Fluorescent biosensor for one-step detection of miRNA based on CRISPR / Cas13a and primer exchange reaction

Abstract

The invention discloses a fluorescent biosensor for one-step detection of miRNA based on CRISPR / Cas13a and primer exchange reaction, which comprises a CRISPR / Cas13a reaction system consisting of Cas13a protein, crRNA corresponding to the Cas13a protein and a hairpin H1, and a primer exchange reaction system consisting of Bst3.0 DNA polymerase, a buffer solution of the Bst3.0 DNA polymerase, a hairpin H2, dNTP and a molecular beacon MB, and realizes one-step detection of target nucleic acid. And the instability of the detection process and the complexity of operation are remarkably reduced, and great clinical application potential and value are shown.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection, and in particular to a fluorescent biosensor for detecting miRNA in one step based on CRISPR / Cas13a and primer exchange reaction. Background Art

[0002] In recent years, nucleic acid biomarkers have played an increasingly important role in various fields such as clinical disease diagnosis and treatment, including circulating tumor DNA, gene mutation DNA, and various mRNAs and microRNAs (miRNAs) that regulate gene expression. Among them, miRNA, as one of the many nucleic acid markers, has a wide variety and high homology. It is widely involved in various life activities of the body and can often be seen in various environments, such as blood, urine, etc. Due to its unique physiological function and its own easy degradation and low expression level (compared with other nucleic acid markers), it is undoubtedly very difficult to achieve sensitive and specific detection in complex environments. At present, traditional detection methods are still limited to real-time PCR, microarray technology and nucleic acid blotting technology. However, these technologies have their own shortcomings, such as high detection cost (expensive reagents and instruments), long detection time, cumbersome operation and susceptibility to interference. These defects make them unable to adapt well to the requirements and conditions of current clinical rapid detection. Based on this, researchers have also tried to develop technical means such as electrochemical biosensors, chemiluminescence and Raman spectroscopy to detect miRNA. These technologies have achieved sensitive and specific detection of markers to a certain extent, which is an improvement over the above-mentioned traditional detection technologies. However, these new technologies still have a big problem that they cannot solve the problem of simple and fast experimental operation, that is, they cannot complete the detection of biomarkers in one step. The step-by-step operation brings great instability to the test results, which ultimately leads to unreliable test results. Therefore, we urgently need to develop a new detection technology that can achieve simple and fast detection of our nucleic acid biomarkers with good analytical performance (high sensitivity, specificity and constant temperature). Summary of the invention

[0003] In view of the above, an object of the present invention is to provide.

[0004] In order to achieve the above object, the present invention provides the following technical solutions: A fluorescent biosensor for detecting miRNA in one step based on CRISPR / Cas13a and primer exchange reaction, wherein the fluorescent biosensor comprises a CRISPR / Cas13a reaction system and a primer exchange reaction system driven by DNA polymerase; The CRISPR / Cas13a reaction system comprises Cas13a protein and its corresponding crRNA, and hairpin H1; the crRNA can complement the target miRNA to be tested to form a hybrid double strand and activate the RNase activity of the Cas13a protein, cut the hairpin H1, and release the single-stranded DNA primer P1; The DNA polymerase-driven primer exchange reaction system includes Bst3.0 DNA polymerase and its buffer, hairpin H2, dNTP and molecular beacon MB; the 3' end of hairpin H2 is modified with an inverted T base to prevent non-specific extension, and the GC base pair at the end of the stem of hairpin H2 is hydroxymethylated to prevent the extension of the polymerase; P1 can be complementary to the 3' end of hairpin H2, and with the help of Bst3.0 DNA polymerase, primer P1 uses hairpin H2 as a template, replicates and extends forward, and terminates at the hydroxymethylated site, thereby generating a primer extension sequence P2, and the complementary sequence on hairpin H2 displaces P2 from H2 through competition, and P2 complementarily hybridizes with the molecular beacon MB, converting MB from a hairpin structure to a double-stranded DNA structure to generate a fluorescent signal; The nucleotide sequence of hairpin H1 is: TCT ACA CGU UUU UCG TGT AGA; The nucleotide sequence of primer P1 is: GT GTA GA; The nucleotide sequence of hairpin H2 is: GAG GAC AGT GGC GCT CmGmG GCC TTT TGG CmCmC GAGCGC CAC TGT CCT CTC TAC AC dT; The nucleotide sequence of primer extension sequence P2 is: GTGTAGAGAGGACAGTGGCGCTC; The nucleotide sequence of the molecular beacon MB is: FAM-GTG TAG AGA GGA GCG CCA CTG TCC TCT CTACAC-BHQ1.

[0005] In some embodiments of the present invention, when the target miRNA to be detected is miRNA-21, the nucleotide sequence of miRNA-21 is UAG CUU AUC AGA CUG AUG UUG A, and the nucleotide sequence of its corresponding crRNA is GAU UUA GAC UACCCC AAA AAC GAA GGG GAC UAA AAC UCA ACA UCA GUC UGA UAA GCU AU.

[0006] In some embodiments of the present invention, the detection method comprises the following steps: first, a sample containing the target to be detected is mixed with the CRISPR / Cas13a system and the primer exchange reaction system driven by DNA polymerase, and then incubated; after the reaction is completed, the DNA polymerase activity is inactivated, and the fluorescence value is detected.

[0007] In some embodiments of the present invention, the concentrations of the components in the reaction system of the fluorescent biosensor are: Cas13a 5 nM, crRNA 25 nM, hairpin H1 200 nM, hairpin H2 100 nM, dNTP 10 mM, Bst3.0 DNA polymerase 16 U / 20 μL, and molecular beacon MB 100 nM.

[0008] In some embodiments of the present invention, the reaction condition of incubation is 37° C. for 2 h, and the reaction condition of inactivating DNA polymerase activity is 80° C. for 5 min.

[0009] In some embodiments of the present invention, the parameters for detecting fluorescence values ​​are set as follows: excitation wavelength 480 nm, emission wavelength range 500-600 nm, and slits of both excitation peak and emission peak are 5 nm.

[0010] The beneficial effects of the present invention are: the advantage of the present invention is that compared with traditional detection technologies and other newly constructed technologies, the complexity of the operation can be significantly reduced, and multiple lid closing and opening operations are not required (increasing the possibility of aerosol contamination). The whole process is completed in one test tube, and the fluorescence result can be obtained within two hours, thereby quickly analyzing the presence of the test object and quantitatively detecting its content. The present invention smoothly combines the CRISPR / Cas13a system with the primer exchange reaction system driven by DNA polymerase, realizes the detection of target nucleic acid in one step, significantly reduces the instability of the detection process and the complexity of the operation, and shows great clinical application potential and value. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration: Figure 1 This is a schematic diagram of the principle of the present invention.

[0012] Figure 2 The assay feasibility was verified by non-denaturing gel electrophoresis.

[0013] Figure 3 The fluorescence spectrum is used to characterize the fluorescence signal difference.

[0014] Figure 4 To monitor the changes of fluorescence signals in real time.

[0015] Figure 5 For sensitivity analysis. DETAILED DESCRIPTION

[0016] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0017] All oligonucleotide sequences (including miR-21 and crRNA) in the present invention were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. and purified by high-performance liquid chromatography. LwaCas13a protein (5 μM) was purchased from Shanghai Jiying Biotechnology Co., Ltd. Bst 3.0 DNA polymerase and its buffer (10×rCutSmart) were ordered from New England Biolabs (Beijing). 20 bp DNA marker and 10× loading buffer were provided by TakaRa Biological Co., Ltd. (Chengdu Microgram). Gel electrophoresis-related reagents including 10% gelling agent, 30% polyacrylamide and TBE buffer were purchased from Beijing Solaibao Biotechnology Co., Ltd. Fluorescence signals were collected using a fluorescence spectrophotometer (Hitachi, Japan). Non-denaturing polyacrylamide gel electrophoresis (nPAGE) was performed on a Bio-Rad electrophoresis analyzer (Bio-Rad, USA), and the results were visualized on a Bio-rad ChemDoc XRS (Bio-Rad, USA).

[0018] The principle design of the present invention is as follows Figure 1 As shown, taking miR-21 as the target to be detected, the detection process specifically includes the following steps: 1. Construct a reaction system, including 35 nM Cas13a, 25 nM crR-21, 200 nM hairpin H1, 100 nM hairpin H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase and its corresponding 1×rCutSmart buffer, 100 nM molecular beacon MB and different concentrations of miR-21, and incubate.

[0019] 2. After the reaction is completed, use a fluorescence spectrophotometer to collect the fluorescence signal. The intensity of the fluorescence signal is closely related to the content of the target miR-21, so as to accurately analyze miR-21.

[0020] The fluorescent biosensor based on CRISPR / Cas13a and primer exchange reaction was established. The basic principle is as follows: We used the CRISPR / Cas13a system as a gating element and designed a crRNA sequence that is completely complementary to the base composition of the target miRNA. When the target miRNA is present, the crRNA and miR-21 bases are complementary and paired, successfully activating the RNase activity of CRISPR / Cas13a, cutting the UUUUU site on the hairpin H1, thereby destroying the hairpin structure of H1 and releasing the free single-stranded DNA primer P1 (CGTGTAGA). P1 complementarily binds to the primer binding site on the hairpin H2, forming the amplification conditions of the DNA polymerase. At this time, with the assistance of Bst3.0 DNA polymerase, P1 uses H2 as a template, replicates and extends forward, opens the hairpin H2, and terminates the extension at the hydroxymethylation modification site. At this time, through the principle of three-branch migration, the sequence originally opened on H2 competitively displaces the primer extension sequence P2 (GTGTAGAGAGGACAGTGGCGCTC) from H2, and H2 returns to its original state and continues to hybridize with the next P1 to repeat the polymerization-displacement-polymerization process, thereby achieving signal amplification. The displaced P2 can hybridize with the molecular beacon MB, changing MB from a hairpin structure to a double-stranded DNA structure. Due to its unique hairpin structure, MB causes the fluorescent groups and quenching groups labeled at both ends to be very close, and the fluorescent signal is quenched. The activation of the CRISPR / Cas13a system successfully triggered by the target miRNA and the subsequent primer exchange reaction to produce P2 destroyed this pattern, and finally opened the molecular beacon MB labeled with the fluorescent group to release the fluorescent signal. Therefore, the fluorescence signal we measured is closely related to the content of the target miR-21, achieving accurate detection and analysis of miR-21.

[0021] Table 1 Sequence information Name Sequence (5'→3') H1 TCT ACA CGU UUU UCG TGT AGA (SEQ ID NO.1) H2 GAG GAC AGT GGC GCT CmGmG GCC TTT TGG CmCmC GAG CGC CAC TGT CCT CTC TAC AC dT (SEQ ID NO.2) MB FAM-GTG TAG AGA GGA GCG CCA CTG TCC TCT CTA CAC-BHQ1 (SEQ ID NO.3) miR-21 UAG CUU AUC AGA CUG AUG UUG A (SEQ ID NO.4) crR-21 GAU UUA GAC UAC CCC AAA AAC GAA GGG GAC UAA AAC UCA ACA UCA GUC UGA UAA GCU AU (SEQ ID NO.5) Note: m represents hydroxymethyl modification; FAM represents carboxyfluorescein modification; BHQ1 represents fluorescence quenching group Example 1 In this example, miR-21 was used as a target to establish a fluorescent biosensor based on CRISPR / Cas13a and primer exchange reaction. The specific operation steps are as follows: First, a stable hairpin structure H1, H2, and MB was constructed by high temperature and annealing. The program was set to 95°C for 5 minutes, then dropped to 25°C at a rate of 0.1°C / s and stored for at least 1 hour. The molecular beacon MB labeled with a fluorescent group needs to be protected from light. The prepared probe was placed in a -20°C refrigerator for later use. Next, a 20 μL detection system was constructed, including 35 nM Cas13a, 25 nM crR-21, 200 nM H1, 100 nM H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase and its corresponding 1× rCutSmart buffer, 100 nM MB and different concentrations of miR-21, and finally supplemented with water to 20 μL. After the detection system reacted at 37°C for 2 hours, it was heated to 80°C for 5 minutes to inactivate the enzyme, thereby terminating the reaction. Finally, 180 μL of enzyme-free water was added to mix into 200 μL of the sample to be tested, and the fluorescence signal was detected on a fluorescence spectrophotometer. The specific fluorescence parameters were set as an excitation wavelength of 480 nm, an emission wavelength range of 500-600 nm, and the slits of the excitation peak and emission peak were both 5 nm.

[0022] Example 2 We first configured a 12% non-denaturing gel electrophoresis to verify the detection feasibility of the present invention. The 10 μL loading sample contained 9 μL of reaction product and 1 μL of 10 × loading buffer. After being fully mixed, it was added to the lanes of gel electrophoresis in sequence (5 μL of 20 bp DNA marker was added to the first lane). Gel electrophoresis was performed in 1 × TBE buffer and maintained at a voltage of 120 V for 40 min. Finally, the gel was soaked in Gel-red nucleic acid dye for staining. The gel was developed using a chemiluminescence imaging system. The results are shown in Figure 2. Figure 2As shown, lane M: 20 bp DNA marker; lane 1: miR-21; lane 2: H1; lane 3: H2; lane 4: H1 + CRISPR / Cas13a; lane 5: miR-21 + H1 + CRISPR / Cas13a; lane 6: H1 +CRISPR / Cas13a + H2 + Bst3.0 DNA polymerase; lane 7: miR-21 + H1 + CRISPR / Cas13a + H2+ Bst3.0 DNA polymerase. The concentrations of H1, H2, Cas13a, crR-21, and Bst3.0 DNA polymerase were 200 nM, 100 nM, 35 nM, 25 nM, and 16 U, respectively. The results show that in the absence of miR-21, the locked CRISPR / Cas13a system cannot cleave the RNA substrate, and H1 remains intact in lanes 4 and 6. In contrast, the activated CRISPR / Cas13a system cleaves the RNA probe, resulting in the disappearance of H1 in lanes 5 and 7. When miR-21 successfully unlocks the CRISPR / Cas13a enzyme activity and triggers the primer exchange reaction loop, a band is observed below lane 7, while no corresponding band is observed in lane 6. Therefore, we verified the feasibility of the present invention from the gel electrophoresis results.

[0023] Example 3 First, a fluorescence detection system is constructed with reference to Example 1.

[0024] Sample 1: 20 μL of detection system, including 10 nM miR-21, 35 nM Cas13a, 25 nM crR-21, 200 nM H1, 100 nM H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase and its corresponding 1× rCutSmart buffer, 100 nM MB. Incubate at room temperature 37℃ for 2h, then maintain at 80℃ for 5min to inactivate the enzyme.

[0025] Sample 2: 20 μL of detection system, including 35 nM Cas13a, 25 nM crR-21, 200 nM H1, 100 nM H2, 10 mM dNTP, 16 U Bst3.0 DNA polymerase and its corresponding 1× rCutSmart buffer, 100 nM MB. Incubate at room temperature 37°C for 2 hours, then maintain at 80°C for 5 minutes to inactivate the enzyme.

[0026] The whole process is completed in one step, without the need for repeated opening and closing of the lid. Figure 3As shown, it shows that the fluorescence spectrum shows a relatively obvious signal difference when the target nucleic acid miR-21 is present or not, and the negative control (sample 2) signal is lower than the positive control (sample 1) signal, indicating that only when the target miR-21 is present can it trigger a significant fluorescence enhancement, further illustrating the feasibility of the present invention to detect miR-21.

[0027] Example 4 In order to monitor the changes of fluorescence signals in real time during the whole process, we used a fluorescence thermostatic amplification instrument to monitor the intensity changes of the signal. A 20 μL detection system was constructed containing (i.e., sample 1 in Example 3) or not containing (i.e., sample 2 in Example 3) 10 nM of target miR-21, which was directly inserted into the amplification instrument and the parameters were set. The parameters were set to maintain at 37°C for 40 minutes and collect signals every 15 seconds. The results are shown in Figure 2. Figure 4 As shown, it indicates that with the increase of time, the fluorescence intensity of the positive control, i.e., when the target miR-21 is present, also increases continuously; in contrast, no obvious fluctuation is observed in the fluorescence signal of the blank control group, and the fluorescence intensity is always at a low value, thus proving that the present invention can well monitor the presence of the target nucleic acid.

[0028] Example 5 First, the target nucleic acid was diluted layer by layer with enzyme-free water and added to the detection system described in Example 1 to maintain the following concentration gradient: 100 nM, 50 nM, 10 nM, 1 nM, 100 pM, 10 pM, 1 pM. The fluorescence signal of the sample (three sets of parallel controls for each concentration gradient) was detected by fluorescence spectrophotometer. The results are shown in Figure 2. Figure 5 As shown, it shows that as the concentration decreases, the fluorescence signal also decreases. The linear range of the present invention is 1 pM ~ 1 nM, the minimum detection limit is 0.66 pM, and the fitting is FI = 18.17 lgC miR-21 + 107.87. Compared with other known methods, the present invention exhibits considerable sensitivity, proving that the present invention can better detect the nucleic acid marker miR-21.

[0029] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. A fluorescent biosensor for detecting miRNA in one step based on CRISPR / Cas13a and primer exchange reaction, characterized in that: The fluorescent biosensor includes a CRISPR / Cas13a reaction system and a DNA polymerase-driven primer exchange reaction system; The CRISPR / Cas13a reaction system comprises Cas13a protein and its corresponding crRNA, and hairpin H1; the crRNA can complement the target miRNA to be tested to form a hybrid double strand and activate the RNase activity of the Cas13a protein, cut the hairpin H1, and release the single-stranded DNA primer P1; The DNA polymerase-driven primer exchange reaction system includes Bst3.0 DNA polymerase and its buffer, hairpin H2, dNTP and molecular beacon MB; the 3' end of hairpin H2 is modified with an inverted T base to prevent non-specific extension, and the GC base pair at the end of the stem of hairpin H2 is hydroxymethylated to prevent the extension of the polymerase; P1 can be complementary to the 3' end of hairpin H2, and with the help of Bst3.0 DNA polymerase, primer P1 uses hairpin H2 as a template and replicates and extends forward until it terminates at the hydroxymethylated site, thereby generating a primer extension sequence P2; the complementary sequence on hairpin H2 displaces P2 from H2 through competition, and P2 complementarily hybridizes with molecular beacon MB, converting MB from a hairpin structure to a double-stranded DNA structure to generate a fluorescent signal; The nucleotide sequence of hairpin H1 is: TCT ACA CGU UUU UCG TGT AGA; The nucleotide sequence of primer P1 is: GT GTA GA; The nucleotide sequence of hairpin H2 is: GAG GAC AGT GGC GCT CmGmG GCC TTT TGG CmCmC GAG CGCCAC TGT CCT CTC TAC AC dT; The nucleotide sequence of primer extension sequence P2 is: GTGTAGAGAGGACAGTGGCGCTC; The nucleotide sequence of the molecular beacon MB is: FAM-GTG TAG AGA GGA GCG CCA CTG TCC TCT CTA CAC-BHQ1.

2. The fluorescent biosensor according to claim 1, characterized in that: When the target miRNA to be detected is miRNA-21, the nucleotide sequence of miRNA-21 is UAG CUU AUC AGA CUG AUG UUG A, and the nucleotide sequence of its corresponding crRNA is GAU UUA GAC UAC CCC AAA AAC GAA GGG GAC UAA AAC UCA ACA UCA GUC UGA UAAGCU AU.

3. The fluorescent biosensor according to claim 1, characterized in that: The detection method includes the following steps: first, a sample containing the target to be detected is mixed with the CRISPR / Cas13a system and the primer exchange reaction system driven by DNA polymerase, and then incubated; after the reaction is completed, the DNA polymerase activity is inactivated, and the fluorescence value is detected.

4. The fluorescent biosensor according to claim 3, characterized in that: The concentrations of the components in the reaction system of the fluorescent biosensor are: Cas13a 5 nM, crRNA 25 nM, hairpin H1 200 nM, hairpin H2 100 nM, dNTP 10 mM, Bst3.0 DNA polymerase 16 U / 20 μL, and molecular beacon MB 100 nM.

5. The fluorescent biosensor according to claim 3, characterized in that: The reaction condition of the incubation is 37° C. for 2 h, and the reaction condition of inactivating the activity of the DNA polymerase is 80° C. for 5 min.

6. The electrochemical sensor according to claim 3, characterized in that When detecting the fluorescence value, the parameters were set as follows: excitation wavelength 480 nm, emission wavelength range 500-600 nm, and slits of both the excitation peak and emission peak were 5 nm.

Images