Kit for rapidly detecting hiPSC residues in hiPSC derived cells and application of kit

Abstract

The invention belongs to the technical field of biomedicine, and relates to a kit for rapidly detecting hiPSC residues in hiPSC derived cells and application of the kit. The kit comprises six components, namely an NANOG gene primer probe composition, a TaqMan Fast qPCR (Polymerase Chain Reaction) premixed solution, a standard quality particle, a positive reference substance, a sensitivity reference substance and a sample dilution buffer solution, according to the kit, the NANOG gene sequence serves as a template, the designed primer pair and probe have high specificity, absolute quantitative detection can be conducted on hiPSC residues in an intermediate product, a semi-finished product and a finished product (obtained through differentiation of an endoderm, a mesoderm and an ectoderm) of a human induced pluripotent stem cell derived cell preparation, and compared with other detection modes such as a culture method, the detection method has the advantages that the detection efficiency is high, and the detection cost is low. False positive results caused by a detection method are avoided, and the method has the detection characteristics of simplicity and rapidness in operation, high specificity and high sensitivity.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology and relates to a kit for rapidly detecting hiPSC residues in hiPSC-derived cells and an application thereof. Background Art

[0002] Human induced pluripotent stem cells (hiPSC) are pluripotent stem cells that can replicate indefinitely in vitro and differentiate into any cell type in vivo. They can be used as a potential seed cell source for regenerative medicine and have great prospects in treating various diseases. At present, the use of hiPSC-derived cardiomyocytes and dopaminergic neural precursor cells to treat myocardial infarction and neurodegenerative diseases has begun to enter clinical trials. However, the tumorigenicity of hiPSC is a major problem in clinical applications. The remaining undifferentiated hiPSCs in hiPSC-derived cell therapy products can form teratomas in vivo, which has a potential tumorigenic risk during transplantation, posing a challenge to the safety of therapeutic applications. Therefore, for the intermediates, semi-finished products and finished products of cell drug preparations, an efficient, rapid and accurate detection kit for the residual amount of hiPSC is developed to evaluate the tumorigenic risk before clinical application, which can provide a guarantee for the safety of hiPSC-derived cell drug transplantation.

[0003] So far, the patents related to the detection kit for in vitro detection of hiPSC residues include a patent published on September 6, 2024, namely, a primer probe composition and a kit and application for detecting iPSC residues, patent number CN118600039A. The technology disclosed in this patent invention mainly uses digital PCR to detect the kit and its application for hiPSC residues. In addition to the kit method disclosed in the patent, the detection technology methods for hiPSC residues mainly include: 1) Culture method, that is, using hiPSC culture conditions, culturing the cells to be tested for 10-14 days, and the residual hiPSCs are cultured to form clones visible to the naked eye. This method detects the residues of hiPSCs, and the culture time is long. In addition, during the culture process, due to the inappropriateness of the culture medium or the poor cell state, some hiPSC cells will die and be lost, making it difficult to form clones, resulting in false negative results, or the clones formed are formed by other cells, resulting in false positive results; 2) Flow cytometry, that is, using stem cell marker proteins (SSEA3, SSEA4, TRA-1-8 1) Labeling the cells to be tested with antibodies such as TRA-1-60, etc. The proportion of flow cytometry positive cell populations is the residual hiPSC. The detection sensitivity of this method is only one thousandth, and the detection limit is low, which cannot meet the detection limit required by industry standards; 3) Immunofluorescence staining method, that is, the cells to be tested are seeded in the culture plate, and the cells are immunochemically stained after the cells adhere to the wall. This method has extremely low sensitivity and has high requirements for cell plating density and antibody specificity. Improper staining background or processing process is prone to false positive phenomenon, and the resolution of the fluorescence microscope is required to be high; 4) qRT-PCR detection method, that is, collecting the cells to be tested, extracting cell RNA for reverse transcription, and using SYBR Green fluorescent dye method to relatively quantitatively detect the expression levels of stem cell-specific genes such as TDGF1 and ESRG. SYBR Green fluorescent dye is a non-specific fluorescent dye that cannot recognize specific double strands. As long as it is a double strand (including non-specific amplification products, primer dimers, etc.), it will combine to emit light, and false positives may occur during detection; 5) Using the primer-probe combination detection method of the digital PCR instrument to obtain the copy number of the residual cell gene. This method requires the use of a high-precision digital PCR instrument, which has a high detection cost and is not suitable for mass testing laboratories; 6) Single-cell sequencing technology is used in combination with bioinformatics analysis to analyze hiPSC residues at the whole-genome transcriptome level to obtain accurate results, but the detection is time-consuming, data analysis is difficult and requires professional personnel, and the detection cost is high. Summary of the invention

[0004] The present invention provides a kit for rapidly detecting hiPSC residues in hiPSC-derived cells, thereby effectively solving the technical problems of high instrument requirements, poor conventional detection sensitivity and complex process in existing hiPSC residue detection.

[0005] In order to achieve the above-mentioned purpose, in one aspect of the present invention, a kit for rapid detection of hiPSC residues in hiPSC-derived cells is provided, the kit comprising 6 components, namely, a NANOG gene primer-probe combination, a TaqManFast qPCR premix, a standard plasmid, a positive control, a sensitivity control, and a sample dilution buffer; the NANOG gene primer-probe combination comprises a forward primer, a reverse primer and a probe; the nucleotide sequence of the forward primer is SEQ ID NO: 1; the nucleotide sequence of the reverse primer is SEQ ID NO: 2; the nucleotide sequence of the probe is SEQ ID NO: 3; the fluorescent group labeled at the 5' end is FAM, and the fluorescent quenching group labeled at the 3' end is BHQ1.

[0006] Furthermore, the total PCR reaction system of the kit for rapid detection of hiPSC residues in hiPSC-derived cells is 20 μL, which includes 10 μL TaqMan Fast qPCR premix, 7 μL sample dilution buffer, 1 μL NANOG gene primer probe combination, and 2 μL template; the template refers to standard plasmid, positive control, sensitivity control and cDNA of the sample to be tested.

[0007] Furthermore, the PCR reaction procedure of the kit for rapid detection of hiPSC residues in hiPSC-derived cells is 94° C. (3 min), 94° C. (5 s), 60° C. (30 s), and repeated cycles are 40 times.

[0008] Furthermore, the standard plasmid has a size of 3036 bp, contains a 1175 bp TDGF1-NANOG target fragment gene, and the copy number of the standard plasmid is 9.47×10 10 copies / μL.

[0009] Furthermore, the standard plasmid comprises an amplification primer pair during the construction process, which are TDGF1 gene amplification primers, whose nucleotide sequences are SEQ ID NO:4 and SEQ ID NO:14, and the amplified fragment sequence is SEQ ID NO:18; NANOG gene amplification primers, whose nucleotide sequences are SEQ ID NO:15 and SEQ ID NO:16, and the amplified fragment sequence is SEQ ID NO:19; TDGF1-NANOG fusion PCR amplification primers, whose nucleotide sequences are SEQ ID NO:4 and SEQ ID NO:17, and the amplified fragment sequence is SEQ ID NO:20.

[0010] Furthermore, the positive control is a reverse transcription product of hiPSC; the reverse transcription product is cDNA obtained by reverse transcription of 1 μg RNA.

[0011] Furthermore, the sensitivity control substance is the reverse transcription product of 0.01% hiPSC and 99.99% SH-SY5Y mixed cells; the reverse transcription product is cDNA obtained by reverse transcription of 1 μg RNA; and the sample dilution buffer contains 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA-Na2 (pH 8.0).

[0012] Exemplarily, in the kit for rapid detection of hiPSC residues in hiPSC-derived cells, the NANOG gene is used as a biomarker for detecting or evaluating hiPSC residues.

[0013] Illustratively, the kit for rapid detection of hiPSC residues in hiPSC-derived cells is used for rapid detection of hiPSC residues in hiPSC-derived cells.

[0014] Exemplarily, the kit for rapid detection of hiPSC residues in hiPSC-derived cells is used to detect the residual amount of hiPSC in human induced pluripotent stem cell mesoderm-differentiated cardiomyocyte precursor cells (hiPSC-CVPC), cardiomyocytes (hiPSC-CM), ectoderm-differentiated dopaminergic neural precursor cells (hiPSC-DAP), dopaminergic neurons (hiPSC-mDA) and endoderm-differentiated cell therapy drug products.

[0015] Compared with the prior art, the present invention has the following beneficial effects: the present invention mainly uses Taqman fluorescent probe quantitative PCR technology to form a qPCR-Taqman fluorescent probe detection kit, and calculates the residual amount of hiPSC in the induced differentiated cells of human induced pluripotent stem cells by detecting the copy number of the gene NANOG. Through the use of Taqman probes, the kit of the present application has a higher detection sensitivity, and the detection sensitivity can reach 1 / 10,000 to 1 / 100,000, and the copy number of the gene can be accurately calculated through the standard curve; by utilizing the fact that the NANOG gene has a high expression in hiPSC, but is not expressed in differentiated cells or adult functional cell lines, the residual detection of hiPSC in various functional cells derived from hiPSC can be more efficiently achieved. The detection cost is lower, and the detection can be efficiently completed for enterprises without digital PCR, and the detection efficiency is higher. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a diagram of the plasmid structure of the standard plasmid DNA containing TDGF1 and NANOG genes.

[0017] Figure 2This is a graph showing the differences in expression levels of pluripotency genes NANOG, TDGF1, OCT4, SOX2, PODXL, and ST3GAL2 in hESC, hiPSC, hPBMC, SH-SY5Y, and 293T cells.

[0018] Figure 3-A This is the amplification curve of the TDGF1 gene using the SYBR Green fluorescent dye method.

[0019] Figure 3-B This is the standard curve of the SYBR Green fluorescent dye method for the TDGF1 gene.

[0020] Figure 4-A This is the amplification curve of the NANOG gene using the SYBR Green fluorescent dye method.

[0021] Figure 4-B This is the standard curve of the SYBR Green fluorescent dye method for the NANOG gene.

[0022] Figure 5-A This is the amplification curve of the NANOG gene using the Taqman fluorescent probe method.

[0023] Figure 5-B This is the standard curve of the Taqman fluorescent probe method for the NANOG gene.

[0024] Figure 6 Amplification curves of hiPSC residues in human induced pluripotent stem cell-derived cardiomyocyte progenitor cells (hiPSC-CVPCs), cardiomyocytes (hiPSC-CMs), human induced pluripotent stem cell-derived dopaminergic neural progenitor cells (hiPSC-DAPs), and dopaminergic neurons (hiPSC-mDAs) detected by qPCR-Taqman fluorescent probe method. DETAILED DESCRIPTION

[0025] The following will be combined with the drawings in the embodiments of the present application to clearly and completely describe the technical solutions in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0026] The terms "first" and "second" in the description and claims of the embodiments of the present application are used to distinguish different objects rather than to describe a specific order of the objects. For example, the first guide wheel and the second guide wheel are used to distinguish different dielectric layers rather than to describe a specific order of the dielectric layers.

[0027] In the description of the embodiments of the present application, unless otherwise specified, the meaning of "plurality" refers to two or more than two. For example, a plurality of elements refers to two elements or more than two elements.

[0028] In the embodiments of the present application, words such as "exemplary" or "for example" are used to indicate examples, illustrations or descriptions. Any embodiment or design described as "exemplary" or "for example" in the embodiments of the present application should not be interpreted as being more preferred or more advantageous than other embodiments or designs. Specifically, the use of words such as "exemplary" or "for example" is intended to present related concepts in a specific way.

[0029] In order to solve the technical problems of high cost, poor accuracy and complicated process of hiPSC residue detection in the prior art, the present invention provides a kit for rapid detection of hiPSC residues in hiPSC-derived cells, the kit comprising 6 components, namely, a NANOG gene primer probe combination, a TaqMan Fast qPCR premix, a standard plasmid, a positive control, a sensitivity control, and a sample dilution buffer; the reagent components and ingredients are shown in Table 1 below; the NANOG gene primer probe combination comprises a forward primer, a reverse primer and a probe; the nucleotide sequence of the forward primer is SEQ ID NO: 1; the nucleotide sequence of the reverse primer is SEQ ID NO: 2; the nucleotide sequence of the probe is SEQ ID NO: 3; the fluorescent group labeled at the 5' end is FAM, and the fluorescent quenching group labeled at the 3' end is BHQ1. Therefore, the qPCR-Taqman fluorescent probe detection kit is formed mainly based on the Taqman fluorescent probe quantitative PCR technology. By detecting the copy number of the gene NANOG, the residual amount of hiPSC in the induced differentiated cells of human induced pluripotent stem cells is calculated. Through the use of Taqman probes, the kit of the present application has a higher detection sensitivity, which can reach 1 / 10,000 to 1 / 100,000. The copy number of the gene can be accurately calculated through the standard curve; by taking advantage of the fact that the NANOG gene has a high expression in hiPSC, but is not expressed in differentiated cells or adult functional cell lines, the residual hiPSC in various functional cells derived from hiPSC can be detected more efficiently.

[0030] Table 1 qPCR-Taqman kit components

[0031]

[0032] The present invention uses the qPCR method to optimize and screen primers of multiple genes, obtains the NANOG gene as the final detection gene, and provides a primer-probe combination. The upstream primer nucleotide sequence is CTCAGCTACAAACAGGTGAA (SEQ ID NO: 1), the downstream primer nucleotide sequence is CTGGTGGTAGGAAGAGTAAA (SEQ ID NO: 2), the Taq-NANOG probe nucleotide sequence: TTCCAGAACCAGAGAATGAAATCTAAGAGGTGGCA (SEQ ID NO: 3), the probe 5' end is modified with a FAM (6-carboxyfluorescein) reporter group, and the 3' end is modified with a BHQ1 (black hole quencher-1) fluorescence quenching group. The target sequence size is 150bp, and the nucleotide sequence is:

[0033] CTCAGCTACAAACAGGTGAAGACCTGGTTCCAGAACCAGAGAATGAAATCTAAGAGGT

[0034] GGCAGAAAAACAACTGGCCGAAGAATAGCAATGGTGTGACGCAGAAGGCCTCAGCAC CTACCTACCCCAGCCTTTACTCTTCCTACCACCAG (SEQ ID NO: 22).

[0035] The standard plasmid provided in the kit of the present invention is constructed by cloning TDGF1 and NANOG genes into the pBM16A vector using fusion PCR technology. The cDNA sequences of TDGF1 and NANOG genes were obtained from the NCBI database, and amplification primers were designed using the above two gene sequences as templates. The upstream primer sequence of TDGF1 amplification is

[0036] GGATACCTGGCCTTCAGAGAT (SEQ ID NO: 4), the downstream primer sequence for TDGF1 amplification is

[0037] ACAAGCTGGATCCACACTCATTTTGGAAATGTATTCATTATT (SEQ ID NO: 14), the amplified fragment size is 601 bp (SEQ ID NO: 18); the NANOG amplification upstream primer sequence is

[0038] AATAATGAATACATTTCCAAAATGAGTGTGGATCCAGCTTGT (SEQ ID NO: 15), the downstream primer sequence for NANOG amplification is TCACACGTCTTCAGGTTGCAT (SEQ ID NO: 16), and the amplified fragment size is 930 bp (SEQ ID NO: 19); the upstream primer sequence for TDGF1-NANOG fusion PCR amplification is

[0039] GGATACCTGGCCTTCAGAGAT (SEQ ID NO: 4), the downstream primer sequence of TDGF1-NANOG fusion PCR amplification was GGTTGCTCCACATTGGAAGG (SEQ ID NO: 17), and the amplification length of the fusion PCR was 1175 bp (SEQ ID NO: 20).

[0040] The primers and probes mentioned above were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0041] The 1175 bp target fragment TDGF1-NANOG gene was cloned into the pBM16A vector. After ligation and transformation, the standard plasmid was extracted. The plasmid size was 3036 bp. The plasmid map is shown in Figure 1 According to the formula: plasmid copy number = plasmid concentration (ng / μL) × Atschott constant / molecular weight (Atschott constant = 6.02 × 10 23 , molecular weight = number of DNA bases × 660 Daltons / base), the copy number of the positive plasmid standard was calculated to be 9.47 × 10 10 copies / μL.

[0042] Exemplarily, the total PCR reaction system of the kit for rapid detection of hiPSC residues in hiPSC-derived cells is 20 μL, including 10 μL TaqMan Fast qPCR premix, 7 μL sample dilution buffer, 1 μL NANOG gene primer probe combination, and 2 μL template; the template refers to standard plasmid, positive control, sensitivity control and cDNA of the sample to be tested.

[0043] Exemplarily, the PCR reaction procedure of the kit for rapid detection of hiPSC residues in hiPSC-derived cells is 94° C. (3 min), 94° C. (5 s), 60° C. (30 s), and repeated 40 cycles.

[0044] For example, the standard plasmid has a size of 3036 bp, contains a 1175 bp TDGF1-NANOG target fragment gene, and the copy number of the standard plasmid is 9.47×10 10 copies / μL.

[0045] Exemplarily, the standard plasmid comprises an amplification primer pair during the construction process, which are TDGF1 gene amplification primers, whose nucleotide sequences are SEQ ID NO:4 and SEQ ID NO:14, and the amplified fragment sequence is SEQ ID NO:18; NANOG gene amplification primers, whose nucleotide sequences are SEQ ID NO:15 and SEQ ID NO:16, and the amplified fragment sequence is SEQ ID NO:19; TDGF1-NANOG fusion PCR amplification primers, whose nucleotide sequences are SEQ ID NO:4 and SEQ ID NO:17, and the amplified fragment sequence is SEQ ID NO:20.

[0046] Exemplarily, the positive control is a reverse transcription product of hiPSC; the reverse transcription product is cDNA obtained by reverse transcription of 1 μg RNA.

[0047] Exemplarily, the sensitivity control is a reverse transcription product of 0.01% hiPSC and 99.99% SH-SY5Y mixed cells; the reverse transcription product is cDNA obtained by reverse transcription of 1 μg RNA; and the sample dilution buffer contains 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA-Na2 (pH 8.0).

[0048] The present invention provides a kit for rapid detection of hiPSC residues in hiPSC-derived cells, which mainly uses the NANOG gene as a biomarker for detecting or evaluating the amount of hiPSC residues, and uses the Taqman fluorescent probe quantitative PCR technology to achieve the detection purpose. The total system of the Taqman fluorescent probe quantitative PCR reaction is 20 μL, which is 10 μL TaqMan Fast qPCR premix, 7 μL sample dilution buffer, 1 μL NANOG gene primer probe combination, and 2 μL template; the PCR reaction program is 94°C (3min), 94°C (5s), 60°C (30s), and repeated cycles 40 times. The positive control used in the kit is the reverse transcription product of hiPSC, and the sensitivity control is the reverse transcription product of 0.01% hiPSC and 99.99% SH-SY5Y mixed cells, both of which are cDNA obtained by reverse transcription of 1 μg mRNA. The sample dilution buffer provided in the kit is composed of 10mM Tris-HCl (pH8.0) and 1mM EDTA-Na2 (pH 8.0).

[0049] The following is attached to the instruction manual Figure 2-6 The detection process of the kit for rapidly detecting hiPSC residues in hiPSC-derived cells of the present invention is described in detail.

[0050] 1. Extraction of sample mRNA. The extraction of total cell mRNA was completed using the Tiangen micro RNA extraction kit.

[0051] 2. Total mRNA is reverse transcribed into cDNA. This is done using Evo M-MLV reverse transcription premix kit from Acryl. The specific method is as follows: 1) Use an ultra-micro spectrophotometer to measure the mRNA concentration and calculate, and perform a reverse reaction at a concentration of 1.0 μg; 2) Remove genomic DNA according to the system in Table 2, and react in a PCR instrument (incubate at 42°C for 2 minutes); 3) Premix the reagents with total mRNA according to Table 3, transfer the PCR tube to the PCR instrument for reaction (37°C for 15 minutes; 85°C for 5 seconds), and quickly transfer the reversed cDNA solution to ice for 1 minute after completion; 4) Store the cooled cDNA solution in an environment of -20°C.

[0052] Table 2 Genomic DNA removal reaction system

[0053]

[0054] Table 3 mRNA and reverse transcription reagent premix

[0055]

[0056] 3. Dilution of the standard. In the kit described in Table 3, the copy number of the standard plasmid is 9.47×10 8 After the standard was gently shaken and mixed, 1 μL of the standard plasmid (9.47×10 8 copies / μL) were added to 9 μL of sample dilution buffer, pipetted up and down 10 times and vortexed to mix, i.e. the copy number was 9.47×10 7 With this sample as the initial standard concentration, 1 μL was taken to 9 μL of sample dilution buffer, pipetted up and down 10 times and vortexed to mix, and a 10-fold series of dilutions was performed in this way. The plasmid concentration was 9.47×10 6 copies / μL、9.47×10 5 copies / μL、9.47×10 4 copies / μL、9.47×10 3 copies / μL、9.47×10 2 copies / μL、9.47×10 1 A new pipette tip was used to draw the sample each time dilution was performed.

[0057] 4. Preparation of qPCR-Taqman reaction system. According to the number of standards, samples to be tested, positive controls, sensitivity controls, negative template controls, and negative reverse transcription controls (3 sets of duplicate wells), calculate the number of wells required for the reaction: number of wells = (7 sets of standards + 1 positive control PC + 1 no template control NTC + 1 negative extraction control NRT + 1 sensitivity control + samples to be tested) × 3. Calculate the qPCR Mix required for this reaction based on the number of wells: qPCRMix = (number of wells + 2 or 3) × 18 μL, (2 or 3 is the amount of operational loss).

[0058] After the reagents used in the kit were melted on ice, they were gently shaken to mix, and the qPCR Mix was prepared as shown in Table 4, and the PCR reaction system was prepared as shown in Table 5 (wherein the negative extraction control NRT is the product of the negative control during mRNA extraction after reverse transcription).

[0059] 5. Reaction program setting and amplification. qPCR-Taqman detection uses Tianlong's fully automatic medical PCR analyzer. Place the prepared PCR reaction tube in a 96-well reaction tank, set the reaction program according to Table 6, select the FAM fluorescence channel in the software system sample setting interface, and set the sample type, name and concentration in turn, and then amplify and run.

[0060] Table 4 qPCR-Taqman Mix

[0061]

[0062] Table 5 qPCR-Taqman all sample reaction systems

[0063]

[0064] Table 6 qPCR-Taqman reaction procedure

[0065]

[0066] 6. Result analysis. qPCR-Taqman uses a fully automatic medical PCR analyzer. The slope, Y-intercept, and R of the standard curve are displayed in the software system analysis interface. 2 Standard curve R 2 It should not be lower than 0.960, the positive control should be positive, and the Ct value should be <28; the sensitivity control should be positive, and the Ct value should be <38, which is considered valid.

[0067] In addition, the Ct value of the sample to be tested is displayed on the statistical interface, and the Ct value of the test result of the sample to be tested is substituted into the NANOG gene standard curve to calculate the starting copy number of NANOG in the sample; since the residual hiPSC in the sample and the hiPSC in the positive control are the same cell, the starting copy number of NANOG in each hiPSC cell is consistent, and the proportion of residual hiPSC can be obtained by dividing the starting copy number of NANOG in the sample by the starting copy number of NANOG in the hiPSC in the positive control, thereby realizing the detection of residual hiPSC.

[0068] Example 1

[0069] 1. Screening of test genes

[0070] The cell lines used in the test are: negative control cells hPBMC (human peripheral blood mononuclear cells), SH-SY5Y (human neuroblastoma cells), 293T (human embryonic kidney cells), and positive control cells hESC (human embryonic stem cells).

[0071] The cDNA sequences of pluripotency genes NANOG, TDGF1, OCT4, SOX2, PODXL, and ST3GAL2 were searched through the NCBI website, and primers were designed across the exon region, including the following qPCR detection primer pairs.

[0072] The upstream primer nucleotide sequence of NANOG: CTCAGCTACAAACAGGTGAA (SEQ ID NO: 1), the downstream primer nucleotide sequence: CTGGTGGTAGGAAGAGTAAA (SEQ ID NO: 2);

[0073] The nucleotide sequence of the upstream primer of TDGF1 is: GGATACCTGGCCTTCAGAGAT (SEQ ID NO: 4), and the nucleotide sequence of the downstream primer is: CTCCTTACTGTGCTGTATCCC (SEQ ID NO: 5);

[0074] The upstream primer nucleotide sequence of OCT4 is: GTATCGAGAACCGAGTGAGAGG (SEQ ID NO: 6), and the downstream primer nucleotide sequence is: AACCACACTCGGACCACATC (SEQ ID NO: 7);

[0075] The upstream primer nucleotide sequence of SOX2 is: ACATGAACGGCTGGAGCAAC (SEQ ID NO: 8), and the downstream primer nucleotide sequence is: GGTCATGGAGTTGTACTGCA (SEQ ID NO: 9);

[0076] The upstream primer nucleotide sequence of PODXL is: TGAACCTCACAGGAAACACC (SEQ ID NO: 10), and the downstream primer nucleotide sequence is: AGGGAGCTTAGTGTGAATAG (SEQ ID NO: 11);

[0077] The nucleotide sequence of the upstream primer of ST3GAL2 is: AGCCACTTTGACGGTAACA (SEQ ID NO: 12), and the nucleotide sequence of the downstream primer is: TGGAACAGCTTCTCAGCA (SEQ ID NO: 13).

[0078] Total mRNA was extracted from hESC, hiPSC, hPBMC, SH-SY5Y, and 293T cell samples using Tiangen Micro RNA Extraction Kit, and mRNA was reverse transcribed into cDNA using Evo M-MLV Reverse Transcription Premix Kit from Arcori.

[0079] The SYBR Green fluorescent dye method was used to detect the expression levels of NANOG, TDGF1, OCT4, SOX2, PODXL, and ST3GAL2 genes in hESC, hiPSC, hPBMC, SH-SY5Y, and 293T cells. The reaction system is shown in Table 7, and the reaction procedure is shown in Table 8.

[0080] Table 7 qPCR-SYBR Green reaction system

[0081]

[0082] Table 8 qPCR-SYBR Green reaction procedure

[0083]

[0084] The amplification results were calculated using the relative quantitative method: using 2 -ΔΔCt The analytical method calculates the analytical value, deducts the blank and baseline fluorescence signals to obtain the Ct value of all samples. ΔCt = target gene Ct - internal reference Ct, ΔΔCt is the difference between the ΔCt values ​​of the group comparison, that is, ΔΔCt = target gene ΔCt in the experimental group sample - target gene ΔCt in the control group sample; relative to the initial template amount, 2 -ΔΔCt The results show.

[0085] The results are shown in Table 9 and Figure 2As shown in the figure, the results of qPCR-SYBR Green detection of Ct values ​​and data analysis showed that NANOG and TDGF1 genes were highly expressed in both hiPSC and hESC, while the Ct values ​​in hPBMC, SH-SY5Y, and 293T were all greater than 30, indicating that they were not expressed. Therefore, NANOG and TDGF1 genes can be used as candidate genes for residual detection in hiPSC.

[0086] Table 9 Screening of pluripotency genes OCT4, SOX2, NANOG, TDGF1, TRA-1-81, SSEA4

[0087]

[0088]

[0089] hPBMC: human peripheral blood mononuclear cells;

[0090] hESC: human embryonic stem cell;

[0091] hiPSC: human induced pluripotent stem cells;

[0092] SH-SY5Y: human neuroblastoma cells;

[0093] 293T: human embryonic kidney cells.

[0094] 2. Determination of the minimum detection line of candidate genes NANOG and TDGF1

[0095] The SYBR Green fluorescent dye method was used to determine the lowest detection line of candidate genes NANOG and TDGF1, and further screen the detection genes.

[0096] The prepared standard plasmid was used to establish a SYBR Green standard curve. The NANOG gene used a primer pair of SEQ ID NO: 1 and SEQ ID NO: 2, and the TDGF1 gene used a primer pair of SEQ ID NO: 4 and SEQ ID NO: 5. The detection reaction system and reaction procedure are shown in Tables 7 and 8. The standard curve was drawn based on the Ct value of the detection result and the logarithmic value of the gene copy number Log (C). Figure 3 is the amplification curve and standard curve of the SYBR Green fluorescent dye method for the NANOG gene. Figure 4 is the amplification curve and standard curve of the SYBR Green fluorescent dye method for the TDGF1 gene.

[0097] SH-SY5Y was purchased from Wuhan Punosai Life Science Co., Ltd. SH-SY5Y cells were mixed with hiPSC in different proportions, i.e., 100% hiPSC + 0% SH-SY5Y, 10% hiPSC + 90% SH-SY5Y, 1% hiPSC + 99% SH-SY5Y, 0.1% hiPSC + 99.9% SH-SY5Y, 0.01% hiPSC + 99.99% SH-SY5Y, 0.001% hiPSC + 99.999% SH-SY5Y, 0% hiPSC + 100% SH-SY5Y. Total mRNA was extracted from the mixed cells and reverse transcribed to obtain cDNA. The NANOG gene used primer pairs of SEQ ID NO: 7 and SEQ ID NO: 8; the TDGF1 gene used primer pairs of SEQ ID NO: 5 and SEQ ID NO: 6. The detection reaction system and reaction procedure are shown in Tables 7 and 8.

[0098] The TDGF1 and NANOG genes were detected in the above 7 SH-SY5Y cell samples with different hiPSC residual ratios, and the detection CT values ​​are shown in Table 10. When the residual ratio of hiPSC is greater than 0.1%, the CT values ​​of both are less than 30, which is within the detection range; when the residual ratio of hiPSC is less than or equal to 0.1%, compared with the CT value of TDGF1, the NANOG gene is within the detection range, so the detection sensitivity can be as low as 0.01%. According to the standard curve calculation, the minimum detection line of NANOG is 1.41 copies / μL, and the minimum detection line of TDGF1 is 3.16 copies / μL. Therefore, the NANOG gene was selected as the final detection target gene.

[0099] Table 10 qPCR-SYBR Green fluorescence staining method to screen target genes

[0100]

[0101] 3. Verification of the accuracy of the qPCR-Taqman detection kit

[0102] The starting copy number of the NANOG gene in hiPSCs was detected by qPCR-Taqman detection kit, digital PCR (ddPCR) method and SYBR Green fluorescent dye method, respectively, to verify the accuracy of the detection kit.

[0103] Prepare two hiPSC cell lines, hiPSC-1 and hiPSC-2. Collect 3×10 6 Cells, using Tiangen micro RNA extraction kit, total mRNA was extracted from the test samples hiPSC-1 and hiPSC-2.

[0104] The total mRNA of the test samples hiPSC-1 and hiPSC-2 was reverse transcribed using Evo M-MLV reverse transcription premix kit from Acryl. After obtaining cDNA, it was placed on ice and divided into three parts for future use.

[0105] 1. qPCR-Taqman fluorescent probe kit was used to detect the initial copy number of NANOG gene in hiPSC.

[0106] Take one of the cDNAs of hiPSC-1 and hiPSC-2 and use the qPCR-Taqman fluorescent probe kit to detect the starting copy number of the NANOG gene in hiPSC. For specific detection methods, see the instructions for use of the kit for hiPSC residues in hiPSC-derived cells. Figure 5-B The standard curve was used to calculate the starting copy number of the NANOG gene in hiPSC-1 and hiPSC-2.

[0107] 2. SYBR Green fluorescent dye method was used to detect the starting copy number of NANOG gene in hiPSCs.

[0108] One of the remaining two samples of hiPSC-1 and hiPSC-2 was used to obtain cDNA, and the starting copy number of the NANOG gene in hiPSC was detected using the qPCR-SYBRGreen fluorescent dye method. Figure 3-B The standard curve was used to calculate the starting copy number of the NANOG gene in hiPSC-1 and hiPSC-2.

[0109] 3.ddPCR detected the initial copy number of NANOG gene in hiPSCs.

[0110] The last cDNA of the above hiPSC-1 and hiPSC-2 was taken, and the starting copy number of the NANOG gene in hiPSC was detected by digital PCR.

[0111] The results of the initial copy number detection of the NANOG gene obtained by the three detection methods are shown in Table 11. The NANOG gene copy numbers of hiPSC-1 and hiPSC-2 obtained by the qPCR-Taqman fluorescent probe kit were 142756.55 copies / μL and 157387.21 copies / μL, respectively, and the NANOG gene copy numbers detected by digital PCR were 168517.87 copies / μL and 161252.93 copies / μL. The copy numbers detected by the qPCR-Taqman fluorescent probe method and digital PCR were close, and the difference between the two was small, indicating that the qPCR-Taqman fluorescent probe kit has high detection accuracy.

[0112] The SYBR Green fluorescent dye method detected the NANOG gene copy numbers of hiPSC-1 and hiPSC-2 to be 79181.40 copies / μL and 88526.69 copies / μL, respectively, which is quite different from the detection data of the above two methods. The reason is that SYBR Green fluorescent dye is a non-specific fluorescent dye, and false positives may occur during detection, so the formulation of the standard curve is not accurate, and the sample Ct value changes, which in turn affects the accuracy of the sample detection results. Therefore, the initial copy number of the NANOG gene obtained by the SYBR Green fluorescent dye method is the lowest, and the detection results are not accurate enough.

[0113] Therefore, the kit for rapid detection of hiPSC residues in hiPSC-derived cells can be applied to the precise detection of hiPSC residues in hiPSC-derived cell drugs using the qPCR-Taqman fluorescent probe method.

[0114] Table 11 Three methods for detecting the starting copy number of the NANOG gene in hiPSCs

[0115]

[0116] Example 2

[0117] The qPCR-Taqman fluorescent probe kit was used to detect the residual proportion of hiPSCs in cardiomyocyte progenitor cells (hiPSC-CVPC) and cardiomyocytes (hiPSC-CM) differentiated from the mesoderm of human induced pluripotent stem cells; the residual proportion of hiPSCs in dopaminergic neural progenitor cells (hiPSC-DAP) and dopaminergic neurons (hiPSC-mDA) differentiated from the ectoderm of human induced pluripotent stem cells.

[0118] The above cells are all from our company and are obtained from hiPSC through different induced differentiation processes.

[0119] Total mRNA was extracted from hiPSC-CVPC, hiPSC-CM, hiPSC-DAP, hiPSC-mDA, and hiPSC cell samples, and the mRNA was reverse transcribed into cDNA.

[0120] Take 1 μL of standard plasmid (9.47×10 8 copies / μL) were added to 9 μL of sample dilution buffer, pipetted up and down 10 times and vortexed to mix, i.e. the copy number was 9.47×10 7 With this sample as the initial standard concentration, 1 μL was taken to 9 μL of sample dilution buffer, pipetted up and down 10 times and vortexed to mix, and a 10-fold series of dilutions was performed in this way, which were 9.47×10 6copies / μL、9.47×10 5 copies / μL、9.47×10 4 copies / μL、9.47×10 3 copies / μL、9.47×10 2 copies / μL、9.47×10 1 copies / μL, for future use.

[0121] At the same time, prepare the standards, test samples, and controls required for the test, and calculate the number of wells required for the reaction: (7 sets of standards + 1 positive control PC + 1 template-free control NTC + 1 negative extraction control NRT + 1 sensitivity control SC + test sample) × 3. Calculate the qPCR Mix required for this time according to the number of reaction wells: qPCRMix = (number of reaction wells + 2) × 18 μL, (2 is the amount of operation loss). Prepare qPCRMix as shown in Table 4, prepare the PCR reaction system according to Table 5, and the reaction procedure is shown in Table 6. The proportion of residual hiPSCs can be obtained by dividing the starting copy number of NANOG in the sample by the starting copy number of NANOG in the positive control hiPSC.

[0122] The CT values ​​of the standard curve are shown in Table 12. The amplification curve and standard curve are shown in Figure 5-A and Figure 5-B .

[0123] The test results are shown in Table 13 and Figure 6 The results showed that hiPSC-CVPC differentiated from the mesoderm of human induced pluripotent stem cells had more residual hiPSCs than hiPSC-CM, which matched the process data of induced differentiation. The reason was that hiPSC-CVPC was not screened for hiPSC residues before differentiating into mature hiPSC-CM. The proportion of hiPSC residues in mature cardiomyocytes after lactate screening was low, and no residues were detected in the hiPSC-CM-3 sample, indicating that the hiPSC residues in the differentiated cardiomyocytes were less than one in ten thousand and were not within the detection range. The test also found that hiPSC-DAP differentiated from the ectoderm had more residual hiPSCs than hiPSC-mDA, indicating that there were more hiPSC residues in dopaminergic neural precursor cell differentiation cells, and process optimization was needed to reduce hiPSC residues. The sensitivity control test results showed that the sensitivity of the qPCR-Taqman fluorescent probe kit for hiPSC residue detection can reach one in ten thousand.

[0124] Table 12 CT values ​​of the standard curve of qPCR-Taqman fluorescent probe kit

[0125]

[0126]

[0127] Table 13 Residual ratio of hiPSCs in hiPSC-induced differentiated cardiomyocytes and dopaminergic neuronal cells detected by qPCR-Taqman fluorescent probe kit

[0128]

[0129] The above embodiments are all used to illustrate the contents of the kit of the present invention. The kit of the present invention is not limited to the specific embodiment described, i.e., the residual detection of hiPSC in the mesoderm and ectoderm differentiated cells of hiPSC, but can also be used for the residual detection of hiPSC in the endoderm differentiated cells of hiPSC. The present invention selects and specifically describes these embodiments in order to better explain the research and development concept, detection principle and practical application of the kit of the present invention. Those skilled in the art can modify and replace these embodiment methods without departing from the principles of the present invention, and these modifications and replacements should also be regarded as the scope of protection of the present invention.

Claims

1. A kit for rapid detection of hiPSC residues in hiPSC-derived cells, characterized in that: The kit includes 6 components, namely, a NANOG gene primer-probe combination, a TaqMan Fast qPCR premix, a standard plasmid, a positive control, a sensitivity control, and a sample dilution buffer; the NANOG gene primer-probe combination includes a forward primer, a reverse primer, and a probe; the nucleotide sequence of the forward primer is SEQ ID NO: 1; the nucleotide sequence of the reverse primer is SEQ ID NO: 2; the nucleotide sequence of the probe is SEQ ID NO: 3; the fluorescent group labeled at the 5' end is FAM, and the fluorescent quenching group labeled at the 3' end is BHQ1.

2. The kit for rapid detection of hiPSC residues in hiPSC-derived cells according to claim 1, characterized in that: The total PCR reaction system of the kit for rapid detection of hiPSC residues in hiPSC-derived cells is 20 μL, which includes 10 μL TaqMan Fast qPCR premix, 7 μL sample dilution buffer, 1 μL NANOG gene primer probe combination, and 2 μL template; the template refers to standard plasmid, positive control, sensitivity control and cDNA of the sample to be tested.

3. The kit for rapid detection of hiPSC residues in hiPSC-derived cells according to claim 1, characterized in that: The PCR reaction procedure of the kit for rapid detection of hiPSC residues in hiPSC-derived cells is 94° C. (3 min), 94° C. (5 s), 60° C. (30 s), and repeated cycles are 40 times.

4. The kit for rapid detection of hiPSC residues in hiPSC-derived cells according to claim 1, characterized in that: The standard plasmid has a size of 3036 bp, contains a 1175 bp TDGF1-NANOG target fragment gene, and the copy number of the standard plasmid is 9.47×10 10 copies / μL.

5. The kit for rapid detection of hiPSC residues in hiPSC-derived cells according to claim 4, characterized in that: The standard plasmid comprises an amplification primer pair during the construction process, which are TDGF1 gene amplification primers, whose nucleotide sequences are SEQ ID NO:4 and SEQ ID NO:14, and the amplified fragment sequence is SEQ ID NO:18; NANOG gene amplification primers, whose nucleotide sequences are SEQ ID NO:15 and SEQ ID NO:16, and the amplified fragment sequence is SEQ ID NO:19; TDGF1-NANOG fusion PCR amplification primers, whose nucleotide sequences are SEQ ID NO:4 and SEQ ID NO:17, and the amplified fragment sequence is SEQ ID NO:

20.

6. The kit for rapid detection of hiPSC residues in hiPSC-derived cells according to claim 1, characterized in that: The positive control is a reverse transcription product of hiPSC; the reverse transcription product is cDNA obtained by reverse transcription of 1 μg RNA.

7. The kit for rapid detection of hiPSC residues in hiPSC-derived cells according to claim 1, characterized in that: The sensitivity control substance is the reverse transcription product of 0.01% hiPSC and 99.99% SH-SY5Y mixed cells; the reverse transcription product is cDNA obtained by reverse transcription of 1 μg RNA; the sample dilution buffer contains 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA-Na2 (pH 8.0).

8. In the kit for rapid detection of hiPSC residues in hiPSC-derived cells, the NANOG gene is used as a biomarker for detecting or evaluating hiPSC residues.

9. The kit for rapid detection of hiPSC residues in hiPSC-derived cells is used for rapid detection of hiPSC residues in hiPSC-derived cells.

10. The kit for rapid detection of hiPSC residues in hiPSC-derived cells is used to detect the residual amount of hiPSC in human induced pluripotent stem cell mesoderm-differentiated cardiomyocyte precursor cells (hiPSC-CVPC), cardiomyocytes (hiPSC-CM), ectoderm-differentiated dopaminergic neural precursor cells (hiPSC-DAP), dopaminergic neurons (hiPSC-mDA) and endoderm-differentiated cell therapy drug products.

Images