Engineering bacterium for high yield of D-pantothenic acid based on balanced sugar utilization, and construction method and application thereof

Abstract

The invention relates to the technical field of genetic engineering, and discloses an engineering bacterium for high yield of D-pantothenic acid based on balanced sugar utilization, and a construction method and application thereof. Firstly, pfkB, eno and pgi genes of a glycolysis EMP pathway are weakened, zwf and pgl genes are overexpressed at the same time, and part of carbon flow flows into a PPP pathway in a push-pull mode; secondly, 6-phosphofructokinase II PfkB is knocked out, an initiation codon of an enolase gene eno is modified, and the enzyme activity of glucose phosphate isomerase Pgi is weakened; then, in order to enable the carbon flow to further flow to the PPP and ED paths, overexpressing common genes zwf and pgl of the PPP and ED, introducing edd and eda genes derived from zymomonas mobilis, and getting through the ED path in escherichia coli; thirdly, distributing redundant carbon flow of a PPP path to TCA circulation, and integrating an fxpk gene derived from bifidobacterium adolescentis and a pta gene derived from clostridium kruivmensis in a genome; and finally, through the combined action, the titer of the D-pantothenic acid reaches 4.80 g / L.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to an engineering bacterium capable of producing high D-pantothenic acid based on balanced sugar utilization, and a construction method and application thereof. Background Art

[0002] Metabolic engineering aims to maximize the production of high value-added compounds using microorganisms as cell factories. How to build a cell factory, achieve high yield and high conversion rate under effective regulation, and how to transfer carbon flow to product synthesis as much as possible while ensuring the normal growth of the strain, and reduce the waste of carbon sources, are all major research focuses of biosynthetic production products. In addition, the output of the product is the standard for whether the industrial product is achieved. The method of intuitively strengthening product synthesis and enhancing product accumulation is one of the primary operations of metabolic engineering transformation.

[0003] However, the existing technologies often have the following problems: the integration of engineering pathways will slow down the growth of host cells, thereby affecting the production performance of the strains, resulting in a conflict between cell growth and production; in addition, under the minimum limit of ensuring the normal growth of the strains, the excess carbon flow is diverted to the by-products, resulting in a waste of carbon sources. Comparing the metabolic pathway to a water pipe, the carbon flow is the water flow passing through. In order to alleviate the above problems of the existing technologies, it is necessary to reasonably allocate the direction and flow rate of the water flow so that under the premise of the same initial total carbon amount, more flow will eventually flow to the production of the product rather than overflow.

[0004] Pantothenic acid (D-PA), also known as vitamin B5, is a component of coenzyme A and plays an important role in important biochemical reactions such as energy metabolism and the citric acid cycle. At present, D-PA for industrial applications is mainly produced by chemical methods using the condensation of D-pantoic acid lactone and β-alanine in methanol or ethanol. However, the use of chemical separation or enzyme-catalyzed esters involves toxic chemical reagents and expensive separation methods. With the continuous development of genetic engineering and synthetic biology, the production of D-PA using biosynthetic methods that are environmentally friendly, cheap and simple has attracted widespread attention from scholars. However, there are still defects in the current production of D-PA using biological methods, such as unstable fermentation process and low yield. Summary of the invention

[0005] In order to solve the above-mentioned technical problem of low D-pantothenic acid production, the present invention provides an engineering bacterium for high-yield D-pantothenic acid based on balanced sugar utilization, and a construction method and application thereof.

[0006] The specific technical scheme of the present invention is: In a first aspect, the present invention provides an engineered bacterium that produces high D-pantothenic acid based on balanced sugar utilization. The genome of the engineered bacterium includes: Strengthen expression wxya Gene, pgl Gene, edd Gene, eda Gene, fxpk Gene, pta Gene; Weakened eno Gene, pgi Gene; Knockout pkq Gene.

[0007] Based on balanced sugar utilization, the present invention provides the above-mentioned engineered bacteria with high production of D-pantothenic acid. The present invention: (1) knocks out the 6-phosphofructokinase 2 gene pkq , weakening the conversion rate of fructose-6-phosphate to fructose-1, 6-2-phosphate; (2) reducing the expression of enolase Eno, weakening the conversion rate of 3-phosphoglycerate to phosphoenolpyruvate; (3) weakening pgi (1) Introduce and enhance the expression of the phosphate dehydratase edd gene and the KDPG aldolase eda gene to promote the carbon flow to the ED pathway; (2) Introduce and enhance the expression of the phosphate dehydratase edd gene and the KDPG aldolase eda gene to promote the carbon flow to the ED pathway; (3) Introduce and enhance the expression of the bifunctional phosphoketolase FxpK and the phosphate acetyltransferase Pta to convert the excess carbon flow of the PPP pathway into acetyl-CoA for growth. Through the above actions, the carbon flow distribution of EMP and PPP was modified, the EMP was weakened, exogenous EDP was introduced, and part of the PPP flow was introduced into the TCA cycle, thereby eliminating the negative impact of the weakened EMP on cell growth. Under this, a D-pantothenic acid production strain with excellent performance was constructed.

[0008] As a preference, edd The gene is derived from Zymomonas mobilis. eda The gene is derived from Zymomonas mobilis. fxpk The gene comes from Bifidobacterium adolescentis. pta The gene is derived from Clostridium kluyveri.

[0009] Excessive accumulation of glycolysis carbon sources easily leads to the accumulation of acetic acid and lactic acid byproducts. Among the three, EMP, PPP and ED, the EMP pathway is the longest and most complex, while the ED pathway has relatively few steps. For this reason, the present application introduces a heterologous ED pathway and overexpresses it, thereby balancing the carbon flow distribution of the three. The present invention experimentally verifies that after the heterologous ED pathway is introduced and overexpressed, the D-pantothenic acid production is greatly improved.

[0010] In a second aspect, the present invention provides a method for constructing an engineered bacterium for high production of D-pantothenic acid based on balanced sugar utilization, comprising the following steps: (1) Knockout in chassis bacteria pkq Gene; (2) eno The gene start codon ATG was replaced with TTG; (3) Mutate the pgi gene to pgi The amino acid histidine at position 386 of the gene-encoded protein mutated to tyrosine; (4) Enhanced expression in chassis bacteria wxya Gene; (5) Enhanced expression in chassis bacteria pgl Gene; (6) Enhanced expression in chassis bacteria edd Gene; (7) Enhanced expression in chassis bacteria eda Gene; (8) Enhanced expression in chassis bacteria fxpk Gene; (9) Enhanced expression in chassis bacteria pta Gene.

[0011] Preferably, the bottom plate bacteria is Escherichia coli.

[0012] Preferably, the genotype of the bottom plate bacteria is: E. coli W3110 derivative, Trc- panCpanEpanB / ilvC / ilvG * / Δ aV / ilvE * / a * / △ poxB / Δ pta / Δ pf / Δ oeLh / Trc- pykA / ilvN * / iV * / spoT * / Trc- spoT * / Trc- lpd / Trc- ilvD / Δ lacI / Trc- aL / Trc- ilvD / ptsG ::Trc- glk , galP .

[0013] Preferably, in step (9), the strengthening expression is: pta After the original promoter of the gene was replaced with the Trc promoter, the ackA Gene.

[0014] Preferably, in step (4) and step (5), the enhanced expression is: after replacing the original promoter of the gene to be enhanced with the Trc promoter, the corresponding in situ gene in the genome of the chassis bacteria is replaced.

[0015] Preferably, in step (6), step (7) and step (8), the enhanced expression is: replacing the original promoter of the gene to be enhanced with the Trc promoter, and then replacing the pseudogene in the genome of the chassis bacteria.

[0016] Preferably, in step (3), pgi The codon at position 386 of the gene encoding the protein mutated to UAU.

[0017] In a third aspect, the present invention provides the use of the genetically engineered bacteria constructed by the above construction method in the preparation of D-pantothenic acid.

[0018] Compared with the prior art, the present invention has the following technical effects: (1) The present invention uses CRISPR-Cas9 gene editing. First, by weakening three genes in the glycolytic EMP pathway ( pkq , eno and pgi ), while overexpressing wxya and pgl The gene was used to transfer part of the carbon flow into the PPP pathway through a push-pull method, thus transforming the sugar uptake and carbon flow distribution of Escherichia coli. Secondly, the 6-phosphofructokinase II PfkB was knocked out and the enolase gene was modified. eno The start codon of PPP and ED pathways was knocked out and the activity of glucose phosphate isomerase Pgi was weakened, which initially increased the production of D-pantothenic acid. Subsequently, in order to further direct the carbon flow to the PPP and ED pathways, the common gene of PPP and ED was overexpressed. wxya and pgl , and introduced the edd and eda coli; in addition, the excess carbon flow of the PPP pathway was allocated to the TCA cycle, and the fxpk gene from Bifidobacterium adolescentis and the fxpk gene from Clostridium kluyveri were integrated into the genome. pta Finally, through the above combined effects, the three branches of EMP, PPP and ED were rationally distributed, and the D-pantothenic acid titer increased by 25.3% in shake flask fermentation to 4.80 g / L, while OD 600Reaching 4.43, there is a significant improvement in the yield of products with pyruvate as precursor.

[0019] (2) The scheme provided by the present invention proves the feasibility of balancing the EMP, PPP and ED pathways, and can provide reference value for the genetic engineering bacteria transformation of other substances. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the metabolic pathway diagram of EMP, PPP and ED; Figure 2 This is a schematic diagram of the metabolic pathway of D-pantothenic acid; Figure 3 OD of SA-P1 600 and changes in D-pantothenic acid titer; Figure 4 OD of SA-P2 600 and changes in D-pantothenic acid titer; Figure 5 OD of SA-P3 600 and changes in D-pantothenic acid titer; Figure 6 OD of SA-P4 600 and changes in D-pantothenic acid titer; Figure 7 OD of SA-P5 600 and changes in D-pantothenic acid titer; Figure 8 OD of SA-P6 600 and changes in D-pantothenic acid titer; Fig. 9 OD of SA-P7 600 and changes in D-pantothenic acid titer; Fig.10 OD of SA-P8 600 and changes in D-pantothenic acid titer; Fig.11 OD of SA-P9 600 and changes in D-pantothenic acid titer. DETAILED DESCRIPTION

[0021] The present invention will be further described below in conjunction with embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present invention.

[0022] The present invention genetically modifies the bottom bacteria Escherichia coli to modify the sugar uptake and carbon flow distribution of Escherichia coli, and weakens pkq , eno and pgi Three genes weaken the glycolytic EMP pathway and are overexpressed wxya and pgl Genes were used to transfer part of the carbon flow into the PPP pathway through a push-pull method, and part of the flow in the PPP was further transferred to the TCA cycle. The heterologous ED pathway was introduced and overexpressed to balance the carbon flow distribution of the three pathways of EMP, PPP and ED, thus achieving high production of D-pantothenic acid. Figure 1 It is the metabolic pathway diagram of EMP, PPP, and ED; Figure 2 Schematic diagram of the D-pantothenic acid metabolic pathway. The parent strain of Escherichia coli used in the present invention is E. coli W3110, from the Coli Genetic Stock Center of Yale University, deposited on August 5, 1975, with a deposit number of CGSC#4474, has been disclosed in patents US 2009 / 0298135 A1 and US2010 / 0248311 A1.

[0023] In the embodiment of the present invention, the final concentration of kanamycin in the culture medium is 0.05 mg / L, and the final concentration of spectinomycin in the culture medium is 0.05 mg / L.

[0024] In the embodiment of the present invention, the genes and corresponding pathways involved in gene editing are shown in Table 1. Wherein, the accession number is an identifier used to uniquely identify a gene in the Entrez Gene database of the National Center for Biotechnology Information (NCBI) of the United States.

[0025] Table 1 Genes involved in gene editing and corresponding pathways Gene name Accession Number Involved pathways 946230 Fructose 6-phosphate to fructose 1, 6-2 phosphate (EMP) 945032 3-Phosphoglycerate to phosphoenolpyruvate (EMP) 948535 Glucose-6-phosphate to 3-phosphoglycerate (EMP) 946370 Glucose 6-phosphate is converted to 6-phosphogluconolactone (PPP) 946398 Conversion of 6-phosphogluconolactone to 6-phosphogluconate (PPP) 946362 Gluconate phosphate dehydratase (ED) from Zymomonas mobilis 946367 KDPG Aldolase (ED) from Zymomonas mobilis 2633304711 Bifunctional phosphoketolase (TCA) from Bifidobacterium adolescentis 946778 Phosphate acetyltransferase (TCA) from Clostridium kluyveri 7435882 Acetate kinase, catalyzes the conversion of acetyl phosphate into acetate 946230 Fructose 6-phosphate to fructose 1, 6-2 phosphate (EMP) The primer sequence information involved in the embodiments of the present invention is shown in Table 2.

[0026] Table 2 Primer sequences Primer name Primer sequence (5'-3') -up-F CGGTGCTTTTTTTGAATTCTCTAGATTAGAAGAAGTATTACTGGCGTTCC -up-R CCCCAATGCTGGGGGAATGTTTTTTGCATTTCCTCCTATAGGCTGATTTCA -sgRNA-F TAGTGAAAACTGTATTCAGGGTTTTAGAGCTAGAAATAGCAAGTTAAAA -sgRNA-R CCTGAATACAGTTTTCACTAACTAGTATTATACCTAGGACTGAGCTAGC -down-F CAAAAACATTCCCCCAGCATTGGGG -down-R TAACAGGGTAATAGATCTAAGCTTCTGCAGTACGCAGTTCGATTTCGCCTTCACCTAAC -VF TTTCTGAAGAACGCTCATCA -VR GCCATGCGGCATGGACTTCT -up-F CTTTTTTTGAATTCTCTAGAAGTACCCGGTTGTGGCGCT -up-R ATTTTGGACACTAGGTTTTCCTCAAGTCACTAG -sgRNA-F CATCTGGAGGGTGGTTTCGTGTTTTAGAGCTAGAAATAGCAAGTTAAA -sgRNA-R ACGAAACCACCCTCCAGATGACTAGTATTATACCTAGGACTGAGCT -down-F GAAAACCTAGTGTCCAAAATCGTAAAAATCATCG -down-R ATAGATCTAAGCTTCTGCAGAGCCACCTTCGTCACCAAC VF CAGCTTCAGCGATAACAGCCAGAGC VR GATTACGCTCGCCATGTTGCCAAC -up-F CTATTACCCTGTTATCCCTACAAACCTTCACCACTCAGGAA -up-R GCATACTGACCATTGGTACCTGGTTCACCCCAGATAATCG -sgRNA-F GCGTGCTGACCGTTAGTGCCGTTTTAGAGCTAGAAATAGCAAGTTAA -sgRNA-R GGCACTAACGGTCAGCACGCACTAGTATTATACCTAGGACTGAGCTA -down-F GGTACCAATGGTCAGTATGCGTTCTACCAGCTGATCCACC -down-R GGAGCTGCACATGAACTCGATCCGGCCTACATATCGACGA -VF GCGCTACAATCTTCCAAAGT -VR AACGCCTTATCCGGCCTACA -up-F CTATTACCCTGTTATCCCTACAGAAACGATTCACCGTCGGT -up-R ATTATACGAGCCGGATGATTAATTGTCAAGTCATTCTCCTTAAGTTAAC -sgRNA-F GCCTGTGACCTGGTCATTTTGTTTTAGAGCTAGAAATAGCAAGTTAA -sgRNA-R AAAATGACCAGGTCACAGGCACTAGTATTATACCTAGGACTGAGCTA -down-F GCTCGTATAATGTGTGGAATTTCACACAGGAAACAGACCCTCGATGTCAATGACACTGC -down-R GGAGCTGCACATGAACTCGAGCGCTCAGGTCAGACGGCGG -VF ATCAAAACGCGATTCCTTCA -VR ATTGCTGCTCTTGTTCGCGC -up-F CTATTACCCTGTTATCCCTACTAGACCATTGCATCATCGAC -up-R ATTATACGAGCCGGATGATTAATTGTCAAGAATGCTCCTTTGCATTTAG -sgRNA-F GTCTGGAATCTGAATCATGAGTTTTAGAGCTAGAAATAGCAAGTTAA -sgRNA-R TCATGATTCAGATTCCAGACACTAGTATTATACCTAGGACTGAGCTA -down-F GCTCGTATAATGTGTGGAATTTTCACAGGAAACAGACCATGAAGCAAACAGTTTATAT -down-R GGAGCTGCACATGAACTCGAGAGAAGTTTTCCGGCATCAT -VF ACTTGTTGCGCCGTTTCAGC -VR CGCCCAACGGGTGTCGGAGA <![CDATA[MD 3-1 -up-F]]> CTATTACCCTGTTATCCCTACTTATTGATAAACAAAAGTCA <![CDATA[MD 3-1 -up-R]]> ATTATACGAGCCGGATGATTAATTGTCAACAGTGGCAACACATTGAATA <![CDATA[MD 3-1 -sgRNA-F]]> GTTTCGCTGGTGGTAGGAAAGTTTTAGAGCTAGAAATAGCAAGTTAA <![CDATA[MD 3-1 -sgRNA-R]]> TTTCCTACCACCAGCGAAACACTAGTATTATACCTAGGACTGAGCTA <![CDATA[MD 3-1 -down-F]]> ACTGTCATCCTGTAGCTCTA <![CDATA[MD 3-1 -down-R]]> GGAGCTGCACATGAACTCGACATCGTCCGCGCTTTCGTGG -F GCTCGTATAATGTGTGGAATTTTCACAGGAAACAGACCATGACCGATCTGCATAGCAC -R TAGAGCTACAGGATGACAGTTTAAATACCTGCACCTGCAT <![CDATA[MD 3-1 -VF]]> TCGATTCTGGTGCCGCTGAT <![CDATA[MD 3-1 -VR]]> GGTGGGGTACTGGCTCATGC <![CDATA[MD 3-2 -up-F]]> CTATTACCCTGTTATCCCTACGTTCCTGACTGAACAGGGCA <![CDATA[MD 3-2 -up-R]]> ATTATACGAGCCGGATGATTAATTGTCAATTAACGATAGCGCCGCATGG <![CDATA[MD 3-2 -sgRNA-F]]> CAGGAGATCCAGAAACGCTAGTTTAGAGCTAGAAATAGCAAGTTAA <![CDATA[MD 3-2 -sgRNA-R]]> TAGCGTTTCTGGATCTCCTGACTAGTATTATACCTAGGACTGAGCTA <![CDATA[MD 3-2 -down-F]]> GGAGATGATCAATGCCTTTT <![CDATA[MD 3-2 -down-R]]> GGAGCTGCACATGAACTCGAACCGTAATGATGTGATTAAA -F GCTCGTATAATGTGTGGAATTTCACACAGGAAACAGACCATGCGTGATATTGATTCAGT -R AAAAGGCATTGATCATCTCCTTATGCAACGGCTGCACGTT <![CDATA[MD 3-2 -VF]]> GTTTTATTCATCCTCATTAT <![CDATA[MD 3-2 -VR]]> CCATATAACTTGCCATACCA <![CDATA[MD 3-3 -up-F]]> CTATTACCCTGTTATCCCTACAGTTCACGCGCAAAATCGG <![CDATA[MD 3-3 -up-R]]> ATTATACGAGCCGGATGATTAATTGTCAATGACGCGGAGATAACATATCATG <![CDATA[MD 3-3 -sgRNA-F]]> GCTGAGCGATGAAACCAGCGGTTTTAGAGCTAGAAATAGC <![CDATA[MD 3-3 -sgRNA-R]]> CGCTGGTTTCATCGCTCAGCACTAGTATTATACCTAGGACTG <![CDATA[MD 3-3 -down-F]]> AAGTCGTTCCCTCAGGAAGG <![CDATA[MD 3-3 -down-R]]> GGAGCTGCACATGAACTCGACCCTTTCTGAACAACGGCTG -F GCTCGTATAATGTGTGGAATTTCACACAGGAAACAGACCATGACCTCGCCGGTGATTGG -R CCTTCCTGAGGGAACGACTTGAATTCTCACTCGTTATCAC <![CDATA[MD 3-3 -VF]]> GGCTGCATCAATGCCATAGG <![CDATA[MD 3-3 -VR]]> ATCATGCTGCGGGTATTGAG -up-F TATTACCCTGTTATCCCTACCGATCGGCGGCATAAAACG -up-R ATTATACGAGCCGGATGATTAATTGTCAAGGAAGTACCTATAATTGATA -sgRNA-F TACAACCTGTACAAAGAGCAGTTTTAGAGCTAGAAATAGCAAGTT -sgRNA-R TGCTCTTTGTACAGGTTGTAACTAGTATTATACCTAGGACTGAGC -down-F TTTCACACCGCCAGCTCAGC -down-R TGGAGCTGCACATGAACTCGAGTGATACTCAGGTTCGCCTGCTTCGT -F GCTCGTATAATGTGTGGAATTTCACACAGGAAACAGACCATGGGCATGAAATTAATGGA -R GCTGAGCTGGCGGTGTGAAACTCGAGTTAACCTTGCGCCT -VF GGGCGAGTACGACCCTGTTCATCAA -VR GGCAATCTGCCAGCAGAGAGTAAAT pT-line-F CTGCAGAAGCTTAGATCTATTACCCTGTTATCC pT-line-R TCTAGAGAATTCAAAAAAAGCACCGACTCG Example 1 HPLC determination of D-pantothenic acid content The detection method is as follows: Chromatographic conditions: C18 column (250 × 4.6 mm, particle size 5 μm, Agilent Technologies Co., Santa Clara, CA, USA), detection wavelength: 200 nm, column temperature: 30 °C; Sample treatment: Dilute the sample with ultrapure water to keep the D-pantothenic acid content between 0.05 g / L and 0.40 g / L; Mobile phase: acetonitrile / water / phosphoric acid (volume ratio: 50 / 949 / 1); Data collection time: 18 min.

[0027] Example 2 SA-P1 (DPA-SA derivative, Δ pfkB ) and shake flask fermentation With DPA-SA ( E. coli W3110 derivative, Trc- panCpanEpanB / ilvC / ilvG * / Δ avtA / ilvE * / coaA * / △ poxB / Δ pta / Δ plfB / Δ ldhA / Trc- pykA / ilvN * / ilvH * / spoT * / Trc- spoT * / Trc- lpd / Trc- ilvD / Δ lacI / Trc- alaS / Trc- ilvD / ptsG ::Trc- glk , galP ) was used as the starting strain, and CRISPR-Cas9-mediated gene editing technology was used to knock out the Escherichia coli phosphofructokinase encoding gene through gene knockout method pfkB Gene.

[0028] (1) Construction of pT- pfkB Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template. pfkB -sgRNA-F / pfkB -sgRNA-R is the primer for PCR amplification, and the PCR product is Dpn I was digested at 37 °C for 3 h and then transformed into E. coli DH5α, spectinomycin plate screening, sequencing verification to obtain the correct pT- pfkB Plasmid, for subsequent ligation pfkB -up and pfkB -down.

[0029] (2) Build pTarget- pfkB Plasmid: E. coli The W3110 genome was used as a template. pfkB -up-F with pfkB -up-R is obtained by primer amplification pfkB -up, pfkB -down-F and pfkB -down-R is obtained by primer amplification pfkB -down, pTarget- mgsA The plasmid was amplified using PT-line-F and PT-line-R as primers to obtain pTarget-line- pfkB , Cleanup kit to recover DNA fragments; according to ClonExpress ® (One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to pTarget-line- pfkB , pfkB -up and pfkB -down were connected together and verified by sequencing to obtain pTarget- pfkB Plasmid.

[0030] (3) Introduce the pCas plasmid (Addgene Plasmid #62225) into DPA-SA, transfer the single clone into an LB tube containing 0.05 mg / L kanamycin, and culture at 30°C overnight; then inoculate it into a 250 mL shake flask containing 50 mL LB medium at a volume concentration of 1%, add 500 μl 1 mol / L L-arabinose, and culture at 150 rpm and 30°C until the OD 600 0.4~0.6; 4000 rpm, 4 ℃ centrifugation for 10 min to collect cells and prepare electroporation competent cells. For detailed procedures, see (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99-102).

[0031] (4) Take 200 ng pTarget- pfkB The plasmid was mixed with 100 μl of electroporated competent cells and transferred into a pre-cooled 2 mm electroporation cup. The mixture was placed on ice for about 1 min and electroporated using an electroporator (MicroPluser TM, BIO-RAD) for electroporation transformation. Immediately after electroporation, 1 mL of LB medium was added and gently aspirated, and the culture was transferred to a 1.5 mL centrifuge tube. After thawing at 30 °C for 2-3 h, the culture was coated with LB plates containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin, and incubated at 37 °C for 12-16 h. pfkB -VF and pfkB -VR was used as primer for colony PCR verification. If a fragment of about 1500 bp could be successfully cloned, it was proved to be a DPA-SA derivative, Δ pfkB Positive colonies.

[0032] (5) Plasmid elimination: Pick a positive single colony and inoculate it into an LB test tube containing 1 mM IPTG and 0.05 mg / L kanamycin, culture it at 30°C overnight, and streak the bacterial liquid onto an LB plate containing 0.05 mg / L kanamycin the next day. Culture it at 30°C for 24 h, pick a single colony and streak it onto an LB plate containing 0.05 mg / L spectinomycin. The single colony that cannot be streaked onto the LB plate containing 0.05 mg / L spectinomycin has pTarget- pfkB The plasmid was successfully eliminated and pTarget- pfkB The single colony with successful elimination of plasmid was placed in LB test tube and cultured at 37 °C overnight. The next day, the bacterial solution was streaked on LB plate and cultured at 37 °C for 12 h. A single colony was picked and streaked on LB plate containing 0.05 mg / L kanamycin. The pCas plasmid of the single colony that could not be successfully eliminated on the LB plate containing 0.05 mg / L kanamycin was finally obtained. The plasmid-free DPA-SA derivative, Δ pfkB , and the SA-P1 strain was obtained.

[0033] (6) Using DPA-SA as the control group, DPA-SA derivative, Δ pfkB (SA-P1 strain) and DPA-SA were inoculated into 10 mL of LB medium, respectively, and cultured at 37°C and 200 rpm as pre-cultures; 8-12 h later, 1 mL of the pre-culture was inoculated into a 500 mL shake flask containing 50 mL of MS medium, and then fermented in a constant temperature shaker at 30°C and 200 rpm for 48 h; after the fermentation, 1 mL of the fermentation liquid was taken to measure the OD 600 1 mL of fermentation broth was taken and centrifuged at 12000 rpm for 3 min at room temperature. The fermentation supernatant was diluted 10 times and HPLC was performed according to Example 1. OD 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 3 shown.

[0034] Depend on Figure 3It can be seen that knockout in the DPA-SA genome pfkB Gene, has a certain inhibitory effect on cell growth, cell OD 600 The growth capacity of DPA-SA decreased from 4.23 to 4.19, while the D-pantothenic acid titer increased from 3.83 g / L to 3.90 g / L. The D-pantothenic acid yield increased slightly, but the specific productivity (D-pantothenic acid yield ratio) OD 600 value has increased).

[0035] LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, solvent is deionized water, pH value is natural.

[0036] MS medium: glucose 20 g / L, ammonium sulfate 16 g / L, KH2PO4 0.8 g / L, MgSO4 0.5 g / L, yeast extract 2 g / L, β-alanine 2.5 g / L, CaCO3 10 g / L (sterilized separately), 1 mL / L trace element solution, the solvent is deionized water, and the pH value is natural; the trace element solution composition: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.20 g / L CuSO4, 0.02 g / L NiCl2·7H2O, the solvent is deionized water.

[0037] Example 3 SA-P2 (SA-P1 derivative, no A*T ) and shake flask fermentation Using SA-P1 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to modify Escherichia coli enolase no The start codon of no The start codon ATG of the gene was replaced with TTG, weakening the partial enzymatic activity of Eno.

[0038] (1) Construction of pT- no Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template. no -sgRNA-F / enoE -sgRNA-R is the primer for PCR amplification, and the PCR product is Dpn I was digested at 37 °C for 3 h and then transformed into E. coli DH5α, spectacular enzyme plate screening, sequencing verification to obtain the correct pT- no Plasmid, for subsequent ligation no -up and no -down.

[0039] (2) Build pTarget- no Plasmid: E. coli The W3110 genome was used as a template. no -up-F with no -up-R is obtained by primer amplification no -up, no -down-F and no -down-R is obtained by primer amplification no -down,pT- no The plasmid was amplified using PT-line-F and PT-line-R as primers to obtain pTarget-line- no , Clean up kit to recover DNA fragments; according to ClonExpress ® (One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to pTarget-line- no , no -up and no -down were connected together and verified by sequencing to obtain pTarget- no Plasmid.

[0040] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the SA-P1 competent cell obtained in Example 2 (5). The preparation method of SA-P1 competent cell was the same as that in Example 2 (3).

[0041] (4) SA-P2 positive colonies were constructed using the same method as in Example 2 (4).

[0042] (5) Plasmid elimination: The implementation method is the same as Example 2 (5) to obtain plasmid-free SA-P2.

[0043] (6) The constructed SA-P2 engineered strain was used as a control group with the SA-P1 constructed in Example 2, and the shake flask test and detection were carried out according to the method of Example 2 (6). 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 4 shown.

[0044] Depend on Figure 4 It can be seen that mutations in the SA-P1 genome no And weakened, cell OD 600 The gene decreased from 4.19 to 4.06, and the D-pantothenic acid titer increased from 3.90 g / L to 4.12 g / L. The gene had a significant effect on the D-pantothenic acid production. 600The further decrease in shows that the carbon flow in the glycolysis pathway is increasingly reduced, and the growth rate directly affects the production of D-pantothenic acid. The significant increase in productivity reflects the feasibility of this strategy. At present, the growth rate has become the limiting factor of the bacteria. Considering the needs of subsequent transformation, the growth rate of the strain should be gradually increased while increasing the yield.

[0045] This example also starts with DPA-SA and uses CRISPR-Cas9-mediated gene editing technology to modify Escherichia coli enolase no The start codon of no The start codon ATG of the gene was replaced with TTG to weaken the partial enzyme activity of Eno, and the SA-VSP2 strain was obtained. For details, refer to the construction of SA-P2 in steps (1) to (5) of this example. The results showed that the D-pantothenic acid titer of SA-VSP2 was 3.87 g / L, which was not effectively improved compared to 3.83 g / L of DPA-SA, while SA-P2 was improved from 3.83 g / L to 4.12 g / L compared to DPA-SA. This shows that the D-pantothenic acid titer of SA-P2 in this example was 3.87 g / L, which was not effectively improved compared to 3.83 g / L of DPA-SA. pfkB The importance of genetic weakening.

[0046] Example 4 SA-P3 (SA-P2 derivative, pgi H386Y ) and shake flask fermentation Using SA-P2 as the starting strain, the CRISPR-Cas9-mediated gene editing technology was used to modify the 386th amino acid of the E. coli 6-phosphoglucose isomerase pgi, changing histidine to tyrosine, which greatly reduced the enzyme activity of Pgi and destroyed the activity of Pgi to a great extent. Specifically, the codon CAC of the histidine at position 386 of Pgi was replaced with the codon UAU, so that the histidine at position 386 of Pgi was mutated to tyrosine.

[0047] (1) Construction of pT- pgi Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template. pgi -sgRNA-F / pgi -sgRNA-R is the primer for PCR amplification, and the PCR product is Dpn I was digested at 37 °C for 3 h and then transformed into E. coli DH5α, spectacular enzyme plate screening, sequencing verification to obtain the correct pT- pgi Plasmid, for subsequent ligation pgi -up / pgi -down.

[0048] (2) Build pTarget- pgi Plasmid: E. coli The W3110 genome was used as a template. pgi -up-F with pgi -up-R is obtained by primer amplification pgi -up, pgi -down-F and pgi -down-R is obtained by primer amplification pgi -down,pT- pgi The plasmid was amplified using PT-line-F and PT-line-R as primers to obtain pTarget-line- pgi , Clean up kit to recover DNA fragments; according to ClonExpress ® (One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to pTarget-line- pgi , pgi -up and pgi -down were connected together and verified by sequencing to obtain pTarget- pgi Plasmid.

[0049] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the SA-P2 competent cell obtained in Example 3 (5). The preparation method of SA-P2 competent cell was the same as that of Example 2 (3).

[0050] (4) SA-P3 positive colonies were constructed using the same method as in Example 2 (4).

[0051] (5) Plasmid elimination: The implementation method is the same as Example 2 (5) to obtain plasmid-free SA-P3.

[0052] (6) The constructed SA-P3 engineered strain was used as a control group with the SA-P2 constructed in Example 3, and the shake flask test and detection were carried out according to the method of Example 2 (6). 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 5 shown.

[0053] As can be seen from the figure, mutations in the SA-P2 genome pgi The glycolytic pathway was greatly damaged, and the cell OD 600 The OD value decreased from 4.06 to 3.79, while the D-pantothenic acid titer increased slightly from 4.12 g / L to 4.24 g / L. This shows that weakening EMP can introduce carbon flow into the PPP pathway. In E. coli, the PPP pathway itself is weak, so the ATP produced by metabolism is not enough to supply cell growth, so OD600 It decreased again, while the shortening of the PPP carbon metabolism pathway and the generation of NADPH in the first and second steps were associated with the increased production of D-pantothenic acid.

[0054] Example 5 SA-P4 (SA-P3 derivative, P WT - zwf ::Ptrc- zwf ) and shake flask fermentation Using SA-P3 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to replace the Trc promoter with the gene knockout method. zwf The original promoter of the gene is strengthened zwf The expression of the gene was then linked to the Trc promoter zwf In situ gene replacement on the genome of the engineered bacterium SA-P3 zwf Gene, pulling carbon flow into the PPP pathway and enhancing the production of NADPH.

[0055] (1) Construction of pT- zwf Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template. zwf -sgRNA-F / zwf -sgRNA-R is the primer for PCR amplification, and the PCR product is Dpn I was digested at 37 °C for 3 h and then transformed into E. coli DH5α, spectacular enzyme plate screening, sequencing verification to obtain the correct pT- zwf Plasmid, for subsequent ligation zwf -up / zwf -down.

[0056] (2) Build pTarget- zwf Plasmid: E. coli The W3110 genome was used as a template. zwf -up-F with zwf -up-R is obtained by primer amplification zwf -up, zwf -down-F and zwf -down-R is obtained by primer amplification zwf -down,pT- zwf The plasmid was amplified using PT-line-F and PT-line-R as primers to obtain pTarget-line- zwf , Clean up kit to recover DNA fragments; according to ClonExpress ®(One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to pTarget-line- zwf , zwf -up and zwf -down were connected together and verified by sequencing to obtain pTarget- zwf Plasmid.

[0057] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the SA-P3 competent cell obtained in Example 4 (5). The preparation method of SA-P3 competent cell was the same as that of Example 2 (3).

[0058] (4) SA-P4 positive colonies were constructed using the same method as in Example 2 (4).

[0059] (5) Plasmid elimination: The implementation method is the same as Example 2 (5) to obtain plasmid-free SA-P4.

[0060] (6) The constructed SA-P4 engineered strain was used as a control group with the SA-P3 constructed in Example 4, and the shake flask test and detection were carried out according to the method of Example 2 (6). 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 6 shown.

[0061] As can be seen from the figure, it is overexpressed in the SA-P3 genome zwf , cell OD 600 From 3.79 to 3.84, OD 600 The change was not significant, and the D-pantothenic acid titer increased slightly from 4.24 g / L to 4.29 g / L, but the increase was not significant. 600 There was no significant increase in the potency of D-pantothenic acid, but as the first step of the PPP pathway and ED pathway, zwf The overexpression laid the foundation for subsequent transformation.

[0062] Example 6 SA-P5 (SA-P4 derivative, P WT - pgl ::Ptrc- pgl ) and shake flask fermentation Using SA-P4 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to replace the Trc promoter pgl The original promoter of the gene is strengthened pgl The expression of the gene was then linked to the Trc promoter pgl Gene replacement in situ on the genome of engineered bacteria SA-P4 pglgene, further pulling carbon flux into the PPP pathway and enhancing the production of NADPH.

[0063] (1) Construction of pT- pgl Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template. pgl -sgRNA-F / pgl -sgRNA-R is the primer for PCR amplification, and the PCR product is Dpn I was digested at 37 °C for 3 h and then transformed into E. coli DH5α, spectacular enzyme plate screening, sequencing verification to obtain the correct pT- pgl Plasmid, for subsequent ligation pgl -up / pgl -down.

[0064] (2) Build pTarget- pgl Plasmid: E. coli The W3110 genome was used as a template. pgl -up-F with pgl -up-R is obtained by primer amplification pgl -up, pgl -down-F and pgl -down-R is obtained by primer amplification pgl -down,pT- pgl The plasmid was amplified using PT-line-F and PT-line-R as primers to obtain pTarget-line- pgl , Clean up kit to recover DNA fragments; according to ClonExpress ® (One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to pTarget-line- pgl , pgl -up and pgl -down were connected together and verified by sequencing to obtain pTarget- pgl Plasmid.

[0065] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the SA-P4 competent cell obtained in Example 5 (5). The preparation method of SA-P4 competent cell was the same as that of Example 2 (3).

[0066] (4) SA-P5 positive colonies were constructed using the same method as in Example 2 (4).

[0067] (5) Plasmid elimination: The implementation method is the same as Example 2 (5) to obtain plasmid-free SA-P5.

[0068] (6) The constructed SA-P5 engineered strain was used as a control group with the SA-P4 constructed in Example 5, and the shake flask test and detection were carried out according to the method of Example 2 (6). 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 7 shown.

[0069] Depend on Figure 7 It can be seen that overexpression in the SA-P4 genome pgl , cell OD 600 From 3.84 to 3.89, and the D-pantothenic acid titer increased from 4.29 g / L to 4.32 g / L, similar to zwf The role of pgl As the second enzyme in the PPP and ED pathways, OD 600 The D-pantothenic acid production did not change, indicating that the carbon flow distribution relying solely on the PPP pathway could no longer meet the needs of D-pantothenic acid production, or because the PPP pathway and the EMP pathway were still too long, resulting in a loss of carbon flow and ultimately too little pyruvate precursor generated. Therefore, subsequent experiments introduced the ED pathway, which has the least steps to produce pyruvate from glucose, to reduce the waste of carbon sources.

[0070] Example 7 SA-P6 (SA-P5 derivative, MD 3-1 ::Ptrc- edd ) and shake flask fermentation Using SA-P5 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to knock out the gene using the trc promoter regulated by pTrc99A from Zymomonas mobilis. edd Gene replacement of part of the pseudogene cluster MD on the genome of strain SA-P5 3-1 (The nucleotide sequence is shown in SEQ IQ NO.1), pulling the carbon source from the PPP pathway to the ED pathway.

[0071] (1) Construction of pT-MD 3-1 Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template, MD 3-1 -sgRNA-F / MD 3-1 -sgRNA-R is the primer for PCR amplification, and the PCR product is Dpn I was digested at 37 °C for 3 h and then transformed into E. coli DH5α, screening with spectacular enzyme plate, sequencing verification to obtain the correct pT-MD 3-1Plasmid, used for subsequent ligation of MD 3-1 -up, edd and MD 3-1 -down.

[0072] (2) Construction of pTarget-MD 3-1 ::Ptrc- edd Plasmid: Based on the genome of Zymomonas mobilis, MD 3-1 -up-F and MD 3-1 -up-R is the primer amplification to obtain MD 3-1 -up, edd -F with edd -R is obtained by primer amplification edd , MD 3-1 -down-F and MD 3-1 -down-R is primer amplification to obtain MD 3-1 -down, pT-MD 3-1 Plasmid pTarget-line-MD was obtained by amplification with primers PT-line-F and PT-line-R. 3-1 , Clean up kit to recover DNA fragments; according to ClonExpress ® (One stepclone kit, Vazyme Biotech, Nanjing, China) instructions for pTarget-line-MD 3-1 ,MD 3-1 -up, edd and MD 3-1 -down were connected together and verified by sequencing to obtain pTarget-MD 3-1 ::Ptrc- edd Plasmid.

[0073] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the SA-P5 competent cell obtained in Example 6 (5). The preparation method of SA-P5 competent cell was the same as that of Example 2 (3).

[0074] (4) SA-P6 positive colonies were constructed using the same method as in Example 2 (4).

[0075] (5) Plasmid elimination: The implementation method is the same as Example 2 (5) to obtain plasmid-free SA-P6.

[0076] (6) The constructed SA-P6 engineered strain was used as a control group with the SA-P5 constructed in Example 6, and shake flask tests and detection were performed according to the method of Example 2 (6). OD 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 8shown.

[0077] Depend on Figure 8 It can be seen that overexpression in the SA-P5 genome edd , cell OD 600 The titer of D-pantothenic acid decreased from 3.89 to 3.81, while the titer of D-pantothenic acid increased slightly from 4.32 g / L to 4.35 g / L. edd From the gene, it pulled the carbon flow from the PPP pathway and introduced it into the ED pathway from Zymomonas mobilis. eda Before the gene, it was not visible edd The apparent effect of the gene on this strain.

[0078] Example 8 SA-P7 (SA-P6 derivative, MD 3-2 ::Ptrc- eda ) and shake flask fermentation Using SA-P6 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to knock out the gene using the trc promoter regulated by pTrc99A from Zymomonas mobilis. eda Gene replacement of part of the pseudogene cluster MD on the genome of strain SA-P6 3-2 (The nucleotide sequence is shown in SEQ IQ NO.2), further pulling the carbon source from the PPP pathway to the ED pathway.

[0079] (1) Construction of pT-MD 3-2 Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template, MD 3-2 -sgRNA-F / MD 3-2 -sgRNA-R is the primer for PCR amplification, and the PCR product is Dpn I was digested at 37 °C for 3 h and then transformed into E. coli DH5α, screening with spectacular enzyme plate, sequencing verification to obtain the correct pT-MD 3-2 Plasmid, used for subsequent ligation of MD 3-2 -up, eda and MD 3-2 -down.

[0080] (2) Construction of pTarget-MD 3-2 ::Ptrc- eda Plasmid: Based on the genome of Zymomonas mobilis, MD 3-2 -up-F and MD 3-2 -up-R is the primer amplification to obtain MD 3-2 -up, eda -F with eda -R is obtained by primer amplification eda , MD 3-2 -down-F and MD 3-2 -down-R is primer amplification to obtain MD 3-2 -down, pT-MD 3-2 Plasmid pTarget-line-MD was obtained by amplification with primers PT-line-F and PT-line-R. 3-2 , Clean up kit to recover DNA fragments; according to ClonExpress ® (One stepclone kit, Vazyme Biotech, Nanjing, China) instructions for pTarget-line-MD 3-2 ,MD 3-2 -up, eda and MD 3-2 -down were connected together and verified by sequencing to obtain pTarget-MD 3-2 ::Ptrc- eda Plasmid.

[0081] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the SA-P6 competent cell obtained in Example 7 (5). The preparation method of SA-P6 competent cell was the same as that of Example 2 (3).

[0082] (4) SA-P7 positive colonies were constructed using the same method as in Example 2 (4).

[0083] (5) Plasmid elimination: The implementation method is the same as Example 2 (5) to obtain plasmid-free SA-P7.

[0084] (6) The constructed SA-P7 engineered strain was used as a control group with the SA-P6 constructed in Example 7, and the shake flask test and detection were carried out according to the method of Example 2 (6). 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 9 shown.

[0085] Depend on Figure 9 It can be seen that overexpression in the SA-P6 genome eda , cell OD 600 From 3.81 to 3.88, and the D-pantothenic acid titer increased from 4.35 g / L to 4.41 g / L. eda Gene, it is the second gene of Zymomonas mobilis, and it is different from the previous edd After overexpression, the complete ED pathway was introduced into E. coli, and OD 600The D-pantothenic acid production was also increased in line with the theory, indicating that the carbon source was indeed lost in the EMP and PPP pathways, and the short ED pathway effectively reduced the loss of this part of the carbon flow and directed it to pyruvate synthesis.

[0086] Example 9 SA-P8 (SA-P7 derivative, MD 3-3 ::Ptrc- fxpk ) and shake flask fermentation Using SA-P8 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to knock out the gene using the trc promoter regulated by pTrc99A from Bifidobacterium adolescentis. fxpk Gene replacement of part of the pseudogene cluster MD on the genome of strain SA-P8 3-3 (The nucleotide sequence is shown in SEQ IQ NO.3), which promotes the production of acetyl-CoA precursor acetyl phosphate from xylulose 5-phosphate in the PPP pathway and fructose 6-phosphate in the EMP pathway.

[0087] (1) Construction of pT- fxpk Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template, MD 3-3 -sgRNA-F / MD 3-3 -sgRNA-R is the primer for PCR amplification, and the PCR product is Dpn I was digested at 37 °C for 3 h and then transformed into E. coli DH5α, screening with spectacular enzyme plate, sequencing verification to obtain the correct pT-MD 3-3 Plasmid, used for subsequent ligation of MD 3-3 -up, fxpk and MD 3-3 -down.

[0088] (2) Construction of pTarget-MD 3-3 ::Ptrc- fxpk Plasmid: Based on the genome of Zymomonas mobilis, MD 3-3 -up-F and MD 3-3 -up-R is the primer amplification to obtain MD 3-3 -up, fxpk -F with fxpk -R is obtained by primer amplification fxpk , MD 3-3 -down-F and MD 3-3 -down-R is primer amplification to obtain MD 3-3 -down, pT-MD 3-3Plasmid pTarget-line-MD was obtained by amplification with primers PT-line-F and PT-line-R. 3-3 , Clean up kit to recover DNA fragments; according to ClonExpress ® (One step cloning kit, Vazyme Biotech, Nanjing, China) instructions to pTarget-line-MD 3-3 ,MD 3-3 -up, fxpk and MD 3-3 -down were connected together and verified by sequencing to obtain pTarget-MD 3-3 ::Ptrc- fxpk Plasmid.

[0089] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the SA-P7 competent cell obtained in Example 8 (5). The preparation method of SA-P7 competent cell was the same as that of Example 2 (3).

[0090] (4) SA-P8 positive colonies were constructed using the same method as in Example 2 (4).

[0091] (5) Plasmid elimination: The implementation method is the same as Example 2 (5) to obtain plasmid-free SA-P8.

[0092] (6) The constructed SA-P8 engineered strain was used as a control group with the SA-P7 constructed in Example 8, and shake flask tests and detection were performed according to the method of Example 2 (6). OD 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 10 shown.

[0093] As can be seen from the figure, it is overexpressed in the SA-P7 genome fxpk , cell OD 600 The content of D-pantothenic acid increased from 3.88 to 4.09, while the titer of D-pantothenic acid decreased from 4.41 g / L to 4.38 g / L, and the change of D-pantothenic acid production was not significant. fxpk The gene directs the excess carbon flow from the EMP and PPP pathways into coenzyme A, which can flow into the TCA cycle after further conversion, so-called promoting cell growth, so OD 600 The changes were rapid, and the strain gradually returned to the growth state of the chassis strain.

[0094] Example 10 SA-P9 (SA-P8 derivative, ackA ::Ptrc- pta ) and shake flask fermentation Using SA-P9 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to knock out the gene using the trc promoter regulated by pTrc99A from Clostridium kluyveri. pta The gene replaced the acetate kinase in the genome of strain SA-P8, which promoted the production of acetyl-CoA from acetyl phosphate and flowed into the TCA cycle.

[0095] (1) Construction of pT- ackA Plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as template. ackA -sgRNA-F / ackA -sgRNA-R is the primer for PCR amplification, and the PCR product is Dpn I was digested at 37 °C for 3 h and then transformed into E. coli DH5α, spectacular enzyme plate screening, sequencing verification to obtain the correct pT- ackA Plasmid, for subsequent ligation ackA -up, pta and ackA -down.

[0096] (2) Build pTarget- ackA ::Ptrc- pta Plasmid: Based on the genome of Zymomonas mobilis as template, ackA -up-F with ackA -up-R is obtained by primer amplification ackA -up, pta -F with pta -R is obtained by primer amplification pta , ackA -down-F and ackA -down-R is obtained by primer amplification ackA -down,pT- ackA The plasmid was amplified using PT-line-F and PT-line-R as primers to obtain pTarget-line- ackA , Clean up kit to recover DNA fragments; according to ClonExpress ® (One step clone kit, Vazyme Biotech, Nanjing, China) instructions for pTarget-line- ackA , ackA -up, pta and ackA -down were connected together and verified by sequencing to obtain pTarget- ackA ::Ptrc- pta Plasmid.

[0097] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the SA-P8 competent cell obtained in Example 9 (5). The preparation method of SA-P8 competent cell was the same as that of Example 2 (3).

[0098] (4) SA-P9 positive colonies were constructed using the same method as in Example 2 (4).

[0099] (5) Plasmid elimination: The implementation method is the same as Example 2 (5) to obtain plasmid-free SA-P9.

[0100] (6) The constructed SA-P9 engineered strain was used as a control group with the SA-P8 constructed in Example 9, and the shake flask test and detection were carried out according to the method of Example 2 (6). 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 11 shown.

[0101] Depend on Figure 11 It can be seen that overexpression in the SA-P8 genome pta , cell OD 600 The titer of D-pantothenic acid increased from 4.38 g / L to 4.45 g / L, and the OD 600 The production of d-pantothenic acid and d-pantothenic acid has been significantly increased. fxpk The acetyl phosphate formed depends on the pta Acetyl-CoA cannot be generated effectively, and the overexpression of heterologous genes further promotes the conversion of acetyl phosphate to acetyl-CoA. The energy supply of TCA to the strain even achieves growth performance that exceeds that of the starting strain. SA-P9 is a high-yield D-pantothenate strain that balances the carbon flow of the glycolysis pathway (EMP), pentose phosphate pathway (PPP) and 2-keto-3-deoxy-6-phosphogluconate pathway (ED).

[0102] Excessive accumulation of glycolysis carbon sources easily leads to the accumulation of acetic acid and lactic acid byproducts. Among EMP, PPP and ED, the EMP pathway is the longest and most complex one, while the ED pathway has relatively the fewest steps. For this reason, the present invention introduces a heterologous ED pathway and overexpresses it, thereby balancing the carbon flow distribution of the three. The present invention has been verified by experiments that after introducing a heterologous ED pathway and overexpressing it, the D-pantothenic acid yield is greatly improved.

[0103] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0104] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. An engineered bacterium for high production of D-pantothenic acid based on balanced sugar utilization, characterized in that: The genome of the engineered bacteria includes: Strengthen expression wxya Gene, pgl Gene, edd Gene, eda Gene, fxpk Gene, pta Gene; Weakened eno Gene, pgi Gene; Knockout pkq Gene.

2. The engineered bacteria according to claim 1, characterized in that: edd The gene is derived from Zymomonas mobilis. eda The gene is derived from Zymomonas mobilis. fxpk The gene comes from Bifidobacterium adolescentis. pta The gene is derived from Clostridium kluyveri.

3. A method for constructing an engineered bacterium for high production of D-pantothenic acid based on balanced sugar utilization, characterized in that: The following steps are involved: (1) Knockout in chassis bacteria pkq Gene; (2) eno The start codon ATG of the gene was replaced with TTG; (3) Mutate the pgi gene to pgi The amino acid histidine at position 386 of the gene-encoded protein mutated to tyrosine; (4) Enhanced expression in chassis bacteria wxya Gene; (5) Enhanced expression in chassis bacteria pgl Gene; (6) Enhanced expression in chassis bacteria edd Gene; (7) Enhanced expression in chassis bacteria eda Gene; (8) Enhanced expression in chassis bacteria fxpk Gene; (9) Enhanced expression in chassis bacteria pta Gene.

4. The construction method according to claim 3, characterized in that: The bottom plate bacteria is Escherichia coli.

5. The construction method according to claim 4, characterized in that: The genotype of the bottom plate bacteria is: E. coli W3110derivative, Trc- panCpanEpanB / ilvC / ilvG * / Δ aV / ilvE * / a * / △ poxB / Δ pta / Δ pf / Δ oeLh / Trc- pykA / ilvN * / iV * / spoT * / Trc- spoT * / Trc- lpd / Trc- ilvD / Δ lacI / Trc- aL / Trc- ilvD / ptsG ::Trc- glk , galP .

6. The construction method according to claim 4 or 5, characterized in that: In step (9), the enhanced expression is: pta After the original promoter of the gene was replaced with the Trc promoter, the ackA Gene.

7. The construction method according to claim 4 or 5, characterized in that: In step (4) and step (5), the enhanced expression is as follows: after replacing the original promoter of the gene to be enhanced with the Trc promoter, the corresponding in situ gene in the genome of the chassis bacteria is replaced.

8. The construction method according to claim 4 or 5, characterized in that: In step (6), step (7) and step (8), the enhanced expression is as follows: after replacing the original promoter of the gene to be enhanced with the Trc promoter, the pseudogene in the genome of the chassis bacteria is replaced.

9. The construction method according to claim 4 or 5, characterized in that: In step (3), pgi The codon at position 386 of the gene encoding the protein mutated to UAU.

10. Use of the genetically engineered bacterium according to claim 1 or 2, or the genetically engineered bacterium constructed by the construction method according to any one of claims 3 to 9 in the preparation of D-pantothenic acid.

Images