Wheat negative regulation factor TaEDR2 and application thereof in wheat stripe rust resistance improvement

Abstract

The invention belongs to the field of biological agriculture, and particularly relates to a wheat negative regulatory factor TaEDR2 and application thereof. The amino acid sequence of the wheat negative regulatory factor encoding protein provided by the invention is as shown in SEQ ID NO: 1, and the nucleotide sequence of the wheat negative regulatory factor TaEDR2 is as shown in SEQ ID NO: 2. According to the invention, gene editing is carried out in a Fielder wild type material, and a TaEDR2 gene editing plant which shows resistance to stripe rust CYR32 is obtained. It is determined that the TaEDR2 gene plays a negative regulation role in wheat stripe rust resistance, a stripe rust resistant wheat material is created by using the negative regulation factor, and new gene and germplasm resources are provided for wheat stripe rust resistant breeding.

Description

Technical Field

[0001] The invention belongs to the field of biological agriculture, and specifically relates to a wheat negative regulatory factor TaEDR2 and an application thereof in improving wheat stripe rust resistance. Background Art

[0002] Wheat stripe rust is one of the main diseases of wheat and an important biological disaster that affects the safe production of wheat. Wheat stripe rust is caused by Puccinia striiformis f.sp.Tritici and is characterized by strong epidemicity, wide range of damage and strong destructiveness. In the past 50 years, due to the widespread planting of disease-resistant varieties with similar genotypes and the same resistance source, a single disease-resistant gene has exerted tremendous selection pressure on stripe rust, and the toxicity of stripe rust has rapidly mutated. Once the toxicity of the pathogen population mutates, the resistance of the existing varieties will be overcome, leading to a large-scale outbreak of the disease. Therefore, tapping into wheat disease-resistant gene resources and creating broad-spectrum and long-lasting disease-resistant materials are the fundamental ways to prevent and control wheat stripe rust.

[0003] The wheat negative regulatory factor (TaEDR2) is located on chromosome 4. The TaEDR2 protein consists of 718 amino acids, including a PH region (Pleckstrin Homology), a START region (Steroidogenic Acute Regulatory protein-related lipid transfer) and a DUF1336 region (PFAM accession nos PF00169, PF01852 and PF07059, respectively). The DUF1336 region is about 250 amino acids and is a plant-specific domain. This region is quite conservative, suggesting that TaEDR2 may play an important role in regulating plant disease responses. There are no literature reports related to TaEDR2 resistance to stripe rust. Whether TaEDR2 gene can be used to create broad-spectrum and durable disease-resistant materials against wheat stripe rust cannot be predicted by ordinary technicians in this field without a large number of screening tests and verification tests. Summary of the invention

[0004] To solve the above technical problems, the present invention provides a wheat negative regulatory factor TaEDR2 and its application. The present invention aims to further explore the immune defense mechanism of wheat, explore the genes that play a negative regulatory role in the defense response of wheat to stripe rust invasion, and provide a new path for creating broad-spectrum and long-lasting wheat stripe rust-resistant materials by conducting gene function research.

[0005] In order to fully and unambiguously understand the technical solution of the present invention, it is necessary to supplement that the coding gene of the wheat negative regulatory factor TaEDR2 of the present invention is represented by the italic font "TaEDR2", and the coding protein of the wheat negative regulatory factor TaEDR2 is represented by the non-italic font "TaEDR2". Of course, those of ordinary skill in the art can clearly and completely understand the meaning and expression of the relevant genes and their coded proteins based on the records of the present invention.

[0006] In one aspect, the present invention provides a wheat negative regulatory factor TaEDR2, the nucleotide sequence of which is shown in SEQ ID NO: 2. The sequence SEQ ID NO: 2 is as follows:

[0007]

[0008] On the other hand, the present invention provides a protein encoding the wheat negative regulatory factor TaEDR2, and the protein encoding the wheat negative regulatory factor TaEDR2 is obtained by encoding the nucleotide sequence providing the wheat negative regulatory factor TaEDR2.

[0009] Furthermore, the amino acid sequence of the protein encoded by the wheat negative regulatory factor TaEDR2 is shown in SEQ ID NO: 1. The sequence SEQ ID NO: 1 is as follows:

[0010] .

[0011] On the other hand, the present invention provides a gene knockout or editing vector for knocking out or editing the wheat negative regulatory factor TaEDR2.

[0012] On the other hand, the wheat negative regulatory factor TaEDR2 or the wheat negative regulatory factor TaEDR2 encoding protein or the gene knockout or editing vector is used in the breeding of wheat stripe rust resistant varieties.

[0013] Furthermore, the nucleotide sequence of the wheat negative regulatory factor TaEDR2 is expressed by Agrobacterium-mediated genetic transformation, and has a negative regulatory effect in the interaction between wheat and stripe rust. Knocking out the wheat negative regulatory factor TaEDR2 enhances wheat's resistance to stripe rust pathogens.

[0014] In addition, the present invention provides a method for breeding wheat stripe rust-resistant varieties, the method comprising knocking out the wheat negative regulatory factor TaEDR2 in the plant to obtain a TaEDR2 gene-edited plant variety.

[0015] Furthermore, the plant is a monocotyledonous plant, the monocotyledonous plant is a cereal crop, and the cereal crop is wheat.

[0016] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0017] (1) Compared with traditional disease-resistant breeding technology, plant disease-resistant genetic engineering technology can break through the reproductive isolation and incompatibility of distant hybridization between species, achieve targeted improvement of target traits in a shorter period of time, and provide more comprehensive, continuous and broad-spectrum protection for crops. Through gene function research, the present invention found that the wheat negative regulatory factor TaEDR2 plays a negative regulatory role in the defense response of wheat invaded by stripe rust, that is, knocking out the nucleotide sequence of the wheat negative regulatory factor TaEDR2 can improve the ability of wheat to resist stripe rust. Reducing the expression of the protein encoded by the wheat negative regulatory factor TaEDR2 in the plant can give the plant a certain degree of disease resistance.

[0018] (2) The present invention provides a method for breeding wheat stripe rust-resistant varieties. The method uses CRISPR / Cas9 gene editing technology to knock out the wheat negative regulatory factor TaEDR2 in the wheat plant, thereby enhancing the resistance of wheat to stripe rust pathogens. It has been verified that wheat edited with the wheat negative regulatory factor TaEDR2 gene obtained by the method of the present invention shows resistance to the main epidemic subspecies of stripe rust. The present invention provides a new technical idea for breeding wheat stripe rust-resistant varieties from the perspective of molecular biology, and effectively solves the technical problems of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1This is a schematic diagram of the expression profile analysis of the wheat negative regulatory factor TaEDR2 in Example 1.

[0020] Figure 2 This is a schematic diagram of gene editing in TaEDR2 gene-edited plants.

[0021] Figure 3 It is a schematic diagram of the phenotypic results of the TaEDR2 gene-edited plants inoculated with stripe rust CYR32 in Example 2. Fielder is a wild-type wheat variety, Fielder is a control group; TaEDR2KO#L4 and TaEDR2KO#L5 represent the T1 generation lines Line4 and Line5 of the TaEDR2 gene-edited plants, respectively. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is described below in conjunction with embodiments; however, the present invention is not limited to the following embodiments.

[0023] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings, but the embodiments are not intended to limit the present invention.

[0024] The experimental methods and detection methods described in the following embodiments are conventional methods unless otherwise specified; the reagents and materials are commercially available unless otherwise specified.

[0025] Example 1

[0026] This example is a functional analysis experiment of wheat negative regulatory factor TaEDR2.

[0027] Fielder wheat leaves were collected at different time points (0, 24, 48, 72, 96, and 120 h) after inoculation with stripe rust fungi CYR23 (non-affinity) and CYR32 (affinity), and RNA was extracted using an RNA extraction kit (purchased from Beijing Huayueyang Biotechnology Co., Ltd.). Reverse transcription was performed using reverse transcriptase M-MLV (purchased from Thermo Fisher). Real-time quantitative PCR was used to detect the expression level of the TaEDR2 gene. Real-time quantitative PCR was performed using specific primers for TaEDR2. Based on qRT-PCR, the elongation factor gene TaEF1-α was used as an internal reference. The reaction conditions were as follows: 95°C for 10 min; 95°C for 10 s; 60°C for 30 s; 72°C for 30 s; and 40 cycles.

[0028] TaEDR2 Primers:

[0029] EDR2-qRT-F:CTTTGACTCGGTTGCCTTGC;

[0030] EDR2-qRT-R:ACTGCACGCTTTACCATCCA.

[0031] Internal reference TaEF1-α primer:

[0032] TaEF1-α-F: TGGTGTCATCAAGCCTGGTATGGT;

[0033] TaEF1-α-R:ACTCATGGTGCATCTCAACGGACT.

[0034] Adoption 2 -△△CT Methods The relative expression of TaEDR2 was calculated. The results were as follows Figure 1 As shown: The expression level of TaEDR2 gene reached the highest level 24 hours after stripe rust infection in the affinity system (inoculated with CYR32), indicating that the resistance of TaEDR2 gene knockout plants to stripe rust was improved, indicating that TaEDR2 gene played a negative regulatory role in wheat response to stripe rust infection.

[0035] Example 2

[0036] This embodiment provides the application of wheat negative regulatory factor TaEDR2 in improving wheat rust-resistant varieties.

[0037] The plants of the present invention are preferably monocotyledonous plants and cereal crops that can be successfully infected and colonized by wheat stripe rust fungi, and wheat is particularly preferred.

[0038] The nucleotide sequence of the wheat negative regulatory factor TaEDR2 in this example is shown in SEQ ID NO:2.

[0039] The amino acid sequence of the protein encoded by the wheat negative regulatory factor TaEDR2 in this example is shown in SEQ ID NO: 1.

[0040] The application of the wheat negative regulatory factor TaEDR2 in the improvement of wheat rust-resistant varieties provided in this embodiment includes the use of CRISPR / Cas9 gene editing technology to create TaEDR2 gene-edited plants.

[0041] Two specific targets of the TaEDR2 gene were screened, and forward primers and reverse primers were designed according to the screened targets. The designed primers were synthesized to synthesize target-1 primers and target-2 primers respectively; the intermediate vector sgRNA was single-digested with BtgZI endonuclease, and the digested vector was connected with the target-1 primer using T4 ligase, and the connected products were transformed into Escherichia coli, and a single colony was picked for testing, and the positive colony was detected. When the sequencing results were correct, a single colony was picked for shaking culture and plasmid sgRNA-target-1 was extracted; sgRNA-target-1 was digested with BsaI t-1, use T4 ligase to connect the digested vector with target-2, transform the obtained ligation product into Escherichia coli, pick a single colony for testing, detect the positive colony, and wait for the sequencing result to be correct. Pick a single colony to shake and culture to extract the plasmid, use LR reaction to connect sgRNA-target-1-target-2 with the final vector Cas9, pick the positive colony to shake and extract the plasmid, and introduce the prepared plasmid into Fielder wheat using Agrobacterium-mediated, and obtain TaEDR2 gene-edited plants. The gene schematic diagram of wild-type wheat (Fielder) and gene-edited wheat (TaEDR2KO) is shown in the figure. Figure 2 shown.

[0042] Target primer-target-1:

[0043] EDR2-SgRNA1-F:ACTCAGTTGGTGGAAACAATTGAT;

[0044] EDR2-SgRNA1-R:AAAC ATCAATTGTTTCCACCAACT.

[0045] Target primer-target-2:

[0046] EDR2-SgRNA2-F:ACTTGAAGTGCATTGTTACTCGCA;

[0047] EDR2-SgRNA2-R:AAACTGCGAGTAACAATGCACTTC.

[0048] The application of the wheat negative regulatory factor TaEDR2 in improving wheat rust-resistant varieties provided in this embodiment also includes a verification method for the application of the wheat negative regulatory factor TaEDR2 in cultivating and improving wheat rust-resistant varieties, specifically including:

[0049] S101: Obtain TaEDR2 gene-edited wheat and perform Hi-TOM gene editing sequencing on the obtained TaEDR2 gene-edited wheat

[0050] S102: Inoculate the T1 generation TaEDR2 gene-edited plants with the main epidemic species of stripe rust, identify the resistance of the gene-edited plants to the epidemic species of stripe rust, and determine the stripe rust resistance characteristics of the TaEDR2 gene-edited wheat varieties.

[0051] Hi-TOM gene editing sequencing technology was used to detect TaEDR2 gene-edited plants. Figure 2 shown.

[0052] The application of the wheat negative regulatory factor TaEDR2 provided in this example in the improvement of wheat rust resistance. T1 generation TaEDR2 gene-edited plants L4 strains and L5 strains were selected. When they grew to the "two leaves and one heart" stage, the stripe rust fungus CYR32 was inoculated on the second leaf of wheat. Wild wheat (Fielder) was used as the control group and inoculated with stripe rust fungus CYR32. The growth of spore piles on wheat leaves was observed 14 days after inoculation. The results are as follows: Figure 3 As shown: The number of spore piles in TaEDR2 gene-edited plants (TaEDR2KO#L4 and TaEDR2KO#L5) was significantly less than that in the wild wheat (Fielder) in the control group, indicating that TaEDR2 gene-edited plants enhanced wheat resistance to stripe rust, suggesting that the TaEDR2 gene plays a negative regulatory role in wheat resistance to stripe rust.

[0053] In summary, the application of wheat negative regulatory factor TaEDR2 in wheat rust-resistant variety improvement provided in the embodiment of the present invention adopts CRISPR / Cas9 gene editing technology to construct a gene editing vector of wheat negative regulatory factor TaEDR2, and delivers the gene editing vector to the recipient wheat Fielder through Agrobacterium-mediated wheat genetic transformation technology. The obtained gene-edited plants are identified as positive plants, and two strains L4 and L5 of the T1 generation of positive plants are selected and inoculated with the popular race CYR32. After 14 days of observation, it is found that the gene-edited plants of wheat negative regulatory factor TaEDR2 have reduced spore production compared with Fielder, showing enhanced resistance.

[0054] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A wheat negative regulatory factor TaEDR2, characterized in that: The nucleotide sequence of the wheat negative regulatory factor TaEDR2 is shown in SEQ ID NO:

2.

2. A protein encoding a wheat negative regulatory factor TaEDR2, characterized in that: The wheat negative regulatory factor TaEDR2 encoding protein is encoded by the nucleotide sequence according to claim 1.

3. The wheat negative regulatory factor TaEDR2 encoding protein according to claim 2, characterized in that: The amino acid sequence of the protein encoded by the wheat negative regulatory factor TaEDR2 is shown in SEQ ID NO:

1.

4. A gene knockout or editing vector, characterized in that: Used to knock out or edit the wheat negative regulatory factor TaEDR2 described in claim 1.

5. Use of the wheat negative regulatory factor TaEDR2 according to claim 1 or the wheat negative regulatory factor TaEDR2 encoding protein according to claim 3 or the vector according to claim 4 in the breeding of wheat stripe rust resistant varieties.

6. The use according to claim 5, characterized in that: The nucleotide sequence of the wheat negative regulatory factor TaEDR2 is expressed by genetic transformation mediated by Agrobacterium tumefaciens and has a negative regulatory effect in the interaction between wheat and stripe rust.

7. The use according to claim 5, characterized in that: Knocking out the wheat negative regulatory factor TaEDR2 enhances wheat resistance to stripe rust.

8. A method for breeding wheat varieties resistant to stripe rust, characterized in that: The wheat negative regulatory factor TaEDR2 according to claim 1 is knocked out in the plant to obtain a TaEDR2 gene-edited plant variety.

9. The method for breeding wheat stripe rust resistant varieties according to claim 8, characterized in that: include: Construct the gene knockout or editing vector of claim 4; transform the immature embryos of the plant by using Agrobacterium-mediated genetic transformation to obtain the TaEDR2 gene-edited plant variety.

10. The method for breeding wheat stripe rust resistant varieties according to claim 9, characterized in that: The plant is a monocotyledonous plant, the monocotyledonous plant is a cereal crop, and the cereal crop is wheat.

Images