Wild coral hericium erinaceus strain with high yield of triterpenes and application

Abstract

The invention relates to the field of hericium erinaceus strains, and discloses a wild coral hericium erinaceus strain with high yield of triterpenes and application, the wild coral hericium erinaceus strain with high yield of triterpenes is preserved in China General Microbiological Culture Collection Center on August 13, 2024, the strain is Hs, the preservation address is Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Yard, Beichen West Road, Chaoyang District, Beijing, the postcode is 100101, the strain number is Hs, and the preservation number is CGMCC NO.41435. The culture medium is improved by applying liquid fermentation culture, so that the production period of the coral hericium erinaceus is effectively shortened, and the yield is increased; the cultivation medium is optimized, radix tetrastigme and mulberry branch powder are added to serve as the cultivation medium, so that the content of triterpenes is increased, sporocarp is pure white and good in commodity, the yield and quality are effectively improved, a more efficient coral hericium erinaceus cultivation mode is provided, the production cost of coral hericium erinaceus is greatly reduced, and the coral hericium erinaceus cultivation method is suitable for large-scale popularization and application. The yield and the quality of the coral hericium erinaceus are improved.

Description

Technical Field

[0001] The invention relates to the technical field of Hericium erinaceus strains, and in particular to a wild Hericium erinaceus strain with high triterpene production and application thereof. Background Art

[0002] Hericium coralloides belongs to the phylum Basidiomycetes, class Agaricaceae, order Russulares, family Hericium, genus Hericium, also known as pine mushroom, and is the same genus as Hericium erinaceus. It is a rare and delicious mushroom in the market. Hericium coralloides is not only nutritious but also delicious. Modern pharmacological and clinical studies have shown that Hericium coralloides has a variety of pharmacological activities and has been widely used to prevent and treat various diseases, especially in enhancing immunity, lowering blood sugar, protecting liver and stomach, anti-tumor and anti-oxidation. The physiologically active ingredients are mainly polysaccharides, triterpenoids, proteins, amino acids, sterols, etc.

[0003] Although Hericium erinaceus is a very rare edible and medicinal fungus, its resources are very limited, and there are even fewer germplasm resources that can be used in actual production, making it difficult to develop an industrialized model. At present, although artificial cultivation has been achieved, due to factors such as immature technology and unstable variety traits, there are problems such as low yield and poor fruiting body quality. Therefore, breeding excellent strains with strong resistance, high yield and good quality has become a key issue, which is of great significance to the development and application of Hericium erinaceus. Summary of the invention

[0004] In view of the shortcomings of the prior art, the present invention provides a wild coral hericium strain with high triterpenoid production and its application, so as to solve the problem that the resources of coral hericium are very limited, and the germplasm resources that can be used in actual production are even fewer, making it difficult to form an industrialized development model. At present, although artificial cultivation has been achieved, due to factors such as immature technology and unstable variety traits, there are problems of low yield and poor fruiting body quality.

[0005] To achieve the above objectives, the present invention is implemented through the following technical scheme: a wild coral hericium erinaceus strain with high triterpenoid production, which is deposited in the General Microbiology Center of China Microbiological Culture Collection Committee on August 13, 2024, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101, its strain number is Hs, and the deposit number is CGMCC NO.41435.

[0006] A method for culturing a wild coral hericium erinaceus strain with high triterpene production, comprising the following steps:

[0007] S1. Collect intact coral Hericium fruiting bodies from Tumen County, Yanbian City, Jilin Province, take the tissue from the center of the stipe, inoculate it on the separation medium, culture it at 25℃ and dim light for 10 days, take the tip hyphae and repeat the inoculation twice to purify the strain;

[0008] S2, inoculating the purified strains into a basic liquid culture medium, and culturing at 24°C and 150r / min with shaking for 8-10 days to obtain coral Hericium erinaceus liquid fermentation strains;

[0009] S3, placing the coral hericium liquid fermentation strain in a fermentation tank with an inoculation volume of 500 mL, a temperature of 18°C-20°C, a tank pressure of 0.12Mpa, and culturing for 7d-8d to obtain a liquid strain;

[0010] S4, inoculate the liquid bacteria into a cultivation bag containing a culture medium according to an inoculum volume of 20 mL, and cultivate at 25°C and in the dark for 25-30 days;

[0011] S5. Manage the mushroom bags that have been fully germinated. Give them 500Lux-800Lux and 8h-10h white light during the day to stimulate the formation of primordium. After the primordium is formed, add 3h-5h blue light stimulation with a light intensity of 500Lux-800Lux.

[0012] S6. Harvest the coral Hericium fruiting bodies after 10-14 days of cultivation, and then continue to cultivate for 10-12 days for the second wave of mushroom production.

[0013] Preferably, the separation medium formula in step S1 is 200 g potato, 20 g glucose, 10 g peptone, 13 g agar, and 1 L water.

[0014] Preferably, the formula of the basic liquid culture medium in step S2 is 0.3% corn flour, 0.2% soybean meal, 0.2% peptone, 1.6% glucose, 0.1% yeast extract, 0.001% vitamin B1, 0.1% KH2PO4, and 0.1% MgSO4.

[0015] Preferably, the culture medium formula in step S4 is 50% broad-leaved sawdust, 28% cottonseed hulls, 5% mulberry branch chips, 5% clover leaf green, 15% bran, 1% citric acid, and 1% gypsum; the clover leaf green is crushed after drying, and the mulberry branch chips are crushed after mulberry branches are dried; the size of the cultivation bag is 17cm*38cm*0.045cm, and the dry material weight is 0.45kg / bag.

[0016] Preferably, the culturing method in step S4 is to control the internal temperature of the observation bag at 23°C-25°C, set the ambient temperature to 23°C-26°C 1d-7d after inoculation, set the ambient temperature to 20°C-23°C after culturing for 7d-15d, set the internal temperature of the bag to 23°C-25°C after culturing for 15d, and continue culturing for 10d-15d for fruiting management.

[0017] The invention discloses an application of a wild coral hericium erinaceus strain with high triterpene production in nutritional health food or medicine.

[0018] The present invention provides a wild coral hericium strain with high triterpene production and its application, which has the following beneficial effects:

[0019] 1. The present invention improves the culture medium by applying liquid fermentation culture, effectively shortens the production cycle of coral hericium, and improves the yield; by optimizing the cultivation medium, adding three-leaf green and mulberry branch chips as the cultivation matrix, thereby increasing the triterpene content, making the fruiting body white and having good commercial quality, effectively improving the yield and quality, and providing a more efficient coral hericium cultivation mode, which greatly reduces the production cost of coral hericium and improves the yield and quality of coral hericium.

[0020] 2. The present invention optimizes the cultivation method to shorten the fruiting period of the coral hericium strain and increase the yield. The yield of the first two waves can reach 300-340g / bag, the biological efficiency can reach 66.67%-75.55%, and the fruiting body yield is high, so that the commercial quality is better. The triterpene yield reaches 2.75%-2.88%, and the quality is higher. Primordia begin to form 25d-30d after inoculation, and the time from inoculation to the first wave harvest is 43d-47d, thereby shortening the cycle and improving the tide turning time.

[0021] 3. The present invention provides a new coral hericium erinaceus strain, which greatly enriches the coral hericium erinaceus germplasm resources, and has high yield and high biological efficiency. The yield of the strain in the first two waves can reach 300-340g / bag, and the biological efficiency can reach 66.67%-75.55%.

[0022] 4. The fruiting body of the coral hericium strain of the present invention has a higher triterpene content than other coral hericiums, with a content of 2.88 g per 100 g of fruiting body, and has a very broad application prospect. It also provides a new coral hericium strain that has high triterpene production and is suitable for factory cultivation. The new coral hericium strain has a good mushroom shape of fruiting body, white color, high yield, short production cycle, and fast tide change, thereby further increasing its wide application. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The present invention is a flow chart of a method for cultivating a wild coral Hericium erinaceus strain with high triterpene production;

[0024] Figure 2 A schematic diagram of the genetic diversity of Hericium erinaceus of the present invention;

[0025] Figure 3 The schematic diagram of the SRA Plot of the primer me1-em4 of the present invention;

[0026] Figure 4 It is a wild collection photo of the present invention;

[0027] Figure 5 It is a photo of the domestication and fruiting of mushrooms of the present invention. DETAILED DESCRIPTION

[0028] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0029] Example:

[0030] The embodiment of the present invention provides a wild coral hericium strain with high triterpenoid production. The wild coral hericium strain with high triterpenoid production was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on August 13, 2024, and was classified and named Hericium coralloides. The storage address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101, its strain number is Hs, and the storage number is CGMCC NO.41435.

[0031] Specifically, the ITS sequence of the coral hericium strain Hs is as follows, which is Hericium coralloides (coral hericium) after comparison by NCBI:

[0032] CTGGGGGGGGACTGCGGAGGACATTAATGAATTTGAAGGAGTTGTTG

[0033] CTGGCTTGTCAACCCAAACATGTGCACACTCCCC

[0034] TCTCACCCCTCTCACACCTGTGCACCCTCGTGTGGGTGCCCCGCCTT

[0035] TGTGCTCGCTCTCGCTTGTGCTTTTCTATATA

[0036] CTCTCATGTATGTAACACAAAGTGTTATAGCGATAAACGCATCTCATA

[0037] CAACTTTCTCCAACGGATATCTTGTGTCTCTC

[0038] ATCTATAAAAAAAACACCGAAATGTGATAAAAAATGTGAATAGTGC

[0039] AAATCTCTGAATCATCTCATCTCTGAGAGCACCT

[0040] CGTGCCCCTTGTGATACCCAGAGGCACGCCTGTGCTAGAGTGGCGA

[0041] AATTCTCACCTCTCTCCCCTTGTGATGAGAGAGG

[0042] TGGGCTTGTACATGTAGATCTTGTGGCTTGTGTTCCCTCTCGGACAC

[0043] CTCCTCCCCTCGAGTGCGTGAGAGGATAACCTTT

[0044] TTGTATGGGTTGCCCTTGTGGTGAGAAATATATACACCGCGCGTATA

[0045] CTTGTGGCTGTGCTGCTTCTATACGCCCTTCT

[0046] CGAGATATCATCTCACCTCGAGATCTCATCACGCGCGACTACACGCT GAGCTCATACACTAAAAA.

[0047] Please see attached Figure 1-Figure 5 A method for cultivating a wild coral hericium erinaceus strain with high triterpene production comprises the following steps:

[0048] S1. Collect intact coral Hericium fruiting bodies from Tumen County, Yanbian City, Jilin Province, take the tissue from the center of the stipe, inoculate it on the separation medium, culture it at 25℃ and dim light for 10 days, take the tip hyphae and repeat the inoculation twice to purify the strain;

[0049] S2, inoculating the purified strains into a basic liquid culture medium, and culturing at 24°C and 150r / min with shaking for 8-10 days to obtain coral Hericium erinaceus liquid fermentation strains;

[0050] S3, placing the coral hericium liquid fermentation strain in a fermentation tank with an inoculation volume of 500 mL, a temperature of 18°C-20°C, a tank pressure of 0.12Mpa, and culturing for 7d-8d to obtain a liquid strain;

[0051] S4, inoculate the liquid bacteria into a cultivation bag containing a culture medium according to an inoculum volume of 20 mL, and cultivate at 25°C and in the dark for 25-30 days;

[0052] S5. Manage the mushroom bags that have been fully germinated. Give them 200Lux-300Lux and 8h-10h white light during the day to stimulate the formation of primordium. After the primordium is formed, add 3h-5h blue light stimulation with a light intensity of 200Lux-300Lux.

[0053] S6. Harvest the coral Hericium fruiting bodies after 10-14 days of cultivation, and then continue to cultivate for 10-12 days for the second wave of mushroom production.

[0054] Specifically, the purified strain is 5 yellow gun head inoculation blocks, the fermentation tank capacity is 750L, and the coral hericium erinaceus strain Hs is sequentially subjected to tissue separation, mother strain culture, liquid strain culture, cultivation culture and mushroom stage culture to obtain the coral hericium erinaceus fruiting body. By culturing the strain and improving the substrate, the triterpene content in the coral hericium erinaceus fruiting body is effectively increased, and its application in health food or medicine is promoted, so that the two-tide yield can reach 300-340g / bag, the biological efficiency can reach 66.67%-75.55%, and the triterpene yield can reach 2.75%-2.88%. , while the biological efficiency of general coral strains (biological efficiency = (fresh weight of fruiting body / dry weight) × 100%) is around 70% to 78% [Zhuang Lei et al., Journal of Mycology, 2024], but because it is the yield of four-tide mushrooms, its biological efficiency is slightly higher. According to the biological efficiency calculation of the two-tide yield of this patent, its biological efficiency will be reduced; the biological efficiency of the patent "A method for breeding and cultivating a high-yield glucan-resistant coral-like Hericium erinaceus strain" is 98%. The biological efficiency is also calculated using the four-tide yield. If calculated based on the first two-tide yield, the biological efficiency is 53%.

[0055] The separation medium formula in step S1 is 200 g potato, 20 g glucose, 10 g peptone, 13 g agar, and 1 L water.

[0056] The formula of the basic liquid culture medium in step S2 is 0.3% corn flour, 0.2% soybean meal, 0.2% peptone, 1.6% glucose, 0.1% yeast extract, 0.001% vitamin B1, 0.1% KH2PO4, and 0.1% MgSO4.

[0057] The culture medium formula in step S4 is 50% of broad-leaved sawdust, 28% of cottonseed hulls, 5% of mulberry branch chips, 5% of clover, 15% of bran, 1% of citric acid, and 1% of gypsum; the clover is crushed after drying, and the mulberry branch chips are crushed after drying mulberry branches; the size of the cultivation bag is 17cm*38cm*0.045cm, and the dry material weight is 0.45kg / bag.

[0058] The cultivation method in step S4 is to control the internal temperature of the observation bag at 23°C-25°C, set the ambient temperature to 23°C-26°C 1d-7d after inoculation, set the ambient temperature to 20°C-23°C after culturing for 7d-15d, set the internal temperature of the bag to 23°C-25°C after culturing for 15d, and continue culturing for 10d-15d for fruiting management.

[0059] Specifically, the culture method comprises the following steps: observing the internal temperature of the fungus bag and controlling it at 23°C-25°C; setting the ambient temperature at 23°C-26°C 1d-7d after inoculation, the mycelium just beginning to germinate at this stage, and monitoring the internal temperature of the fungus bag at all times, preferably at 23°C-25°C; culturing for 7d-15d, which is the rapid growth stage of mycelium, the temperature inside the fungus bag will increase due to enhanced mycelium respiration, and the ambient temperature is set at 20°C-23°C to ensure that the internal temperature of the fungus bag is preferably at 23°C-25°C; after culturing for 15d, the internal temperature of the fungus bag is still at 23°C-25°C, and the ambient temperature is increased in time (preferably by 0.2°C-0.5°C) based on the temperature of 20°C-23°C to reduce the impact of large environmental changes on the mycelium, and continuing to culture for about 10d-15d for fruiting management.

[0060] Please see attached Figure 2 , application of a wild coral hericium strain with high triterpene production in nutritional health foods or medicines.

[0061] Specifically, the coral hericium strain Hs is genetically stable, and the triterpene content in the coral hericium fruiting body obtained by culturing the strain can reach 2.75% to 2.98%. The strain has a strong ability to synthesize triterpenes and can be used in nutritional health foods or medicines.

[0062] The following is further introduced in conjunction with specific embodiments:

[0063] Embodiment 1:

[0064] A method for culturing a wild coral hericium erinaceus strain with high triterpene production, comprising the following steps:

[0065] S1. Collect intact coral Hericium fruiting bodies from Tumen County, Yanbian City, Jilin Province, take the tissue from the center of the stipe, inoculate it on the separation medium, culture it at 25℃ and dim light for 10 days, take the tip hyphae and repeat the inoculation twice to purify the strain;

[0066] S2, inoculating the purified strains into a basic liquid culture medium, and culturing at 24°C and 150r / min for 8 days to obtain coral Hericium erinaceus liquid fermentation strains;

[0067] S3, placing the coral hericium liquid fermentation strain in a fermentation tank with an inoculation volume of 500 mL, a temperature of 18° C., a tank pressure of 0.12 MPa, and culturing for 7-8 days to obtain a liquid strain;

[0068] S4, inoculate the liquid bacteria into a cultivation bag containing a culture medium according to an inoculum volume of 20 mL, and cultivate at 25°C and in the dark for 25 days;

[0069] S5. Manage the mushroom bags that have been fully germinated. Give them 500 Lux and 8 hours of white light during the day to stimulate the formation of primordium. After the primordium is formed, add 3 hours of blue light stimulation with a light intensity of 500 Lux.

[0070] S6. Harvest the coral Hericium fruiting bodies after 10 days of cultivation, and then continue to cultivate for 10 days for the second wave of mushroom fruiting.

[0071] The separation medium formula in step S1 is 200 g potato, 20 g glucose, 10 g peptone, 13 g agar, and 1 L water.

[0072] The formula of the basic liquid culture medium in step S2 is 0.3% corn flour, 0.2% soybean meal, 0.2% peptone, 1.6% glucose, 0.1% yeast extract, 0.001% vitamin B1, 0.1% KH2PO4, and 0.1% MgSO4.

[0073] The culture medium formula in step S4 is 50% of broad-leaved sawdust, 28% of cottonseed hulls, 5% of mulberry branch chips, 5% of clover, 15% of bran, 1% of citric acid, and 1% of gypsum; the clover is crushed after drying, and the mulberry branch chips are crushed after drying mulberry branches; the size of the cultivation bag is 17cm*38cm*0.045cm, and the dry material weight is 0.45kg / bag.

[0074] The cultivation method in step S4 is to control the internal temperature of the observation bag at 23°C, set the ambient temperature to 23°C 1d-7d after inoculation, set the ambient temperature to 20°C after 7d of cultivation, set the internal temperature of the bag to 23°C after 15d of cultivation, and continue to cultivate for 10d for fruiting management.

[0075] Embodiment 2:

[0076] The difference between this embodiment and the above-mentioned embodiment 1 is that:

[0077] S2, inoculating the purified strain into a basic liquid culture medium, and culturing at 24°C and 150r / min for 10 days to obtain the coral Hericium liquid fermentation strain;

[0078] S3, placing the coral hericium liquid fermentation strain in a fermentation tank with an inoculation volume of 500 mL, a temperature of 20° C., a tank pressure of 0.12 MPa, and culturing for 7-8 days to obtain a liquid strain;

[0079] S4, inoculate the liquid bacteria into a cultivation bag containing a culture medium according to an inoculum volume of 20 mL, and cultivate at 25°C and in the dark for 30 days;

[0080] S5. Manage the mushroom bags that have been fully germinated. Give them 800 Lux and 10 hours of white light during the day to stimulate the formation of primordium. After the primordium is formed, add 5 hours of blue light stimulation with a light intensity of 800 Lux.

[0081] S6. Harvest the coral Hericium fruiting bodies after 14 days of cultivation, and then continue to cultivate for 12 days for the second wave of mushroom production.

[0082] The method of cultivation in step S4 is to control the internal temperature of the observation bag at 25°C, set the ambient temperature to 26°C 7 days after inoculation, set the ambient temperature to 23°C after 15 days of cultivation, set the internal temperature of the bag to 25°C after 15 days of cultivation, and continue to cultivate for 15 days for fruiting management

[0083] Embodiment 3:

[0084] The difference between this embodiment and the above-mentioned embodiment 1 is that:

[0085] S2, inoculating the purified strains into a basic liquid culture medium, and culturing at 24°C and 150r / min for 9 days to obtain coral Hericium erinaceus liquid fermentation strains;

[0086] S3, placing the coral hericium liquid fermentation strain in a fermentation tank with an inoculation volume of 500 mL, a temperature of 19° C., a tank pressure of 0.12 MPa, and culturing for 7.5 days to obtain the liquid strain;

[0087] S4, inoculate the liquid bacteria into a cultivation bag containing the culture medium according to the inoculum volume of 20 mL, and cultivate at 25°C and dark light for 27.5 days;

[0088] S5. Manage the mushroom bags that have been fully germinated. Give them 650Lux, 9h white light during the day to stimulate the formation of primordium. After the primordium is formed, add 4h blue light stimulation with a light intensity of 650Lux.

[0089] S6. Harvest the coral Hericium fruiting bodies after 12 days of cultivation, and then continue to cultivate for 11 days to carry out the second wave of fruiting

[0090] The cultivation method in step S4 is to control the internal temperature of the observation bag at 24°C, set the ambient temperature to 24.5°C 4 days after inoculation, set the ambient temperature to 21.5°C after 11 days of cultivation, set the internal temperature of the bag to 24°C after 15 days of cultivation, and continue to cultivate for 12 days for fruiting management

[0091] Table 1:

[0092] contrast Example 1 Example 2 Example 3 Standard value Two tides output (g / bag) 300 340 320 200 Biological efficiency (%) 66.67 75.55 71.11 53 Triterpene content (%) 2.75 2.88 2.82 2

[0093] The comparison in the above table is for wild coral hericium strains. From Table 1, it can be seen that the improvement of the separation medium, the basic liquid medium, and the culture medium affects the two-tide yield of the strain, thereby increasing the yield of the strain; by optimizing the cultivation medium, adding three-leaf green and mulberry branch chips as the cultivation matrix, the triterpene content is increased, and by optimizing the cultivation method, the biological efficiency of the coral hericium strain is affected, thereby improving the yield and quality of the coral hericium.

[0094] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A wild Hericium erinaceus strain with high triterpene production, characterized in that: The high-triterpene-producing wild coral hericium strain was deposited at the General Microbiology Center of the China Microbiological Culture Collection Administration on August 13, 2024. The deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code 100101. Its strain number is Hs and the deposit number is CGMCC NO.41435.

2. A method for cultivating a wild coral hericium strain with high triterpene production, characterized in that: The following steps are involved: S1. Collect intact coral Hericium fruiting bodies from Tumen County, Yanbian City, Jilin Province, take the tissue from the center of the stipe, inoculate it on the separation medium, culture it at 25℃ and dim light for 10 days, take the tip hyphae and repeat the inoculation twice to purify the strain; S2, inoculating the purified strains into a basic liquid culture medium, and culturing at 24°C and 150r / min with shaking for 8-10 days to obtain coral Hericium erinaceus liquid fermentation strains; S3, placing the coral hericium liquid fermentation strain in a fermentation tank with an inoculation volume of 500 mL, a temperature of 18°C-20°C, a tank pressure of 0.12Mpa, and culturing for 7d-8d to obtain a liquid strain; S4, inoculate the liquid bacteria into a cultivation bag containing a culture medium according to an inoculum volume of 20 mL, and cultivate at 25°C and in the dark for 25-30 days; S5. Manage the mushroom bags that have been fully germinated. Give them 500Lux-800Lux and 8h-10h white light during the day to stimulate the formation of primordium. After the primordium is formed, add 3h-5h blue light stimulation with a light intensity of 500Lux-800Lux. S6. Harvest the coral Hericium fruiting bodies after 10-14 days of cultivation, and then continue to cultivate for 10-12 days for the second wave of mushroom production.

3. The method for cultivating a wild Hericium erinaceus strain with high triterpene production according to claim 2, characterized in that: The separation medium in step S1 is formulated as 200 g potato, 20 g glucose, 10 g peptone, 13 g agar, and 1 L water.

4. The method for cultivating a wild Hericium erinaceus strain with high triterpene production according to claim 2, characterized in that: The formula of the basic liquid culture medium in step S2 is 0.3% corn flour, 0.2% soybean meal, 0.2% peptone, 1.6% glucose, 0.1% yeast extract, 0.001% vitamin B1, 0.1% KH2PO4, and 0.1% MgSO4.

5. The method for culturing a wild Hericium erinaceus strain with high triterpene production according to claim 2, characterized in that: The culture medium formula in step S4 is 50% broad-leaved sawdust, 28% cottonseed hulls, 5% mulberry branch chips, 5% clover leaf green, 15% bran, 1% citric acid, and 1% gypsum; the clover leaf green is crushed after drying, and the mulberry branch chips are crushed after drying mulberry branches; the size of the cultivation bag is 17cm*38cm*0.045cm, and the dry material weight is 0.45kg / bag.

6. The method for culturing a wild Hericium erinaceus strain with high triterpene production according to claim 2, characterized in that: The cultivation method in step S4 is to control the internal temperature of the observation bag at 23°C-25°C, set the ambient temperature to 23°C-26°C 1d-7d after inoculation, set the ambient temperature to 20°C-23°C after culturing for 7d-15d, set the internal temperature of the bag to 23°C-25°C after culturing for 15d, and continue culturing for 10d-15d for fruiting management.

7. Use of a wild Hericium erinaceus strain with high triterpene production according to claim 1 in nutritional health foods or medicines.

Images