Rapid detection primer, probe and kit for pseudomonas aeruginosa in drinking water and application of rapid detection primer, probe and kit

Abstract

The invention relates to an RPA (recombinase polymerase amplification) detection primer and a probe for rapidly detecting pseudomonas aeruginosa in drinking water. The primer and the probe show good inclusiveness and exclusiveness. Meanwhile, the invention also provides a rapid detection method of pseudomonas aeruginosa based on the detection primer and the probe, the method can adopt a lateral flow test strip for rapid detection, and a sensitivity test result developed by taking a standard strain lysis solution as a template shows that LOD50 of the rapid screening detection method is 2.4 * 10 < 3 > CFU / mL.

Description

Technical Field

[0001] The invention belongs to the field of rapid microbial detection, and in particular relates to rapid detection of Pseudomonas aeruginosa in drinking water. Background Art

[0002] Pseudomonas aeruginosa is a common conditional pathogen in bottled drinking water. Its optimal growth temperature is 35°C. It can use quorum sensing to generate biofilms to protect the bacteria and promote their adaptation to adverse environments. It poses a greater potential health risk to people with weakened immunity.

[0003] In recent years, with the improvement of people's living standards, packaged drinking water has gradually become popular in people's daily lives. GB 19298-2014 "National Food Safety Standard Packaged Drinking Water" issued in 2014 clearly stipulates that Pseudomonas aeruginosa must not be detected in 5 independently packaged drinking water in the same batch. Developed countries such as the United States and Canada have also made similar regulations on drinking water hygiene standards. According to the sampling results in recent years, the detection rate of Pseudomonas aeruginosa in bottled drinking water is relatively high, especially after disasters such as floods, the pollution of bottled drinking water is more serious (Chen Fei et al., Investigation and Research on Pseudomonas aeruginosa in Bottled Drinking Water, Food Safety Guide, 2023, (19), 122-124; Wang Zhen et al., Random Inspection and Analysis of Pseudomonas aeruginosa in Packaged Drinking Water in my country from 2016 to 2019, Bioprocessing, 2023, 21(03), 346-354.)

[0004] Through visits and investigations, it was found that bottled drinking water manufacturers have a very clear understanding of the risk of their products being contaminated by Pseudomonas aeruginosa. However, due to the limitations of detection levels and conditions, it is difficult for most companies to carry out Pseudomonas aeruginosa detection in accordance with GB8538-2022 "National Food Safety Standard Test Methods for Drinking Natural Mineral Water" and are unable to effectively control the risk of Pseudomonas aeruginosa contamination in the production process of bottled drinking water.

[0005] Jin Xiaojun (Jin Xiaojun et al., Application of recombinase polymerase amplification in the detection of Pseudomonas aeruginosa, Chinese Journal of Burns, 2018, 34(4), 233-239.) et al. used real-time RPA to detect Pseudomonas aeruginosa in clinical samples, with a detection sensitivity of 100 CFU / mL. Liu Hui (Liu Hui et al., Determination of Pseudomonas aeruginosa in bottled (barreled) water by recombinase polymerase rapid amplification method, Journal of Food Safety and Quality, 2020, 11(19), 6915-6920.) also used real-time RPA to detect Pseudomonas aeruginosa in barreled (bottled) drinking water, with a detection sensitivity of 36 CFU / mL. Yang et al. (Yang, SM et al., Rapid Detection of Salmonella Enteritidis, Typhimurium, and Thompson by Specific Peak Analysis Using Matrix-Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry. Foods 2021, 10(5).) used RPA-test strips to detect Pseudomonas aeruginosa in clinical samples, and the detection sensitivity can reach 3.05CFU / mL. Zeng Sisi (Zeng Sisi et al., Real-time fluorescence ring-mediated isothermal amplification detection of Pseudomonas aeruginosa, Journal of Food Safety and Quality. 2019, 10(09), 2684-2688.) used LAMP technology to detect barreled (bottled) drinking water, and its detection sensitivity can reach 5.2CFU / mL. Huang et al. (Huang, S. et al., Rapid and sensitive detection of Pseudomonas aeruginosa by isothermal amplification combined with Cas12a-mediated detection. Sci Rep 2023, 13 (1), 19199.) used real-time PCR technology to detect Pseudomonas aeruginosa in bottled water, and the detection sensitivity can reach 1 CFU / mL. CN 114317790 B discloses a dual fluorescence quantitative PCR detection method and a kit for two pathogenic bacteria in prepackaged drinking water. In the fluorescence quantitative PCR detection method, the target bacteria DNA content in the test sample is increased and retained as much as possible by optimizing the combination of technical means such as culture time, DNA sedimentation agent, and immunomagnetic beads, so as to achieve a detection limit of 1 CFU / 250 mL.CN 110331219 A also discloses a method for rapid detection of Pseudomonas aeruginosa, which uses the rpoB gene of Pseudomonas aeruginosa as the target gene, performs RPA detection by designing primers and probes, has high detection specificity, can distinguish Pseudomonas aeruginosa from other Pseudomonas, including Pseudomonas fluorescens and Pseudomonas putida, and takes about 1 hour.

[0006] However, the prior art does not disclose the use of RPA-test strip technology to quickly detect Pseudomonas aeruginosa in drinking water, which is mainly based on fluorescent PCR technology or LAMP technology, both of which use fluorescent detection as the end point of judgment. The use of RPA-test strip detection is the detection of clinical samples, which are different from food samples and are more complex in food matrices.

[0007] Therefore, it is necessary to develop and promote a cheap, easy-to-operate method for detecting Pseudomonas aeruginosa that does not require the assistance of large equipment and whose results are easy to interpret, so as to facilitate enterprises to effectively control the risk of Pseudomonas aeruginosa contamination in the production process, thereby improving the safety of bottled drinking water and ensuring the drinking water safety of the general public. Summary of the invention

[0008] A lateral flow test strip detection technology for Pseudomonas aeruginosa has been developed based on recombinase polymerase amplification (RPA) technology. This technology has low detection cost and high speed. It does not require the assistance of large-scale detection equipment and only requires simple training for testers to complete the detection of Pseudomonas aeruginosa in packaged drinking water.

[0009] Different from the existing fluorescent PCR detection technology, the rapid detection method of Pseudomonas aeruginosa of the present invention is based on the RPA detection technology and uses the lateral flow test strip as the end point detection technology. It is cheap, easy to operate, does not require the assistance of large equipment, and the results are easy to interpret.

[0010] Through the research and development of the present invention, on the one hand, the present invention provides an RPA composition that can be used for rapid detection of Pseudomonas aeruginosa in drinking water, the composition comprising primers and probes, wherein the primers include upstream primers and downstream primer sequences, the sequence of the upstream primer is 5'-GGAGAATCCCAACGAAGCCAAGGCCGTGGTC-3', the sequence of the downstream primer is 5'-GGAGAGCGCCGGGTCCTTTTCCTGGCAATCG-3', and the sequence of the probe is 5'-[FAM]ATGTCCAGCGCGCCCTTGCGGCGGGTCATCT[THF]GCGCGCCTTGCGCGCGG-[C3spacer]-3'; wherein FAM is a FAM-labeled fluorescent group; THF is a tetrahydrofuran residue; and C3 Spacer is a C3 blocking group.

[0011] Furthermore, the 5' end of the upstream primer sequence contains biotin modification.

[0012] The primers and probes showed good inclusiveness and exclusivity, and the optimal reaction conditions of the primers were 36°C and 30 min. The sensitivity test results using the standard strain lysate as a template showed that the LOD of the rapid screening method of the present invention was 50 2.4x10 3 CFU / mL.

[0013] On the other hand, the present invention also provides a method for rapid detection of Pseudomonas aeruginosa in drinking water, the method comprising the following steps:

[0014] 1) Filter the water sample to be tested;

[0015] 2) Place the filter membrane in the culture medium and incubate for 6 hours;

[0016] 3) Collecting the bacteria to be detected in the filter membrane;

[0017] 4) Lysing the strain;

[0018] 5) performing RPA amplification using the RPA composition;

[0019] 6) taking the amplified product for lateral flow test strip detection;

[0020] 7) Determine the test result based on the color development.

[0021] Furthermore, the step of collecting the bacteria to be detected in the drinking water in step 1) includes the step of filtering the water sample to be detected; preferably, a hydrophilic microporous filter membrane with a pore size of 0.45 μm is used.

[0022] Furthermore, in step 4), 10% Chelex100 Tris-HCl at pH 8.0 is used for lysis.

[0023] In order to further apply this detection technology to the detection of Pseudomonas aeruginosa in bottled water, the present invention adopts a technical solution of enriching and culturing the bottled water for 6 hours after passing through the membrane and then performing RPA detection. Furthermore, through the spike experiment, the sensitivity of the detection of Pseudomonas aeruginosa in bottled water was tested by applying this technical solution. The results showed that the detection sensitivity LOD of this technical solution was 1.34%. 50 It is 3CFU / mL, which is consistent with the detection sensitivity of the national standard GB 8538.

[0024] Compared with the existing detection methods developed for Pseudomonas aeruginosa, the method of the present invention has the following advantages:

[0025] (1) The rapid screening detection technology for Pseudomonas aeruginosa developed by the present invention based on the RPA principle has the advantage of fast detection speed and only takes 20 min to complete the detection reaction compared with the rapid detection methods developed based on the PCR and LAMP principles;

[0026] (2) The present invention uses lateral flow test strip technology to determine the endpoint of the RPA reaction. Compared with the real-time RPA detection technology, the rapid detection method developed by the present invention does not require the assistance of large-scale equipment, and only requires a simple constant temperature incubation device to complete the amplification reaction. In the later stage, the test results can be determined by the naked eye;

[0027] (3) The primers and probes designed in the present invention are based on the gyrB (OR261077.1) gene as the target, which may be consistent with the detection target gene reported in other literature. However, the research results of the present invention show that even if the detection target gene is the same, the detection efficiency will show significant differences due to the different specific sequences targeted by the primers and probes, and the present invention has good tolerance, sensitivity and specificity;

[0028] (4) The sensitivity LOD of the detection method of the present invention 50 The sensitivity of the present invention is based on the estimated sensitivity LOD in the "Guidelines for Validation and Confirmation of Microbiological Detection Methods for Conformity Assessment" 50 The calculation table (Table 2) of the present invention is used to estimate the concentration of 3 CFU / mL. The actual test results show that even if there is only one Pseudomonas aeruginosa in the sample, the rapid test method developed by the present invention can also present a positive test result.

[0029] (5) The number and types of strains in the exclusive and inclusive tests are different. According to GB 4789.45-2023 General Rules for Validation of Microbiological Testing Methods for National Food Safety Standards, the present invention selects 30 strains of bacteria for testing in the inclusive and exclusive test bacteria. At the same time, when conducting the exclusive experiment, the present invention selects common contaminating bacteria in bottled water for testing, such as fecal streptococci, Escherichia coli, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : The working efficiency test results of two sets of primers and probes. A is the first test result; B is the second test result.

[0031] Figure 2 :Determination of the optimal reaction temperature. Among them, 1-7 represent different concentrations of bacterial lysate. 1, 3x10 5 CFU / mL; 2, 3x10 4 CFU / mL; 3, 3x10 3 CFU / mL; 4, 3x10 2 CFU / mL; 5, 3x10 1 CFU / mL; 6, 3CFU / mL; 7, 3CFU / 10mL; 8, negative control.

[0032] Figure 3 :Determination of the optimal reaction time. Among them, 1-7 represent different concentrations of bacterial lysate. 1, 3x10 5 CFU / mL; 2, 3x10 4 CFU / mL; 3, 3x10 3 CFU / mL; 4, 3x10 2 CFU / mL; 5, 3x10 1 CFU / mL; 6, 3CFU / mL; 7, 3CFU / 10mL; 8, negative control.

[0033] Figure 4 :Inclusiveness test of primers and probes. Among them, 1-8, standard strain of Pseudomonas aeruginosa (ATCC27853); 9-32, sample bacteria isolated from bottled water.

[0034] Figure 5:Exclusive test of primers and probes. Among them, 1-2, Staphylococcus aureus (ATCC25923); 3-4, Salmonella typhi (CMCC50071); 5-6, Pseudomonas fluorescens (CICC20066); 7-8, Pseudomonas putida (CGMCC1.2309); 9-10, Aeromonas azotocin (CICC23564); 11-12, Alcaligenes faecalis (CICC10981); 13-14, Escherichia coli (ATCC25922); 15-16, Bacillus mycoides (ATCC25922); CC10206); 17-18, Lactobacillus casei (CGMCC1.2435); 19-20, Bifidobacterium (CICC6069); 21-22, Listeria monocytogenes (ATCC19115); 23-24, Staphylococcus caprica (ATCC35538); 25-26, Vibrio parahaemolyticus (ATCC17802); 27-28, Bacillus licheniformis (ATCC12759); 29-30, Streptococcus faecalis (ATCC29212)

[0035] Figure 6 : Sensitivity testing of primers and probes. DETAILED DESCRIPTION

[0036] The present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments. It is to be understood that the specific embodiments described herein are only used to explain the present invention, rather than to limit the present invention. It should also be noted that, for ease of description, only the parts related to the present invention are shown in the accompanying drawings, rather than all.

[0037] Example 1: DNA extraction

[0038] 1.1 DNA extraction method of standard strains

[0039] Use standard strains for streaking culture, pick characteristic colonies, dilute in phosphate buffer, take 1mL of bacterial solution, centrifuge at 12000g for 10min to collect bacteria, and remove supernatant. Add 100μL of pathogenic bacteria nucleic acid extraction and lysis solution (10% Chelex100 Tris-HCl at pH8.0) to the precipitate, boil at 100℃ for 5min. Centrifuge at 1000g for 3min, take supernatant, use as RPA amplification template, and store at -20℃ for later use.

[0040] 1.2 DNA extraction method of Pseudomonas aeruginosa in drinking water

[0041] According to GB8538-2022 "National Food Safety Standard for Drinking Natural Mineral Water Test Method", a hydrophilic microporous filter with a pore size of 0.45 μm is used to retain the bacteria contained in the water on the filter membrane, and then the filter membrane is transferred to the CN agar medium and cultured at 36℃±1℃ for 0-10 hours. The filter membrane is rolled in a 2.0mL EP tube, and the filter membrane is rinsed with 500μL of lysis solution (10% Chelex100 Tris-HCl at pH8.0) for 3 minutes, and the lysis solution is aspirated, centrifuged at 5000g for 3 minutes, and the supernatant is taken for use.

[0042] Example 2: Design of primers and probes

[0043] The template sequences used in the primer design of the present invention are all from the National Center for Biotechnology Information (NCBI) database, and the primer design work is carried out using primer express software.

[0044] The gyrB gene (OR261077.1, NCBI) was selected as the detection target to design primers and probes. Primerexpress software was used to design primers, and the designed primers and probes were screened. Finally, two pairs of primers and probes that can specifically amplify Pseudomonas aeruginosa were obtained. The sequences of the primers and probes are shown in Table 1.

[0045] Table 1 Primer and probe sequences for RPA detection of Pseudomonas aeruginosa

[0046]

[0047] Subsequently, in order to further test the working efficiency of the two pairs of primers and probes in the table, the same concentration of templates were amplified using these two pairs of primers and probes in the same amplification system, and the end point was determined using the test strip reaction results. The results showed that under the same conditions, the functional efficiency of the first pair of primers and probes was higher than that of the second pair of primers and probes ( Figure 1 ), therefore, the first pair of primers and probes were selected as test objects in the subsequent examples.

[0048] Example 3: Reaction system and reaction conditions

[0049] 3.1 PCR reaction system

[0050] The RPA amplification reaction was carried out using the fast constant temperature amplification reagent (NFO) (YZL0110 Yizhi Technology). The specific reaction system and reaction conditions are as follows: RPA reaction buffer 29.4μL, upstream primer (10μM) 2μL, downstream primer (10μM) 2μL, probe (10μM) 0.6μL, ddH2O 12.5μL, magnesium acetate solution 2.5μL, Mg 2+ The final concentration is 14mM, and the template is 1μL. After the system is added, mix well, centrifuge, and react at 39℃ or 36℃ for 15-60mins. After the reaction is completed, take 10μL and add it to a centrifuge tube containing 190μL ddH2O. After mixing well, take 100μL and drop it into the sample well of the colloidal gold test strip (YZL0111 Yizhi Technology), and read the test results after 5min.

[0051] 3.2 Determination of the optimal reaction temperature

[0052] In order to obtain the optimal reaction temperature, the concentration of bacteria was 3x10 5 CFU / mL, 3x10 4 CFU / mL, 3x10 3 CFU / mL, 3x10 2 CFU / mL, 3x10 1 CFU / mL, 3CFU / mL, and 3CFU / 10mL of bacterial lysate were used for sensitivity testing. Under reaction conditions of 36°C and 39°C, the primers and probes obtained from the test screening were used to amplify the lysate with different bacterial concentrations. The amplification time was 15 minutes. The results are as follows: Figure 2 As shown in Figure 2, the sensitivity of RPA amplification reaction was basically the same under the reaction conditions of 36℃ and 39℃. When the bacterial concentration was 3x10 4 CFU / mL, the test results can be clearly seen. When the bacterial concentration is 3x10 3 CFU / mL, the test line is faintly visible.

[0053] 3.3 Determination of the optimal reaction time

[0054] In order to further determine whether extending the reaction time would increase the sensitivity of the RPA reaction, the amplification of the RPA reaction system on lysates of different bacterial concentrations was tested at 36°C and 39°C, and the reaction time was 30min and 60min. The specific results are as follows: Figure 3 As shown in A. When the reaction time was extended to 30 min, the reaction sensitivity increased. When the bacterial concentration was 3x10 3CFU / mL, the detection line was clearly visible, and the reaction sensitivity at 39℃ and 36℃ was basically the same, with no obvious difference. The reaction time was further extended to 60min, and the reaction sensitivity did not change significantly, still within 3x10 3 CFU / mL, the detection line can be observed, and the reaction sensitivity at 39℃ and 36℃ is basically the same ( Figure 3 (middle B).

[0055] Based on the above reaction results, it was finally determined that the optimal reaction temperature of the rapid screening detection technology for Pseudomonas aeruginosa based on RPA was 36°C and the optimal reaction time was 30 minutes. Based on the optimal reaction conditions, the sensitivity of the method will be tested later.

[0056] Example 4: Inclusion Test

[0057] According to the "GB4789.45-2023 General Rules for Validation of National Standard Microbiological Test Methods for Food Safety", inclusiveness test experiments were carried out on the designed primers and probes, and the standard strain Pseudomonas aeruginosa (ATCC27853) and Pseudomonas aeruginosa isolated from drinking water were selected for inclusiveness testing. Among them, 8 clones of the standard strain were selected for inclusiveness verification experiments, and 24 clones of Pseudomonas aeruginosa isolated from food were selected for inclusiveness verification experiments.

[0058] According to GB4789.45-2023 General Rules for Validation of National Food Safety Standard Microbiological Test Methods, the primers and probes obtained by screening were tested for inclusiveness using standard strains of Pseudomonas aeruginosa (ATCC27853) (No. 1-8) and Pseudomonas aeruginosa strains isolated from drinking water (No. 9-32). The results are as follows: Figure 4 The first pair of primers and probes screened by the present invention can effectively identify all strains of Pseudomonas aeruginosa, showing good inclusiveness.

[0059] Example 5: Exclusivity test

[0060] According to the "GB4789.45-2023 National Food Safety Standard Microbiological Test Method Validation General Rules", bacterial species closely related to Pseudomonas aeruginosa and fecal streptococci and other bacteria commonly detected in bottled water were selected for exclusive experiments. 30 non-target bacterial clones were selected for the exclusive experiment.

[0061] The samples were ① Staphylococcus aureus (ATCC25923), ② Salmonella typhi (CMCC50071), ③ Pseudomonas fluorescens (CICC20066), ④ Pseudomonas putida (CGMCC1.2309), ⑤ Aeromonas aeruginosa (CICC23564), ⑥ Alcaligenes faecalis (CICC10981), ⑦ Escherichia coli (ATCC25922), ⑧ Bacillus mycoides (ATCC10206), ⑨ Lactobacillus casei (CGMCC1.2435), ⑩ Bifidobacterium (CICC6069), Listeria monocytogenes (ATCC19115), Staphylococcus caprica (ATCC35538), Vibrio parahaemolyticus (ATCC17802), Bacillus licheniformis (ATCC12759) and Two strains of Streptococcus faecalis (ATCC29212) were used to perform exclusive tests on the primers and probes of Pseudomonas aeruginosa obtained by screening. The results were as follows Figure 5 The first pair of primers and probes obtained by screening have good exclusivity and have no cross reaction with all the test strains mentioned above.

[0062] Example 6: Sensitivity test

[0063] The standard strain was used as the test object. According to GB4789.45, 24 samples were used for sensitivity testing and the sensitivity was calculated. The specific process is as follows: Pseudomonas aeruginosa (ATCC27853) was used to prepare a bacterial suspension and the McFarland turbidity of the bacterial suspension was adjusted to 1. The bacterial suspension was diluted 10 times and the colony count of the dilution was performed. 10 -1 ~10 -10 1 mL of diluent was centrifuged at 12000 g for 10 min, the supernatant was removed, 100 uL of lysate was added, and the RPA template was prepared by boiling. The RPA experiment was carried out according to the reaction system in Example 3. Then, a bacterial lysate with an appropriate concentration (about the minimum detection template concentration) was selected, and 24 test reactions were carried out in parallel. The LOD was calculated using formula (1) 50 Calculation of the detection level at which 50% positive results are expected at a certain contamination level.

[0064]

[0065] In order to further test the detection performance of the developed rapid test method, the concentration of 3x10 2 CFU / mL standard strain lysate was used as RPA reaction template to test the sensitivity of the rapid test method. The number of test samples was 20, of which 2 were positive. Figure 6, LOD calculated by formula (1) 50 2.4x10 3 CFU / mL.

[0066] Example 7: Sensitivity test in bottled drinking water

[0067] After sterilizing the bottled water, add an appropriate amount of standard strain of Pseudomonas aeruginosa, and pre-treat the sample in accordance with "GB 8538-2022 National Food Safety Standard Test Method for Drinking Natural Mineral Water". After filtering the water, the filter membrane is incubated on CN agar medium for 6 hours, then rolled in a 2.0mL EP tube, and the filter membrane is rinsed with 500μL of lysis solution (10% Chelex100Tris-HCl at pH 8.0) for 3 minutes, then the lysis solution is aspirated, centrifuged at 5000g for 3 minutes, and the supernatant is used as a template for later use. And the sensitivity LOD is estimated in accordance with the "Conformity Assessment-Guidelines for Validation and Validation of Microbiological Detection Methods". 50 The calculation table (Table 2) estimates the LOD of the national standard method and the newly established RPA rapid detection technology 50 Each test method was repeated 3 times.

[0068] Table 2 Estimated LOD based on the number of positive results for each contamination level 50

[0069]

[0070] In order to further test the actual working performance of the method in the process of drinking water detection, a sensitivity test of Pseudomonas aeruginosa detection in bottled water was carried out. As the results of the sensitivity test experiment show, the LOD of the rapid screening detection method is 50 2.4x10 3 CFU / mL. Therefore, when conducting a sensitivity test for the detection of Pseudomonas aeruginosa in bottled water, it is necessary to culture the Pseudomonas aeruginosa enriched on the filter membrane to meet the national standard detection requirements.

[0071] A single clone of Pseudomonas aeruginosa was selected and placed in phosphate buffer to prepare a bacterial suspension with a McFarland turbidity of 1. After diluting the bacterial suspension 10-fold, 10 -7 (high level spike), 10 -7.5 (intermediate level spike) and 10 -8 (Low-level spike) 1 mL of the dilution solution was spiked according to Table 2, and each experiment was repeated 10 times. -8 The total number of colonies in the dilution was 3 CFU / mL. The experimental results are shown in Table 3. The estimated LOD of the national standard method was obtained according to Table 3 50 The estimated LOD of the RPA rapid test method is 3 CFU / mL.50 The estimated relative sensitivity of both methods is RLOD 1.

[0072] Table 3 LOD50 test results of national standard method and RPA test method

[0073]

[0074]

[0075] Note: m value is 3CFU / mL

[0076] The above content is a further detailed description of the present invention in combination with a specific preferred embodiment. It cannot be determined that the specific embodiments of the present invention are limited to this. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the protection scope of the present invention determined by the submitted claims.

Claims

1. A RPA composition for rapid detection of Pseudomonas aeruginosa in drinking water, characterized in that: The RPA composition comprises an upstream primer, a downstream primer and a probe for RPA amplification, wherein the sequence of the upstream primer is 5'-GGAGAATCCCAACGAAGCCAAGGCCGTGGTC-3', the sequence of the downstream primer is 5'-GGAGAGCGCCGGGTCCTTTTCCTGGCAATCG-3', and the sequence of the probe is 5'-[FAM]ATGTCCAGCGCGCCCTTGCGGCGGGTCATCT[THF]GCGCGCCTTGCGCGCGG[C3spacer]-3'; wherein FAM is a fluorescent group labeled with FAM; THF is a tetrahydrofuran residue; and C3 Spacer is a C3 blocking group.

2. The RPA composition according to claim 1, characterized in that: The 5' end of the upstream primer contains a biotin tag.

3. A method for rapid detection of Pseudomonas aeruginosa in drinking water, characterized in that: The method comprises the following steps: 1) Filter the water sample to be tested; 2) Place the filter membrane in the culture medium and incubate for 6 hours; 3) Collecting the bacteria to be detected in the filter membrane; 4) Lysing the strain; 5) performing RPA amplification using the RPA composition of claim 1 or 2; 6) taking the amplified product for lateral flow test strip detection; 7) Determine the test result based on the color development.

4. The method according to claim 3, characterized in that: In the step 4), 10% Chelex 100 Tris-HCl at pH 8.0 is used for lysis.

Images