell status regularly, and replace the cell culture medium during this period. When the cells grow into obvious colonies, observe the fluorescence under a fluorescence microscope, and select the positive clone wells with monoclonal colony growth, good growth status, no obvious changes in cell morphology, and high fluorescence intensity. After trypsin digestion, transfer to 24 wells for continued culture, and then expand the culture step by step. When the number of cells is cultured to 10 5 After counting cells per well, cells with good growth status were selected for cell freezing.

[0081] Example 4: Detection of IRF3 and TBK1 expression in monoclonal cells

[0082] The total RNA of monoclonal cells was extracted by Trizol method, and the RNA was reverse transcribed into cDNA using RevertAidfirststrand cDNA synthesis kit according to the kit instructions. The template, primers, water and 2×SYBRqPCRMasterMix were mixed in proportion for RT-PCR, and amplification detection was performed on the LightCycler96 real-time fluorescence quantitative PCR instrument. The reaction conditions were 95℃3min; 95℃30s, 60℃30s, 40 cycles. hhACTB was used as the reference gene, and 2 -△△ Ct represents the relative mRNA levels of the target genes IRF3 and TBK1. Real-time quantitative PCR primers were synthesized by Sangon Biotech Co., Ltd. The primers involved are:

[0083] IRF3-F:GACATTCTGGATGAGTTACTG; SEQ ID NO:10

[0084] IRF3-R:GAGATGGTCTGCTGGAAG; SEQ ID NO:11

[0085] TBK1-F: TGAAGAGGAGACAACAACAA; SEQ ID NO:12

[0086] TBK1-R:GGTAGTCCATAGGCATTAGAA; SEQ ID NO:13

[0087] hACTB-F:TCCTTCCTGGGCATGGAG; SEQ ID NO:14

[0088] hACTB-R:CAGGAGGAGCAATGATCTTGAT; SEQ ID NO:15

[0089] The mRNA expression levels of IRF3 and TBK1 in HL-60 monoclonal cells transformed with pLenti6.3-IRF3-GFP plasmid, pLenti6.3-IRF3-GFP-TBK1 plasmid, pLenti6.3-IRF3'-GFP plasmid, pLenti6.3-IRF3'-GFP-TBK1 plasmid and pLenti6.3 / V5-DEST-GFP plasmid were detected. Figure 2As shown, HL-60 monoclonal cells transformed with pLenti6.3-IRF3-GFP plasmid or pLenti6.3-IRF3-GFP-TBK1 plasmid highly expressed IRF3 and TBK1, while the expression levels of HL-60 monoclonal cells transformed with pLenti6.3-IRF3'-GFP plasmid or pLenti6.3-IRF3'-GFP-TBK1 plasmid were reduced, and HL-60 monoclonal cells transformed with pLenti6.3 / V5-DEST-GFP plasmid had no expression of IRF3 and TBK1. This indicates that by constructing lentiviral vector pLenti6.3-IRF3-GFP plasmid or pLenti6.3-IRF3-GFP-TBK1 plasmid, IRF3 and TBK1 can be highly expressed in HL-60 cells, and monoclonal cells with stable expression can be constructed.

[0090] Example 5: Model cells for detecting conventional pyrogens and their applications

[0091] The present invention found that the above-screened HL-60 cells with high IRF3 and TBK1 can be used as model cells for detecting conventional pyrogens.

[0092] (1) Reagents

[0093] Pyrogen solution: National standard for bacterial endotoxin (China Food and Drug Inspection Institute; batch number: 150601-200758; specification: 140EU / tube), diluted with sterile water to 5pg / mL, 10pg / mL, 50pg / mL and 100pg / mL. Yeast polysaccharide (Sigma, USA, catalog number: Z4250), diluted with sterile water to 1μg / mL, 2μg / mL, 4μg / mL and 8μg / mL. Lipoteichoic acid (Sigma, USA, catalog number: L3265), diluted with sterile water to 1μg / mL, 2μg / mL, 4μg / mL and 8μg / mL.

[0094] Test cells: HL-60 monoclonal cells transformed with pLenti6.3-IRF3-GFP plasmid, pLenti6.3-IRF3-GFP-TBK1 plasmid, pLenti6.3-IRF3'-GFP plasmid, pLenti6.3-IRF3'-GFP-TBK1 plasmid and pLenti6.3 / V5-DEST-GFP plasmid, and HL-60 cells.

[0095] (2) Experimental procedures

[0096] HL-60 cells were cultured in IMDM containing 20% ​​fetal bovine serum at 37°C and 5% carbon dioxide. The cell concentration was controlled to be 10 cells per mL. 6Take HL-60 cells with good growth status, centrifuge at 1000rpm for 2min, discard the supernatant, and adjust the cell concentration to 5.0×10 with cell culture medium. 6 / mL, inoculated in a 24-well plate, 400μL per well. Then add different concentrations of pyrogen solution, 100μL per well, add 100μL cell culture medium to the negative control, culture at 37°C, 5% carbon dioxide for 48h, centrifuge at 2000rpm for 5min, and take the supernatant. Use IL-6 ELISA kit (E-EL-H6156, Elabscience), IFN-β kit (E-EL-H0085, Elabscience) and TNF-α kit (E-EL-H0109, Elabscience) to detect the content of IL-6 in the supernatant.

[0097] Different test cells were incubated in vitro with different concentrations of pyrogen solutions, and the OD450 value caused by inflammatory factors in the supernatant was detected using an ELISA kit. Figure 3 As shown in Figure 2, HL-60 cells reacted to 100 pg / mL LPS with pyrogen, but the OD450 values ​​induced by different concentrations of yeast polysaccharide and lipoteichoic acid pyrogen solutions were not significantly different from those of the blank control (HP-60 cell fluid not stimulated by pyrogen).

[0098] The HL-60 monoclonal cells expressing pLenti6.3 / V5-DEST-GFP plasmid also showed the same trend, indicating that HL-60 cells can be used to detect LPS pyrogen, but the detection sensitivity is only 100 pg / mL, and yeast polysaccharide and lipoteichoic acid cannot be detected.

[0099] like Figure 3As shown, HL-60 monoclonal cells transformed with pLenti6.3-IRF3-GFP plasmid, pLenti6.3-IRF3-GFP-TBK1 plasmid, pLenti6.3-IRF3'-GFP plasmid, and pLenti6.3-IRF3'-GFP-TBK1 plasmid can cause different increases in OD450 values, but among them, HL-60 monoclonal cells transformed with pLenti6.3-IRF3-GFP-TBK1 plasmid can produce differences in OD450 values ​​relative to the blank group in response to 5 pg / mL LPS, 1 μg / mL yeast polysaccharide, and 2 μg / mL lipoteichoic acid. This shows that the HL-60 monoclonal cells into which the pLenti6.3-IRF3-GFP-TBK1 plasmid has been transferred can detect 5pg / mL of LPS, 1μg / mL of yeast polysaccharide, and 2μg / mL of lipoteichoic acid, and the sensitivity is not only higher than that of HL-60 cells, but also higher than that of HL-60 monoclonal cells into which the pLenti6.3-IRF3-GFP plasmid, pLenti6.3-IRF3'-GFP plasmid, and pLenti6.3-IRF3'-GFP-TBK1 plasmid have been transferred. This shows that the use of the lentiviral vector and model cells provided by the present invention to highly express IRF3 and TBK1 can improve the detection sensitivity of common pyrogens, expand the detection range, and have good pyrogen reactivity.

[0100] Example 6: Application of model cells for anti-tumor drug screening

[0101] The present invention also found that the above-screened HL-60 cells with high IRF3 and TBK1 levels can be used as model cells for screening anti-acute leukemia drugs. The details are as follows:

[0102] (1) Reagents

[0103] Midostaurin (CAS: 120685) was purchased from Shanghai Shenggong Biological Co., Ltd.

[0104] Test cells: HL-60 monoclonal cells and HL-60 cells were respectively transformed with pLenti6.3-IRF3-GFP plasmid, pLenti6.3-IRF3-GFP-TBK1 plasmid, pLenti6.3-IRF3'-GFP plasmid, pLenti6.3-IRF3'-GFP-TBK1 plasmid and pLenti6.3 / V5-DEST-GFP plasmid. Each test cell was inoculated in RPMI1640 culture medium containing 10% FBS, placed in a 37°C, 5% CO2, saturated humidity incubator, and the medium was changed every 2 to 3 days for subculture.

[0105] (2) CCK-8 experiment

[0106] Take the test cells in the logarithmic growth phase for the experiment, add 100 μL of cell suspension into a 96-well plate, set up 3 replicates per group, and 1×10 4 The cells were placed in a 37°C, 5% CO2 incubator for 24 hours, and then 10 μL of different concentrations of midostaurin (0, 0.01, 0.02, 0.05, 0.1, 0.5 μmol / L) were added to each well. The DMSO group was used as the control. After incubation for 48 hours, 10 μL of CCK-8 solution was added to each well, and the culture was continued for 2 hours. The absorbance at 450 nm (A value) was detected by an enzyme marker. Cell proliferation inhibition rate (%) = (A control group - A experimental group) / A control group × 100%.

[0107] like Figure 4 The cell proliferation inhibition rate of HL-60 cells and HL-60 monoclonal cells transformed with pLenti6.3 / V5-DEST-GFP plasmid to midostaurin below 0.1μmol / L was lower than that of other tested cells. HL-60 monoclonal cells transformed with pLenti6.3-IRF3-GFP-TBK1 plasmid also had responsiveness to midostaurin at 0.01μmol / L, indicating that it has improved drug sensitivity compared with HL-60 and is more suitable as a model cell for screening anti-acute leukemia drugs.

[0108] (3) Used to construct in vivo models

[0109] Test cells: HL-60 monoclonal cells and HL-60 cells were respectively transformed with pLenti6.3-IRF3-GFP plasmid, pLenti6.3-IRF3-GFP-TBK1 plasmid, pLenti6.3-IRF3'-GFP plasmid, pLenti6.3-IRF3'-GFP-TBK1 plasmid and pLenti6.3 / V5-DEST-GFP plasmid. Each test cell was inoculated in RPMI1640 culture medium containing 10% FBS, placed in a 37°C, 5% CO2, saturated humidity incubator, and the medium was changed every 2 to 3 days for subculture.

[0110] Acute leukemia model mice were constructed: SCIDbeige female mice, 10 weeks old, 18-20 g, were raised in an SPF animal room. They were first irradiated with a total dose of 7 Gy cobalt-60 gamma rays for 3 min, and then injected into the tail vein with 1×10 7 The survival curves of mice with different test cells and the control group (Con) were compared within 32 days.

[0111] like Figure 5 A, There was no significant difference in the survival between mice injected with HL-60 cells and the control group (P=0.1573).

[0112] like Figure 5 B, There was no significant difference in the survival between the mice injected with HL-60 cells transformed with pLenti6.3 / V5-DEST-GFP plasmid and the HL-60 cells group (P=0.2506).

[0113] like Figure 5 C, The survival of mice injected with HL-60 cells transfected with pLenti6.3-IRF3-GFP plasmid was significantly different from that of mice injected with HL-60 cells (P=0.0286).

[0114] like Figure 5 D, The survival of mice injected with HL-60 cells transfected with pLenti6.3-IRF3-GFP-TBK1 plasmid was significantly different from that of mice injected with HL-60 cells (P=0.0033).

[0115] like Figure 5 E, There was no significant difference in the survival between the mice injected with HL-60 cells transfected with pLenti6.3-IRF3'-GFP plasmid and the HL-60 cells group (P=0.4070).

[0116] like Figure 5 F, There was no significant difference in the survival between the mice injected with HL-60 cells transfected with pLenti6.3-IRF3'-GFP-TBK1 plasmid and the HL-60 cells group (P=0.0898).

[0117] Depend on Figure 5 It can be seen that using HL-60 cells transferred with pLenti6.3-IRF3-GFP plasmid and HL-60 cells transferred with pLenti6.3-IRF3-GFP-TBK1 plasmid as test cells for constructing acute leukemia model mice can enable the model mice to quickly form model mice with poor survival and high mortality rate, which is more conducive to constructing acute leukemia model mice, so as to facilitate testing of drug intervention or treatment of model mice with poor survival and high mortality rate.

[0118] Group experiment: Tumor-bearing mice were divided into 2 groups, 10 mice in each group. Midostaurin at 2nmol / kg, 5nmol / kg, 10nmol / kg, and 30nmol / kg of mouse body weight was injected into the tail vein on the 10th, 14th, and 17th days, respectively. The saline group served as the control group. The survival rate of mice was calculated. After the experiment, the mice were killed by cervical dislocation, and serum and spleen cell grinding fluid were collected.

[0119] (4) Detection of inflammatory factors for constructing in vivo models

[0120] Take the centrifugal supernatant of the spleen cell grinding fluid of the mice that died on the 16th day during the construction process. According to the instructions of the IFN-β kit (E-EL-H0085, Elabscience) and the TNF-α kit (E-EL-H0109, Elabscience), add 100 μL of sample to the ELISA plate (the centrifugal supernatant of the spleen cell grinding fluid of healthy mice injected with normal saline was used as the blank control), incubate at 37°C for 1 hour, wash 3 times with PBST, and pat dry. Dilute the antibody at 1:100 and add 50 μL, incubate at 37°C for 1 hour, and repeat the above washing steps. Dilute the IgG-HRP secondary antibody at 1:10000, add 100 μL to each well, incubate at room temperature for 30 minutes; repeat the above washing steps; add 100 μL of TAB substrate colorimetric solution to each well, color at 37°C in the dark for 10 minutes; stop the reaction, measure the absorbance at 450nm, and draw a statistical graph based on the difference between it and the blank control group.

[0121] Figure 6 In the data, "*" indicates a significant difference from the HL-60 group, P < 0.05, "**" indicates a significant difference from the HL-60 group, P < 0.01, and no mark indicates no significant difference from the HL-60 group. Figure 6 It can be seen that the inflammatory factors in the spleen cells of the 16th line of mice in the pLenti6.3-IRF3-GFP group and the pLenti6.3-IRF3-GFP-TBK1 group were significantly higher than those in the HP-60 group.

[0122] This shows that the HL-60 cells transferred with the pLenti6.3-IRF3-GFP plasmid and the HL-60 cells transferred with the pLenti6.3-IRF3-GFP-TBK1 plasmid provided by the present invention are used as test cells for constructing acute leukemia model mice, which can enable the model mice to quickly form model mice with poor survival conditions and high mortality rates, resulting in increased expression of inflammatory factors in the spleen cells of the model mice, which is more conducive to constructing acute leukemia model mice, so as to facilitate testing of the intervention or treatment of drugs on leukemia model mice with increased expression of inflammatory factors.

[0123] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. A method for constructing a model cell, comprising: Step 1: preparing a recombinant lentiviral plasmid, wherein the recombinant lentiviral plasmid carries the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2; Step 2: transfecting the recombinant lentiviral plasmid and the auxiliary plasmid into 293T cells to package a lentivirus, wherein the lentivirus carries the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2; Step 3: transducing the lentivirus into HL-60 cells; Step 4: Use the limiting dilution method to establish a monoclonal model cell line.

2. The construction method according to claim 1, wherein the construction method of the recombinant lentiviral plasmid comprises: The template as described in SEQ ID NO.1 was amplified by PCR using primers F1 and R1, and the PCR products were separated by 1% agarose gel electrophoresis and recovered by a gel recovery kit to obtain a PCR amplified fragment of IRF3; wherein the nucleotide sequence of primer F1 is shown in SEQ ID NO:3, and the nucleotide sequence of primer R1 is shown in SEQ ID NO:4; Primers F2 and R2 were used to perform PCR amplification on the template as described in SEQ ID NO.2, and the PCR products were separated by 1% agarose gel electrophoresis and recovered using a gel recovery kit to obtain a PCR amplified fragment of TBK1; wherein the nucleotide sequence of primer F2 is shown in SEQ ID NO:5, and the nucleotide sequence of primer R2 is shown in SEQ ID NO:

6.

3. The construction method according to claim 2, wherein the construction method of the recombinant lentiviral plasmid further comprises: pLenti6.3 / V5-DEST-GFP was double-digested with BsmBI and SpeI, and the digested fragments were separated by gel electrophoresis. The digested fragments of pLenti6.3 / V5-DEST-GFP were recovered and ligated with the PCR amplified fragment of IRF3 by T4 DNA ligase. The ligated product was transformed into E. coli DH5α and spread on LA plates for overnight culture for 24 hours. Positive colonies were screened and cultured with shaking for 24 hours. The plasmids were extracted and identified by enzyme digestion. The positive plasmids were further sequenced and verified. The correct plasmid was the pLenti6.3 / V5-DEST-GFP plasmid with SEQ ID NO:1 sequence, named pLenti6.3-IRF3-GFP.

4. The construction method according to claim 3, wherein the construction method of the recombinant lentiviral plasmid further comprises: The pLenti6.3 / V5-DEST-GFP plasmid carrying the SEQ ID NO:1 sequence was double-digested with SalI and mLuI, and the digested fragments were separated by gel electrophoresis. The digested fragments were recovered and ligated with the PCR amplified fragment of TBK1 by T4 DNA ligase. The ligated product was transformed into E.coliDH5α and spread on LA plates for overnight culture for 24 hours. Positive colonies were screened and cultured with shaking for 24 hours. The plasmids were extracted and identified by enzyme digestion. The positive plasmids were further sequenced and verified. The correct plasmid was the pLenti6.3 / V5-DEST-GFP plasmid carrying the SEQ ID NO:1 sequence and the SEQ ID NO:2 sequence, and was named pLenti6.3-IRF3-GFP-TBK1.

5. The construction method according to claim 3, wherein step 2 specifically comprises: 1) Half an hour before transfection, preheat serum-free and antibiotic-free DMEM and complete DMEM medium containing 10% FBS at 37°C; 2) Extract the recombinant lentiviral plasmid pLenti6.3-IRF3-GFP-TBK1, and ensure that the concentration is above 1 μg / μL and the A260 / A280 of DNA is between 1.8 and 2.0; 3) Dilute 2.3 μg of pLenti6.3-IRF3-GFP-TBK1 and 2.36 μg of packaging plasmid in 100 μL of serum-free and antibiotic-free DMEM and mix at room temperature; 4) Dilute 9.2 μL PEI in 100 μL serum-free and antibiotic-free DMEM and mix at room temperature; 5) Mix the two solutions of step 3) and step 4) and incubate at room temperature for 20 to 25 minutes to form a DNA-PEI complex; 6) Take 3 mL of the solution obtained in step 5) and evenly add it to a 293T cell culture dish in good condition and place it in a 37°C, 5% CO2 cell culture incubator for culture. Collect the cell supernatant after 48h, 72h, and 80h, respectively, centrifuge at 4°C, 3000r / min for 10min, gently filter the supernatant through a 0.45μm membrane filter into a centrifuge tube, and then centrifuge at 4°C, 22000r / min for 2h, discard the supernatant, and thoroughly dissolve the precipitate with pre-cooled phosphate buffer, finally collect it into 1.5mL EP tubes, divide it into portions and store it in a -80°C refrigerator. The lentiviral titer was determined by fluorescence microscopy.

6. The construction method according to claim 4, wherein step 3 specifically comprises: The collected lentiviral particles were filtered through a 0.22 μm filter membrane to obtain a virus solution; a serum solution containing 10 μg / mL polybrene and 50% by volume was added to 10 6 HL-60 cells were cultured for 10 generations and infected with the virus solution at an MOI of 10. After 48 h of infection, the cell fluorescence was observed.

7. The construction method according to claim 1, wherein step 4 specifically comprises: The transduced HL-60 cells were digested, counted and adjusted to a concentration of 10 5 cells / mL, repeatedly blow the cell suspension with a glass pipette to make it uniform, then add 100 μL of cell suspension to each well of the 96-well plate and continue to culture for 20 days; When the cells grow into obvious colonies, positive clone wells are screened according to the fluorescence, and after trypsin digestion, they are transferred to 24-wells for further culture, and then expanded step by step; When the number of cells reaches 10 5 After counting cells per well, cells with good growth status were selected for cell freezing.

8. The model cell obtained by the preparation method according to any one of claims 1 to 7.

9. A pyrogen detection kit, comprising the model cells prepared by the preparation method according to any one of claims 1 to 7.

10. Use of the model cells prepared by the preparation method according to any one of claims 1 to 7 in constructing a pyrogen detection kit, constructing leukemia model cells, constructing leukemia model mice, and in vitro screening of anti-acute leukemia drugs.

Images