Molecular marker influencing nap character of northwest Tibetan white nap goat and application of molecular marker

Abstract

The invention discloses a molecular marker influencing nap traits of northwest Tibetan white nap goats and application of the molecular marker. The molecular marker comprises five genome road signs of genes CCSER1, RPS6KC1, KCNRG, KCNK9 and CLYBL which influence the villus traits of the northwest Tibetan white cashmere goats; comprising application in identification of northwest Tibetan white cashmere goats. According to the method, the nap character of the northwest Tibetan white cashmere goat is taken as a research object for the first time, and whole genome association analysis is carried out on the basis of a goat 70KSNP chip sequencing result and nap fineness, nap length, nap length and nap yield phenotype data. A plurality of candidate genes are screened from significant SNP loci associated with GWAS through gene annotation and GO and KEGG enrichment analysis, the significance of the significant loci and the candidate genes is verified by adopting an international sequencing gold standard-Sanger sequencing method, and finally it is determined that a plurality of genes significantly affect the nap traits of the northwest Tibetan white cashmere goats, so that a theoretical basis is laid for subsequent further research, and the method has a broad application prospect in the field of screening of the nap traits of the northwest Tibetan white cashmere goats. And the method has very important scientific significance for analyzing a genetic mechanism related to the villus character.

Description

Technical Field

[0001] The invention relates to the technical field related to molecular biology, and in particular to a molecular marker affecting the hair traits of northwestern Tibetan white cashmere goats and its application. Background Art

[0002] Goats belong to the order Artiodactyla, family Bovidae, subfamily Caprinae, and genus Capra in zoological classification. Goats have a long history in the development of animal husbandry in my country, and have the advantages of wide distribution, diverse varieties, and strong environmental adaptability. Among them, cashmere goats are mainly distributed in the area of ​​25°-55° north latitude and 40°-25° east longitude. In my country, they are mainly distributed in Yunnan, Guizhou, Sichuan and Tibet in the southwest, Shaanxi, Gansu, Ningxia, Qinghai and Xinjiang in the northwest, Inner Mongolia in North China, and the three provinces in the northeast. China is the country with the largest number of goats in the world and a major cashmere producer. It has more than 20 cashmere goat varieties (accounting for about 60% of the world). Among them, Liaoning Cashmere Goats, Inner Mongolia Cashmere Goats and Shaanxi White Cashmere Goats are among the best cashmere goats in the world in terms of hair diameter, length, glossiness and cashmere production, and are excellent cashmere goat varieties in my country.

[0003] As part of global biodiversity, cashmere goats have gone through a long process of natural selection and artificial breeding, and now have become one of the breeds with the highest cashmere production and the best cashmere fiber quality in the world. The most important economic value of cashmere goats comes from their cashmere fibers, which are thin and soft, white as snow, bright and shiny, and smooth to the touch. Textiles made from cashmere raw materials are unique in terms of lightness, comfort, warmth and elegance. They are known as "soft gold" and "fiber gems" and are popular in the global cashmere product market. Cashmere has become a high-end and precious fine spinning raw material with its unique quality. There are many cashmere companies in China, such as Ordos, Hengyuan Xianghe 1436, etc. Cashmere is an important livestock product for export and foreign exchange earning in my country. my country is currently the world's largest cashmere producer, with cashmere production accounting for more than 50% of the global output and total trade accounting for about 70% of the global total.

[0004] The Northwest Tibetan White Cashmere Goat is the first new cashmere goat breed in the Tibet Autonomous Region, bred by the Tibet Autonomous Region Academy of Agricultural and Animal Husbandry Sciences, the Beijing Animal Husbandry and Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, the Rutog County Original Breeding Farm, and the Nima County White Cashmere Goat Original Breeding Farm. The Ali region is located in a high-altitude and cold area. The interaction between genes and the environment on phenotypic traits is comprehensively considered during the breeding process of the Northwest Tibetan White Cashmere Goat. The Northwest Tibetan White Cashmere Goat has extremely high indicators such as fineness, glossiness and softness, and the new variety of the Northwest Tibetan White Cashmere Goat is still in the stage of breeding and expanding the fine variety. Its cashmere production tends to be in short supply in the domestic and foreign cashmere markets.

[0005] Most of the villi quality traits are quantitative traits, which refer to traits that are controlled by a few major genes and gene networks, modified by a large number of minor genes and the environment, interact between genes and between genes and the environment, and whose gene expression is affected by other genes, small biological molecules, and gene methylation, and present continuous variation or non-Mendelian discontinuous variation. That is, the variation of villi quality is continuous, and the variation is easily affected by environmental conditions. The earliest genetic improvement method for quantitative traits was to select the phenotypic traits of individuals, including individual selection, family selection, and mixed selection. With the introduction of the concept of quantitative genetics in the 1920s, quantitative genetics has undergone a continuous development and progress process, and has achieved remarkable results in analyzing the genetic mechanism of quantitative traits and the laws of biological evolution. Most of the economic traits of animals and plants are quantitative traits, and analyzing the genetic variation mechanism of quantitative traits is of great significance for genetic breeding.

[0006] The Northwest Tibetan White Cashmere Goat is the first new breed of goats bred in Tibet, and is also the only new breed of cashmere goats bred in high-altitude areas above 4,500 meters above sea level in my country that can be used for both cashmere and meat. The Northwest Tibetan White Cashmere Goat is world-renowned for its high-quality cashmere, and the cashmere goat industry has driven the rapid and sustainable economic development of the Northwest Tibetan region. With the rapid development of high-throughput genotyping technology and chip technology, whole-genome association analysis has become an important means to explore the relevant loci and candidate genes of important economic traits of animals and plants. At present, domestic and foreign researchers have conducted a lot of research on the important economic traits of cashmere goats and discovered a large number of significant loci, but there is still a lack of more comprehensive and systematic analysis of the genetic mechanism of cashmere goat wool traits. There is still a lack of important scientific references for further analyzing the genetic mechanism of important economic traits of this variety of cashmere goats, exploring key loci and candidate genes, and planning genome selection breeding programs.

[0007] In view of this, we conducted in-depth research on the above issues, which led to the present case. Summary of the invention

[0008] The purpose of the present invention is to provide a molecular marker affecting the hair traits of the Northwest Tibetan White Cashmere Goat and its application, so as to solve the problem that there is still a lack of a more comprehensive and systematic analysis of the genetic mechanism of the hair traits of the cashmere goat proposed in the above background technology, and there is still a lack of important scientific references for further analyzing the genetic mechanism of important economic traits of this variety of cashmere goat, exploring key sites and candidate genes, and planning genome selection breeding programs.

[0009] To achieve the above object, the present invention provides the following technical solutions: a molecular marker affecting the hair traits of Northwest Tibetan white cashmere goats; The molecular markers include 5 genes that affect the hair traits of Northwest Tibetan White Cashmere Goats CCSER1, RPS6KC1, KCNRG, KCNK9 and CLYBLGenomic roadmaps; CCSER1 (coiled-coil serine rich protein 1) is a coiled-coil serine rich protein encoding gene, located between 33559344bp and 35024683bp on chromosome 6 of the goat genome; the specific primers for the marker are: F 5'GTGTTATCCCTAGAGAGCCTGTTTC 3' R 5' AGCATGAACCTCAAAGACTGGAAG 3' RPS6KC1 (ribosomal protein S6 kinase C1) is a ribosomal protein kinase encoding gene, located between 68984514bp and 69197148bp on chromosome 16 of the goat genome; the specific primers for the marker are: F 5' GCATCCACAGTTCCAGCAGAAG 3' R 5' CAGAAGCCCAGCACTCGTTTG 3' KCNRG Potassium channel regulator (potassium channel regulator) is a protein encoding a potassium channel regulatory factor, located between 67128486bp and 67135129bp on chromosome 12 of the goat genome; the specific primers for the marker are: F 5' CTGTGGGAGATAAAGATAGGGCATC 3' R 5' AAGTGTTAGTGACTGTAAGCCAAGG 3' KCNK9 (potassium two pore domain channel subfamily K9) is the protein encoding gene of potassium ion channel two pore domain subfamily K member 9, located between 78410779bp and 78514184bp on chromosome 14 of the goat genome; the specific primers for the marker are: F 5' GCCTCTCTGGAATATCCTCCTATGG 3' R 5'CATCGCCTTCTCTGGTTTGTTGG 3' CLYBL(citramalyl-CoA lyase) is a gene encoding citramalyl-CoA protein, located between 9645150bp and 9878794bp on chromosome 12 of the goat genome; the specific primers for the marker are: F 5' AACAAGAGAAACCAGCGAAAGGAG 3' R 5'ACACGAGAGCCACTGGAATGAG 3'.

[0010] The molecular markers were used to conduct genome-wide association analysis on the four phenotypic traits of cashmere length, cashmere fineness, hair length and cashmere production of the Northwest Tibetan White Cashmere Goat. A total of 18 significant SNPs were associated at the genome level and 232 SNPs were associated at the chromosome level. After gene annotation of the significant sites, the CCSER1, RPS6KC1, KCNRG, KCNK9 and CLYBL All of them are genes that affect the cashmere length traits of Northwest Tibetan white cashmere goats; These five genes all cover the significant SNPs associated with GWAS; CCSER1 The gene is significantly associated with the wool length trait. RPS6KC1 The gene was significantly associated with the trichome trait. KCNRG Genes significantly associated with hair length traits, KCNK9 and CLYBL The gene was significantly correlated with the wool yield trait.

[0011] The invention discloses the application of molecular markers affecting the hair traits of northwestern Tibetan white cashmere goats, including the application of the primers in the identification of northwestern Tibetan white cashmere goats.

[0012] The application is specifically used in identifying the hair characteristics of Northwest Tibetan white cashmere goats.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows: the molecular markers and applications that affect the hair traits of the Tibetan Northwest White Cashmere Goat are used as the research object for the first time, and the whole genome association analysis is performed based on the sequencing results of the goat 70K SNP chip and the phenotypic data of hair fineness, hair length, hair length and hair production. The significant SNP sites associated with GWAS are screened for several candidate genes through gene annotation and GO and KEGG enrichment analysis, and the significance of the significant sites and candidate genes is verified by the international sequencing gold standard-Sanger sequencing method, and it is finally determined that multiple genes significantly affect the hair traits of the Tibetan Northwest White Cashmere Goat, which lays a theoretical foundation for further research in the future, and has extremely important scientific significance for analyzing the genetic mechanism related to hair traits. From the whole genome level, multiple significant mutation sites that affect the hair traits of the Tibetan Northwest White Cashmere Goat are mined. In the future, these functional mutation sites can be used to screen high-quality individuals in the production population through genotype detection, and then the breeding of fine varieties can be achieved, and the production performance of the new breed of cashmere goat population can be gradually improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a schematic diagram of the main test instruments of Example 1 of the present invention; Figure 2 This is a schematic diagram of the descriptive statistics of the hair trait phenotype of the Northwest Tibetan white cashmere goat in Example 1 of the present invention; Figure 3 The frequency distribution histogram of the wool traits of the Northwest Tibetan white cashmere goat in Example 1 of the present invention; Figure 4 This is a heat map of correlation analysis of hair traits of Northwest Tibetan white cashmere goats in Example 1 of the present invention; Figure 5 This is the distribution map of goat autosomes of SNP sites in Example 1 of the present invention; Figure 6 This is a principal component analysis diagram of Example 1 of the present invention; Figure 7 The kinship matrix K of Example 1 of the present invention is a matrix kinship heat map; Figure 8 This is the LD attenuation diagram of Example 1 of the present invention; Fig. 9 The QQ plot and Manhattan plot of the cashmere length trait of Example 1 of the present invention; Fig.10 This is the GWAS candidate gene list for the velvet length trait in Example 1 of the present invention; Fig.11 QQ plot and Manhattan plot of the fineness of the wool in Example 1 of the present invention; Fig.12 This is the GWAS candidate gene list for the fine trait in Example 1 of the present invention; Fig.13 QQ plot and Manhattan plot of the hair length trait of Example 1 of the present invention; Fig.14 is a list of GWAS candidate genes for the hair length trait in Example 1 of the present invention; Fig.15 The QQ diagram and Manhattan diagram of the cashmere yield trait of Example 1 of the present invention; Fig.16 This is the GWAS candidate gene list for the wool yield trait in Example 1 of the present invention; Fig.17 This is the GO function and KEGG signaling pathway enrichment table of Example 1 of the present invention; Fig.18 This is the GO enrichment analysis diagram of Example 1 of the present invention; Fig.19 This is the KEGG enrichment analysis diagram of Example 1 of the present invention; Fig. 20 It is a schematic diagram of the main test instruments of the present invention; Fig.21 It is a schematic diagram of the main test reagents of the present invention; Fig. 22 is the SNP site verification table of the present invention; Fig.23 is the PCR amplification primer sequence information table of the present invention; Fig.24 Schematic diagram of the composition of the PCR reaction solution for the preliminary experiment of the present invention; Fig.25 Schematic diagram of the PCR reaction conditions for the preliminary experiment of the present invention; Fig.26 Schematic diagram of the composition of the conventional PCR reaction solution of the present invention; Fig. 27 Schematic diagram of conventional PCR reaction conditions of the present invention; Fig. 27 Schematic diagram of conventional PCR reaction conditions of the present invention; Fig.28 This is a gel electrophoresis diagram for verifying the specificity of the primers of the present invention; Fig.29 This is the Sanger sequencing peak diagram of the present invention; Fig.30 is the genotyping statistics table of the present invention; Fig.31 Schematic diagram of the chi-square test for candidate genes of the present invention. DETAILED DESCRIPTION

[0015] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0016] See also Figure 1-31 , the present invention provides the following technical solutions:

[0017] Through genome-wide association analysis of the four phenotypic traits of cashmere length, cashmere fineness, hair length and cashmere production of the Northwest Tibetan White Cashmere, 18 significant SNPs were associated at the genome level and 232 SNPs were associated at the chromosome level. CCSER1, RPS6KC1, KCNRG, KCNK9 and CLYBL8 It is an important candidate gene for the hair traits of Northwest Tibetan White Cashmere Goats.

[0018] 1. Sample collection The test samples came from the Northwest Tibetan White Cashmere Goat Breeding Farm in Ritu County, Ali Prefecture, Tibet Autonomous Region. By measuring the thickness and length of the experimental group's body size parameters on site at the breeding farm, the cashmere and ear tissue samples of the experimental group of cashmere goats were collected and brought back to the laboratory for further research. In the laboratory, a portable all-weather cashmere fineness, length, net cashmere rate, and short cashmere rate rapid detection integrated machine was used to test the cashmere fiber diameter of the cashmere samples. The cashmere records of the experimental group in the breeding farm were obtained during the cashmere season.

[0019] 2. Genotype data acquisition The genotype data of this experiment comes from the ear tissue of cashmere goats collected from the original breeding farm of Northwest Tibetan White Cashmere Goats. After the ear tissue was collected, it was placed in a PE tube filled with 75% anhydrous ethanol and stored in a -80℃ refrigerator. The phenol / chloroform method was used to extract the DNA of the ear tissue in the laboratory, and the DNA concentration was detected by NANODROP 2000c. The extracted genomic DNA was required to be detected by agarose gel electrophoresis, with clear bands greater than 10kb in length and no obvious degradation. The OD260 / 280 of the DNA sample should be between 1.7-2.1. The DNA samples that met the phenotypic data requirements and DNA concentration requirements were screened and placed in a 96-well PCR plate and handed over to Newgene Biotech (Shanghai) Co., Ltd. for genotype sequencing based on the goat 70K chip.

[0020] 3 Main test instruments and reagents Instruments used and sources Figure 1 .

[0021] The main reagents and their sources are as follows: (1) Proteinase K (Tiangen) (2) 10% SDS (Beijing Solarbio Science & Technology Co., Ltd) (3) TAE (Beijing Solarbio Science & Technology Co., Ltd) Inner Mongolia Agricultural University Master's Degree Thesis 23 (4) STE (Beijing Solarbio Science & Technology Co., Ltd) (5) DNA extraction phenol (Beijing Solarbio Science & Technology Co., Ltd) (6) DNA extraction solution - 25:24:1 (Beijing Solarbio Science & Technology Co., Ltd) (7) Isopropyl alcohol (T.JKEMAO Chemical Reagents Co., Ltd.) (8) Anhydrous ethanol (Tianjin Zhi Yuan Reagent Co., Ltd) (9) Sterile enzyme-free H2O (Takara) (10) Agarose (BioWest) 4 Phenotypic data processing and correlation analysis Descriptive statistical analysis of phenotypic data was performed using R language, and the ggplot2 package of R language was used to draw the frequency distribution histogram and fitting curve of the phenotype, and the normal distribution law of each phenotype was determined by graphs. The corrplot package of R language was used to draw the Pearson correlation analysis heat map of the four phenotypic traits.

[0022] In this study, the wool traits of 288 Northwest Tibetan white cashmere goats, including wool length, wool fineness, wool length and wool production, were measured. The phenotypic data were collated and then descriptive statistical analysis was performed on the four phenotypes ( Figure 2 ). Use R language to draw the frequency distribution histogram and fitting curve of each phenotype for normality test ( Figure 3 ), according to the graph, all traits belong to normal distribution and can be used for subsequent whole genome association analysis.

[0023] The Pearson correlation analysis heat map of the four phenotypic traits was drawn using the corrplot package of R language ( Figure 4), and found that the correlations among the four hair characteristics of Northwest Tibetan White Cashmere Goats were high, among which the Pearson correlation coefficient between cashmere length and hair length reached 0.47, with the highest correlation.

[0024] 5 DNA extraction and detection Genomic DNA was extracted from tissue samples using the phenol extraction method, and the DNA concentration was detected using a Thermo Fisher spectrophotometer (OD260 / 280 between 1.7 and 2.1 was the qualified standard). Qualified DNA samples were stored in a -80°C refrigerator.

[0025] 6 SNP genotyping The genotyping work in this study was completed by Neogen China Laboratory, and the genotyping used goat GGP_Goat70K-China chip for whole genome scanning.

[0026] 7 Genotype data quality control and linkage disequilibrium analysis The genotype data were quality controlled using Plink1.90 software to remove unqualified samples and SNP sites. The quality control standards are as follows: (1) SNP missing quality control: sites with SNP genotype missing greater than 10% (-geno0.1) were removed from the analysis; (2) Sample missing quality control: samples with a call rate lower than 90% (-mind0.1) were excluded from the analysis; (3) MAF missing quality control: loci with a minimum allele frequency less than 1% (-maf0.01) were removed from the analysis; (4) Hardy-Weinberg equilibrium quality control: Failure to meet the Hardy-Weinberg equilibrium test P value is less than 10 -6 The sites were removed from the analysis.

[0027] The quality control code for genotype data using Plink1.90 software is as follows: plink –file filename –geno 0.1 –recode –out temp; plink –file filename –mind 0.1 –maf 0.01 –hwe 1e-6 –recode –chr 1-29–out filename. After genotyping the ear tissue DNA of 288 individuals, a total of 67,088 SNP sites were obtained, and the genotype data quality control was performed using Plinkv1.90 software. First, single nucleotide site deletion quality control (--geno0.1) was performed, and 1,276 SNPs were eliminated; then sample deletion (--mind0.1), MAF (--maf0.01) and Harwen equilibrium (--hwe1e-6) were quality controlled, of which sample deletion quality control eliminated 2 individuals, MAF quality control eliminated 10,242 SNPs, and Harwen equilibrium eliminated 1,890 SNPs; finally, 523 SNPs on sex chromosomes were eliminated. After raw data quality control, a total of 53,157 SNPs were obtained, evenly distributed on 29 pairs of autosomes in goats (Figure 5). In order to reduce the generation of false positive results in whole genome association analysis, it is necessary to perform population structure analysis on 286 individuals, and add the first three principal components of the population as covariates into the GWAS model. The principal components among all individuals were calculated by Plink software, and then the group structure was analyzed. The results showed that there was no obvious stratification in the group, indicating that there was almost no foreign ancestry between the samples (Figure 6). A heat map of the kinship of the Northwest Tibetan White Cashmere Goat was drawn based on the genotype data (Figure 7).

[0028] In order to determine whether the SNPs sites after quality control have sufficient coverage in the whole genome, Haploview4.1 software was used to calculate the LD coefficient size and distance between SNPs markers after quality control. In Excel, the distance intervals were classified and the average LD coefficient corresponding to each distance was calculated, and finally the average value was used to draw the LD attenuation diagram.

[0029] The LD decay diagram is a two-dimensional curve that shows the linear decrease of the average LD coefficient between SNPs markers on the chromosomes of the genome as the distance between markers increases. Linkage disequilibrium simultaneously measures the genotype synchronization and correlation index of two molecular markers. In this study, the correlation coefficient (r2) and physical distance between SNPs were calculated by Haploview4.1 software, and the average correlation coefficient of the set distance interval was calculated by Excel, and finally the LD decay diagram was drawn (Figure 8). The results showed that the LD correlation coefficient r2 gradually decreased after the physical distance reached 200kb, indicating that the closer the distance between the two SNP sites on the chromosome, the stronger the correlation and the larger the LD coefficient.

[0030] 8 Genome-wide association analysis In this study, the mixed linear model of GEMMA-0.98 software (Genome-wide Efficient Mixed Model Association algorithm) was used to conduct genome-wide association analysis on the phenotypic and genotypic values ​​of four wool traits of 286 individuals of Northwest Tibetan White Cashmere Goats. Individual age was added to the mixed linear model as a fixed effect. This study used the y=Xα+Zβ+Wμ+e statistical analysis model, where: y is the phenotypic trait, X is the fixed effect matrix, α is the fixed effect estimation parameter, Z is the single nucleotide polymorphism matrix, β is the single nucleotide polymorphism effect, W is the random effect matrix, μ is the predicted random individual, e is the random error, and the distribution is e~N (0, ).

[0031] By performing principal component analysis on the population genotype data, the principal components of the population genetic variation are inferred, that is, the genetic variation of the population is compressed into several smaller dimensions, which are then defined as the eigenvectors of the inter-individual covariance matrix. The principal components are added as covariates in the subsequent GWAS analysis model to correct for potential population stratification of the associated population.

[0032] Genome-wide association analysis generally uses multiple hypothesis tests, and the number of multiple hypothesis tests is related to the number of SNPs. This test method may increase the false positive rate and type I error. At present, the Bonferroni correction method can be used to reduce the false positive results caused by multiple hypotheses in genome-wide association analysis. The Bonferroni correction method uses the commonly used significance threshold of 0.05 divided by the number of marker sites as the corrected significance threshold, thereby controlling the cumulative probability of type I error within 0.05. However, this method may produce over-correction, which will lead to an increase in the false negative rate and may miss some significant sites, so 1 divided by the number of marker sites can be used as the corrected significance threshold.

[0033] In genome-wide association analysis, it is necessary to consider the interference factors caused by population stratification on the results, and it is necessary to perform population stratification detection and parameter correction on the experimental population. In this experiment, the principal component analysis of the experimental population will be performed using Plink software, and the first two principal components will be extracted using R software and a principal component analysis scatter plot will be drawn to observe whether there are differences in the genetic background of the population. In this study, individual age and the first three principal components were added as covariates to the mixed linear model to correct the phenotypic data.

[0034] The whole genome association analysis of four phenotypic traits of Northwest Tibetan white cashmere cashmere, namely cashmere length, cashmere fineness, hair length and cashmere production, was conducted by using GEMMA-0.98.1 software under Linux system. Firstly, the population genome kinship matrix (Kinship) was calculated, and then the covariate file and Kinship matrix were added to the model for data processing.

[0035] The result files output by GEMMA software were sorted, the parameters for drawing QQ plots and Manhattan plots were selected, and the visualization graphs of the four trait variation sites were drawn using R software. The significance threshold was based on the Bonferroni correction method, and the significance threshold at the genome level and the significance threshold at the chromosome level needed to be set.

[0036] The GEMMA software was used to perform genome-wide association analysis on the velvet length trait. The GWAS results showed that 7 SNPs were significant at the genome level and were located on chromosomes Chr21, Chr24 and Chr29. 70 SNPs were significant at the chromosome level and were distributed on all chromosomes except Chr7, Chr9, Chr13, Chr20, Chr25 and Chr27. The QQ plot and Manhattan plot were drawn using the R package ggplot2 ( Fig. 9 ). The gene expansion factor λ=1.0023 was calculated using R software, indicating that there was no genome expansion, indicating that the model used had a good fit and was suitable for this trait. The bedtools software was used to annotate the genes of the screened significant loci, and the annotation range was within 50kb above and below the significant loci. 32 candidate genes related to the velvet length trait were obtained through screening ( Fig.10 ).

[0037] The GEMMA software was used to perform a genome-wide association analysis on the tricholoma trait. The GWAS results showed that 6 SNPs were significant at the genomic level and were located on chromosomes Chr4, Chr10, Chr16, Chr20 and Chr25. 65 SNPs were significant at the chromosomal level and were distributed on all chromosomes except Chr28. The QQ plot and Manhattan plot were drawn using the R package ggplot2 (Figure 11). The gene expansion factor λ = 1.027 was calculated using R software, indicating that there was no genome expansion, indicating that the model used had a good degree of fit and was suitable for this trait. The bedtools software was used to annotate the genes of the screened significant sites, and the annotation range was within 50kb above and below the significant sites. 32 candidate genes related to the tricholoma trait were obtained through screening ( Fig.12 ).

[0038] The GEMMA software was used to perform genome-wide association analysis on hair length traits. The GWAS results showed that two SNPs were significant at the genome level, located on chromosomes Chr6 and Chr12. 40 SNPs were significant at the chromosome level. The QQ plot and Manhattan plot were drawn using the R package ggplot2 ( Fig.13 The gene expansion factor λ was calculated using R software to be 0.983, indicating that there was no genome expansion, indicating that the model used had a good fit and was suitable for this trait. The bedtools software was used to annotate the genes of the screened significant loci within 50 kb above and below the significant loci. Through screening, 18 candidate genes related to the hair length trait were obtained ( Fig.14 ).

[0039] The GEMMA software was used to perform genome-wide association analysis on the wool yield trait. The GWAS results showed that 3 SNPs were significant at the genome level, located on chromosomes Chr11, Chr12 and Chr14. 57 SNPs were significant at the chromosome level, and were distributed on all chromosomes except Chr2, Chr3, Chr5, Chr21, Chr22 and Chr28. The QQ plot and Manhattan plot were drawn using the R package ggplot2 ( Fig.15 ). The gene expansion factor λ was calculated using R software to be 1.023, indicating that there was no genome expansion, indicating that the model used had a good degree of fit and was suitable for this trait. The bedtools software was used to annotate the genes of the screened significant loci, with the annotation range within 50 kb above and below the significant loci. Through screening, 25 candidate genes related to the wool yield trait were obtained ( Fig.16 ).

[0040] 9 Gene annotation and enrichment analysis The significant SNP sites mined by whole genome association analysis were downloaded from the website of the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov) of the United States. The candidate genes within 50 kb above and below the physical position of the significant sites were annotated by bedtools software. The DAVID6.8 (http: / / david.abcc.ncifcrf.gov) database was used for gene GO functional annotation and KEGG signaling pathway analysis. In the enrichment analysis results, P < 0.05 was statistically significant. The ggplot2 package of R software was used to draw GO and KEGG bar charts and bubble charts.

[0041] The 107 candidate genes of the four traits of down length, down fineness, hair length and down production annotated by bedtools were analyzed by GO and KEGG enrichment using the DAVID 2021 Gene system of NCBI (Table 10). GO was enriched in 1 biological process (BP), 5 cellular components (CC) and 5 molecular functions (MF) (P<0.05). GO was enriched in the negative regulation biological process of cell proliferation (GO:0008285), including ALDH1A2, STAT3, CDH13 5 genes were enriched in cytoplasm (GO:0005737), cell membrane surface (GO:0009986) and endoplasmic reticulum (GO:0005783), including CREBBP, PRLR and KCNRG The enriched molecular functions include adenosine triphosphate binding (GO:0005524), calcium ion binding (GO:0005509), and voltage-gated potassium channel activity (GO:0005249), including RPS6KC1、CAPNS1 and KCNK9 Etc. KEGG enriched to motor protein (chx:04814) 1 signaling pathway ( P <0.05) , MYO15A, KIF16B and MYO5C Four genes were significantly enriched in this pathway. The results of GO and KEGG analysis are shown in Fig.17 .

[0042] Use the ggplot2 package of R language to draw GO and KEGG enrichment analysis diagrams ( Figure 18-19 ).

[0043] Example 2 Verification of Candidate Genes for Hair Traits of Northwest Tibetan White Cashmere Goats This study selected candidate genes related to villus traits discovered by Research Institute 1 CCSER1, RPS6KC1, KCNRG, KCNK9 and CLYBL After verification analysis, these 8 genes all covered the significant SNPs associated with GWAS. CCSER1 Genes significantly associated with wool length traits RPS6KC1 Genes significantly associated with fine hair trait KCNRG Genes significantly associated with hair length traits KCNK9 and CLYBLThe gene is significantly correlated with the trait of cashmere production. In order to verify the significance of these five candidate genes and exclude false positive results from GWAS analysis, this study will focus on the significant functional mutation sites obtained by the whole genome association analysis in Study 1, expand 300bp upstream and downstream as templates to design common PCR primers, and perform PCR amplification of goat genomic DNA fragments. Then, the international gold standard for genetic testing, Sanger sequencing, is used to perform genotyping on extreme phenotypic individuals of the four phenotypic traits, and then the typing result data is subjected to a chi-square test of suitability, and finally the significance of the candidate genes screened by GWAS is determined, which provides a scientific reference for a comprehensive and systematic analysis of the genetic mechanism of cashmere goat hair traits.

[0044] 1 Test sample The source of the experimental samples in this study was the same as that in Study 1, and the ear tissue DNA samples used did not include the samples used in Study 1. 251 individuals were screened for the experimental samples according to the phenotypic values ​​of down length, down fineness, hair length and down production.

[0045] 2 Main instruments and reagents for the experiment The main test instruments and reagents and their sources are shown in Figure 20-21 .

[0046] 3 DNA extraction and detection The DNA extraction and detection procedures were the same as those in Study 1.

[0047] 4. Design and preparation of PCR primer sequences In the Genome database module of the NCBI website, the keyword goat was entered for retrieval, and the goat reference genome ARS1.2 was located. The chromosome fragments 300 bp upstream and downstream of the five SNP positions with more significant four wool traits of the Northwest Tibetan White Cashmere Goat were extracted according to the chromosome number ( Fig. 22 ). The five genome sequences were submitted to the free primer design module on the official website of Bioengineering (Shanghai) Co., Ltd. for conventional PCR primer design. The designed primer sequences were further prepared by Bioengineering (Shanghai) Co., Ltd. ( Fig.23 ).

[0048] CCSER1 (coiled-coil serine rich protein 1) is a coiled-coil serine rich protein encoding gene, located between 33559344bp and 35024683bp on chromosome 6 of the goat genome; the specific primers for the marker are: F 5'GTGTTATCCCTAGAGAGCCTGTTTC 3' R 5' AGCATGAACCTCAAAGACTGGAAG 3' RPS6KC1 (ribosomal protein S6 kinase C1) is a ribosomal protein kinase encoding gene, located between 68984514bp and 69197148bp on chromosome 16 of the goat genome; the specific primers for the marker are: F 5' GCATCCACAGTTCCAGCAGAAG 3' R 5' CAGAAGCCCAGCACTCGTTTG 3' KCNRG Potassium channel regulator (potassium channel regulator) is a protein encoding a potassium channel regulatory factor, located between 67128486bp and 67135129bp on chromosome 12 of the goat genome; the specific primers for the marker are: F 5' CTGTGGGAGATAAAGATAGGGCATC 3' R 5' AAGTGTTAGTGACTGTAAGCCAAGG 3' KCNK9 (potassium two pore domain channel subfamily K9) is the protein encoding gene of potassium ion channel two pore domain subfamily K member 9, located between 78410779bp and 78514184bp on chromosome 14 of the goat genome; the specific primers for the marker are: F 5' GCCTCTCTGGAATATCCTCCTATGG 3' R 5'CATCGCCTTCTCTGGTTTGTTGG 3' CLYBL (citramalyl-CoA lyase) is a gene encoding citramalyl-CoA protein, located between 9645150bp and 9878794bp on chromosome 12 of the goat genome; the specific primers for the marker are: F 5' AACAAGAGAAACCAGCGAAAGGAG 3' R 5'ACACGAGAGCCACTGGAATGAG 3'.

[0049] The prepared primers need to be pre-processed before they can be used for subsequent PCR amplification. The primer processing process is as follows: (1) Preparation of primer storage solution: a Before opening the primers, they need to be placed in a high-speed refrigerated centrifuge to prevent the loss of the dry film primers. The centrifuge settings are 4°C, 4000 rpm, 60 s.

[0050] b After centrifugation, carefully and gently open the tube cap and add buffer solution. The amount of buffer solution added refers to the value indicated on the primer synthesis report.

[0051] c Replace the tube cap and place on a vortex mixer to mix thoroughly.

[0052] d. Store in a -20℃ freezer until use.

[0053] (2) Preparation of primer working solution: a. Add 90 μl of ddH2O and 10 μl of primer storage solution to the labeled centrifuge tubes, cover them and mix thoroughly on a vortex mixer.

[0054] b. Store the prepared primer working solution in a -20℃ freezer until use.

[0055] 5 PCR amplification 5.1 Primer verification A diluted and purified DNA sample was selected as a template for conventional PCR amplification using a T100 Thermal Cycler PCR instrument. The composition and reaction conditions of the PCR reaction solution for the preliminary experiment are shown in Figure 24-25 .

[0056] The product after the PCR reaction needs to be tested by agarose gel electrophoresis, which specifically includes three steps: gel preparation, electrophoresis, and imaging. Gel preparation requires 50ml of 1×TAE and 1g agarose to be fully heated and mixed until there are no bubbles, and then 2.5μl of nucleic acid dye is added and poured into the gel preparation tank. For electrophoresis, 6μl of PCR product and DL1000 Maker are added to the preset small holes of the gel block in the electrophoresis tank, and the electrophoresis instrument is set to 110V, 200mA, and 25min. After the electrophoresis, the gel block is placed in the gel imaging system for analysis of the PCR product bands to determine whether the product bands are consistent with the product size when the primers were designed, and finally the specific primer sequence suitable for sanger sequencing is screened out.

[0057] A preliminary experiment was conducted on five pairs of primers for four wool traits of Northwest Tibetan White Cashmere Goats, and finally the five pairs of primers successfully amplified the target length fragments (Figure 28). The bands are clear and have no tails, and can be used for subsequent conventional PCR tests. The annealing temperature of the test is 60°C and the number of cycles is 35. The six pairs of primers correspond to snp12579 at the 34449796bp position on chromosome 6, which is significantly related to the wool length trait, marked as CL-2 in the figure; snp41503 at the 69173527bp position on chromosome 16, which is significantly related to the wool fineness trait, marked as CD-1 in the figure; snp41082 at the 67134820bp position on chromosome 12, which is significantly related to the wool length trait, marked as FL-1 in the figure; 14:78472665 at the 78472665bp position on chromosome 14 and 12:9705753 at the 9705753bp position on chromosome 12, which are significantly related to the wool production trait, marked as CP-1 and CP-2 in the figure. These five SNP sites are located in the annotated bedtools CCSER1, RPS6KC1, KCNRG, KCNK9 and CLYBL On the genome sequence.

[0058] 5.2 Conventional PCR amplification Based on 5 pairs of primers, ordinary PCR amplification was performed on the ear tissue DNA templates of 251 individuals of Northwest Tibetan White Cashmere Goats. The target sequence was successfully amplified from all ear tissue DNAs, which can be used for subsequent mutation base sequence analysis ( Figure 26-27 ).

[0059] 6 Sanger sequencing After PCR amplification, the unpurified samples were sent to Sangon Biotech (Shanghai) Co., Ltd. for capillary electrophoresis sequencing (CE). The sequencing was performed using a 3730XL sequencer, and the peak color map in ab1 format and the sequence file in seq format were finally generated for genotyping statistics. The chisq.test function of R software was used to perform a chi-square test on the candidate genes to obtain the chi-square value and P-value of each candidate gene.

[0060] Sangon Biotech (Shanghai) Co., Ltd. performed capillary electrophoresis sequencing on 251 amplified sequences, and used Chromas 2.6.6 software to analyze the ab1 format files generated by the company one by one, and finally found 5 chromosome mutation sites (Figure 29). The candidate genes corresponding to the 5 chromosome mutation sites were typed and counted ( Fig.30 ), chi-square test was used to conduct statistical analysis on the correlation between significant loci and various phenotypic traits (Figure 31).

[0061] Genome-wide association analysis is a method for mining complex traits of biological individuals and their associated mutation sites and regulatory genes. It is currently widely used in the analysis of genetic mechanisms such as the pathogenesis of complex human diseases, plant growth traits, and economic traits of livestock and poultry. The accuracy and validity of GWAS research results is an important research topic. This study used the first-generation sequencing technology to verify the results of genome-wide association analysis, which can effectively avoid false positive errors in GWAS analysis results.

[0062] Sanger sequencing is the international gold standard for many genetic testing technologies. This sequencing technology can well detect the accuracy of chip sequencing technology, second-generation sequencing technology, third-generation sequencing technology, and the fourth-generation sequencing technology that has been developed to date. The automatic sequencer used for genotyping in this study is a DNA sequencer based on capillary electrophoresis and fluorescent labeling technology, which has significant advantages in DNA sequencing precision and accuracy. Statistical analysis of Sanger sequencing results shows that CCSER1 (snp12579, 34449796, A→G), RPS6KC1 (snp41503, 69173527, A→G), KCNRG (snp41082, 67134820, G→A), KCNK9 (14:78472665,78472665,G→A) and CLYBL The base mutation position of (12:9705753, 9705753, C→T) was consistent with the GWAS analysis results and was highly significant (P<0.001), which theoretically verified the accuracy of the results of the genome-wide association analysis of the hair traits of the Northwest Tibetan White Cashmere Goat.

[0063] The relevant information of 5 candidate genes that significantly affect the hair traits of Northwest Tibetan White Cashmere Goats was retrieved through NCBI and PubMed databases to understand the application of each candidate gene in the analysis of biological genetic mechanisms from a macro perspective.

[0064] In summary, this study conducted Sanger genotyping verification on the significant SNPs and annotated candidate genes screened at the genome level by GWAS of the hair traits of Northwest Tibetan White Cashmere Goats. After PCR amplification and statistical analysis of Sanger sequencing results, the results showed that: (1) CCSER1, RPS6KC1, KCNRG, KCNK9 and CLYBL The base mutation site of the gene is consistent with the physical location of the corresponding significant SNPs site in Study 1; (2) CCSER1, RPS6KC1, KCNRG, KCNK9 and CLYBLThe P-values ​​of the chi-square test for gene suitability were all less than 0.001, which was a very significant level. The research results confirmed that these five genes are important candidate genes for the hair traits of the Northwest Tibetan White Cashmere Goats, providing an important reference for a comprehensive and in-depth analysis of the genetic mechanism of the hair traits of this variety of cashmere goats.

[0065] Contents not described in detail in this specification belong to the prior art known to professional and technical personnel in the field. Although the embodiments of the present invention have been shown and described, it is understood by those of ordinary skill in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the attached claims and their equivalents.

Claims

1. A molecular marker affecting the hair traits of Northwest Tibetan white cashmere goats, characterized by: The molecular markers include 5 genes that affect the hair traits of Northwest Tibetan White Cashmere Goats CCSER1, RPS6KC1, KCNRG, KCNK9 and CLYBL Genomic roadmaps; CCSER1 (coiled-coil serine rich protein 1) is a coiled-coil serine rich protein encoding gene, located between 33559344bp and 35024683bp on chromosome 6 of the goat genome; the specific primers for the marker are: F 5'GTGTTATCCCTAGAGAGCCTGTTTC 3' R 5' AGCATGAACCTCAAAGACTGGAAG 3' RPS6KC1 (ribosomal protein S6 kinase C1) is a ribosomal protein kinase encoding gene, located between 68984514bp and 69197148bp on chromosome 16 of the goat genome; the specific primers for the marker are: F 5' GCATCCACAGTTCCAGCAGAAG 3' R 5' CAGAAGCCCAGCACTCGTTTG 3' KCNRG Potassium channel regulator (potassium channel regulator) is a protein encoding a potassium channel regulatory factor, located between 67128486bp and 67135129bp on chromosome 12 of the goat genome; the specific primers for the marker are: F 5' CTGTGGGAGATAAAGATAGGGCATC 3' R 5' AAGTGTTAGTGACTGTAAGCCAAGG 3' KCNK9 (potassium two pore domain channel subfamily K9) is the protein encoding gene of potassium ion channel two pore domain subfamily K member 9, located between 78410779bp and 78514184bp on chromosome 14 of the goat genome; the specific primers for the marker are: F 5' GCCTCTCTGGAATATCCTCCTATGG 3' R 5'CATCGCCTTCTCTGGTTTGTTGG 3' CLYBL (citramalyl-CoA lyase) is a gene encoding citramalyl-CoA protein, located between 9645150bp and 9878794bp on chromosome 12 of the goat genome; the specific primers for the marker are: F 5' AACAAGAGAAACCAGCGAAAGGAG 3' R 5'ACACGAGAGCCACTGGAATGAG 3'.

2. The molecular marker affecting the hair traits of Northwest Tibet White Cashmere Goat according to claim 1, characterized in that: The molecular markers were used to conduct genome-wide association analysis on four phenotypic traits of cashmere length, cashmere fineness, hair length and cashmere production of Northwest Tibetan white cashmere goats, and a total of 18 significant SNPs were associated at the genome level and 232 SNPs were associated at the chromosome level. After gene annotation of significant loci, CCSER1, RPS6KC1, KCNRG, KCNK9 and CLYBL All of them are genes that affect the cashmere length traits of Northwest Tibetan white cashmere goats; These five genes all cover the significant SNPs associated with GWAS; CCSER1 The gene is significantly associated with the wool length trait. RPS6KC1 The gene was significantly associated with the trichome trait. KCNRG Genes significantly associated with hair length traits, KCNK9 and CLYBL The gene was significantly correlated with the wool yield trait.

3. The use of a molecular marker affecting the hair traits of Northwest Tibet White Cashmere Goats according to any one of claims 1-2, characterized in that: The invention comprises the application of the primers in the identification of white cashmere goats in northwest Tibet.

4. The use of a molecular marker affecting the hair traits of Northwest Tibet White Cashmere Goats according to claim 3, characterized in that: The application is specifically used in identifying the hair characteristics of Northwest Tibetan white cashmere goats.

Images