Application of haplotype molecular marker of TaACO3 gene in assisting wheat stripe rust resistance breeding

Abstract

The invention provides application of a haplotype molecular marker of a TaACO3 gene in assisting wheat stripe rust resistance breeding, and belongs to the technical field of crop molecular breeding. The nucleotide sequence of the haplotype molecular marker disclosed by the invention is as shown in SEQ ID NO: 1; the 143rd site in the SEQ ID NO: 1 has insertion polymorphism of a nucleotide sequence as shown in SEQ ID NO: 2. The haplotype molecular marker is linked with the stripe rust resistant character of wheat, can be used for screening and identifying stripe rust resistant varieties of wheat, and provides an important technical means for improving the breeding efficiency of stripe rust resistant wheat.

Description

Technical Field

[0001] The invention belongs to the technical field of crop molecular breeding, and in particular relates to an application of a haplotype molecular marker of a TaACO3 gene in assisting wheat stripe rust resistance breeding. Background Art

[0002] Wheat is one of the most important food crops in the world and my country. Its global planting area is second only to corn and rice, and it provides food for about 35% of the world's population. Stripe rust is caused by Puccinia striiformis f.sp.tritici (Pst) and is one of the most serious diseases affecting wheat growth. The infection and spread of stripe rust can lead to a significant reduction in wheat yield and quality. In the field, stripe rust constantly mutates and produces new physiological subspecies, which can overcome the stripe rust resistance of long-term and monocultured disease-resistant varieties.

[0003] Carrying out disease-resistant breeding, selecting and planting disease-resistant varieties is the most economical, effective and environmentally friendly measure to control wheat stripe rust. In order to efficiently breed wheat varieties with stripe rust resistance and provide genetic resources for breeding wheat varieties with long-lasting and stable stripe rust resistance, it is necessary to discover more molecular markers to assist in stripe rust resistance wheat breeding. Summary of the invention

[0004] The purpose of the present invention is to provide a new application of a haplotype molecular marker of the TaACO3 gene, wherein the haplotype molecular marker of the TaACO3 gene is related to the disease resistance trait of wheat, thereby providing a new screening tool for disease-resistant wheat breeding.

[0005] The present invention provides an application of a haploid molecular marker of a wheat TaACO3 gene in assisting disease-resistant wheat breeding, wherein the nucleotide sequence of the haploid molecular marker is shown in SEQ ID NO: 1;

[0006] At position 143 in the SEQ ID NO: 1, there is an insertion polymorphism of a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 2.

[0007] Preferably, the nucleotide sequence of the haplotype molecular marker is shown as SEQ ID NO:3 or SEQ ID NO:4.

[0008] Preferably, the haplotype molecular marker is obtained by amplification of a primer pair;

[0009] The primer pair includes an upstream primer whose nucleotide sequence is shown as SEQ ID NO:5 and a downstream primer whose nucleotide sequence is shown as SEQ ID NO:6.

[0010] The present invention provides an application of a haploid molecular marker of a wheat TaACO3 gene in assisting disease-resistant wheat breeding, wherein the nucleotide sequence of the haploid molecular marker is shown in SEQ ID NO: 7;

[0011] The haplotype molecular markers include 15 SNP sites and 2 insertion mutation sites;

[0012] There is a C / T polymorphic site at the 177 bp position in the SEQ ID NO:7;

[0013] There is a T / C polymorphic site at 252 bp in the SEQ ID NO:7;

[0014] There is an A / T polymorphic site at 609 bp in the SEQ ID NO:7;

[0015] There is a G / C polymorphic site at the 651 bp position in the SEQ ID NO:7;

[0016] There is a C / G polymorphic site at 690 bp in the SEQ ID NO:7;

[0017] There is a T / G polymorphic site at 810 bp in the SEQ ID NO:7;

[0018] There is an A / C polymorphic site at 845 bp in the SEQ ID NO:7;

[0019] There is an insertion polymorphism of the nucleotide sequence shown in SEQ ID NO:8 at 1418 bp in the SEQ ID NO:7;

[0020] There is an A / G polymorphic site at 1435 bp in the SEQ ID NO:7;

[0021] There is a - / T polymorphic site at 1463 bp in the SEQ ID NO:7;

[0022] There is an A / G polymorphic site at 1482 bp in the SEQ ID NO:7;

[0023] There is a - / AG polymorphic site at 1502 bp in the SEQ ID NO:7;

[0024] There is a G / A polymorphic site at 1518 bp in the SEQ ID NO:7;

[0025] There is a T / C polymorphic site at 1644bp in the SEQ ID NO:7;

[0026] There is a C / T polymorphic site at 1670 bp in the SEQ ID NO:7;

[0027] There is an insertion polymorphism of the nucleotide sequence shown in SEQ ID NO: 2 at 1722 bp in the SEQ ID NO: 7;

[0028] There is a C / G polymorphic site at the 1791 bp position in the SEQ ID NO:7.

[0029] Preferably, the nucleotide sequence of the haplotype molecular marker is shown as SEQ ID NO:9 or SEQ ID NO:10.

[0030] Preferably, the haplotype molecular marker is amplified by a first primer pair, wherein the primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO:11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO:12.

[0031] Preferably, the assisted disease-resistant wheat breeding includes assisted screening of disease-resistant traits of wheat and / or identification of disease-resistant wheat germplasm resources.

[0032] Preferably, the disease resistance includes stripe rust.

[0033] The present invention provides a method for comparing disease resistance of different wheat varieties, comprising the following steps: using the primers in the application to perform PCR amplification on the genomic DNA of the wheat variety to be tested, to obtain a PCR amplification product;

[0034] Detecting the PCR amplification product to obtain the length of the PCR amplification product;

[0035] The disease resistance of the wheat variety to be tested is determined based on the length of the PCR amplification product:

[0036] The average disease resistance of wheat varieties with amplification product length of 560bp was better than that of wheat varieties with amplification product length of 285bp.

[0037] The present invention provides a method for screening disease-resistant wheat germplasm resources, comprising the following steps: using the primers in the application to perform PCR amplification on the genomic DNA of the wheat variety to be tested to obtain a PCR amplification product;

[0038] Detecting the PCR amplification product to obtain the length of the PCR amplification product;

[0039] Screening wheat germplasm resources according to the length of the PCR amplification product of the wheat variety to be tested:

[0040] Wheat varieties with amplification product length of 285 bp were eliminated, and wheat varieties with amplification product length of 560 bp were selected as disease-resistant wheat germplasm resources.

[0041] Beneficial effects:

[0042] The present invention provides an application of a haplotype molecular marker of a wheat TaACO3 gene in assisted disease-resistant wheat breeding. The haplotype molecular marker can be used to distinguish and / or identify the haplotype of the TaACO3 gene of wheat varieties in any period and any tissue, and detect whether the TaACO3 gene exists in each individual plant of the hybrid breeding generation and whether the TaACO3 gene is in a homozygous or heterozygous state. The method is convenient and fast, is not limited by weather and environmental conditions, and has high accuracy. The method can be used for the screening and identification of phenotypic traits including stripe rust resistance of wheat varieties, and provides an important technical means for molecular marker-assisted breeding of the TaACO3 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is a sequence alignment diagram of two haplotypes of TaACO3-Pro from common wheat;

[0044] Figure 2 This is the result of haplotype detection of 12 wheat varieties TaACO3 using haplotype molecular markers;

[0045] Figure 3 To detect the homozygous or heterozygous state of the haplotype of wheat variety TaACO3 using haplotype molecular markers;

[0046] Figure 4 This is a graph showing the difference in average disease index between Hap2 and Hap1 varieties. DETAILED DESCRIPTION

[0047] The invention provides an application of a haploid molecular marker of a wheat TaACO3 gene in assisting disease-resistant wheat breeding. The nucleotide sequence of the haploid molecular marker is shown in SEQ ID NO: 1 (5'-AGAAGGCAAGCCTTTTCTTACTAGTTCTCTCTCCTCCACCTCATTATTTATCCTACGT GGCACT[T / C]CTAAGATAGCATCATTGTATATGCC[C / T]TTAGGGTAAGCTACTTGAAGTTG CGGCCCTCACGCTGATCCGTTTAGCTAA[- / GGGCATGTACAATGGTCGATAAGGTAGTCTT ATCTTAAATCTTGCATGTAATTTAGAGATGACAAAAAAACATGTCTACAATGGGTCATCTCTTAGCCTTATCTTCAATAGCTAGTTATTCCTAAAAACATGGTGAGACATATTGTGCTAAGAGATCATCTCTTGCCTTCTCTTAATTAAGAG AAGACAAGCCTTATCTTATGATTTCTCTCTCCTCCACCTCATCATTTATCTTATGTGGCATTGCTAAGATAGAACCATTGTATATGCCCTAA]CTAACTGGGGCATATCTCGCTTGCTTTGGTCCCTACAGTTTTGTTTTGTACGTCCAGACA GCTTTGTTC[C / G]CCGTTCCATACTGACGATTGACCAAAGTGATTTATAACAAATTAAGCT GTGTCGTAATTTCCTACGTCCCGGC-3'); there is a nucleotide sequence at position 143 in SEQ ID NO:1 such as SEQ ID NO:2(GGGCATGTACAATGGTCGATAAGGTAGTCTTATCTTAAATCTTGCATGTAATTTAGAGA TGACAAAAAAACATGTCTACAATGGGTCATCTCTTAGCCTTATCTTCAATAGCTAGTTATTCCTAAAAACATGGTGAGACATATTGTGCTAAGAGATCATCTCTTGCCTTCTCTTAATTAAGAGAAGACAAGCCTTATCTTATGATTTCTCTCTCCTCCACCTCATCATTTATCTTATGTGGCATTGCTAAGATAGAACCATTGTATATGCCCTAA) Insertion polymorphism of the DNA fragment shown.

[0048] In the present invention, the nucleotide sequence of the haplotype molecular marker is as shown in SEQ ID NO:3 (AGAAGGCAAGCCTTTTCTTACTAGTTCTCTCTCCTCCACCTCATTATTTATCCTACGTG GCACTCCTAAGATAGCATCATTGTATATGCCTTTAGGGTAAGCTACTTGAAGTTGCGGCCCTCACGCTGATCCGTTTAGCTAAGGGCATGTACAATGGTCGATAAGGTAGTCTTATCTTAAATCTTGCATGTAATTTAGAGATGACAAAAAAACATGTCTACAATGGGTCATCTCTTAGCCTTATCTTCAATAGCTAGTTATTCCTAAAAACATGGTGAGACATATTGTGCTAAGAGATCATCTCTTGCCTTCTCTTAATTAAGAGAAGACAAGCCTTATCTTATGATTTCTCTCTCCTCCACCTCATCATTTATCTTATGTGGCATTGCTAAGATAGAACCATTGTATATGCCCTAACTAACTGGGGCATATCTCGCTTGCTTTGGTCCCTACAGTTTTGTTTTGTACGTCCAGACAGCTTTGTTCGCCGTTCCATACTGACGATTGACCAAAGTGATTTATAACAAATTAAGCTGTGTCGTAATTTCCTACGTCCCGGC) or SEQ ID NO:4 (AGAAGGCAAGCCTTTTCTTACTAGTTCTCTCTCCTCCACCTCATTATTTATCCTACGTG GCACTTCTAAGATAGCATCATTGTATATGCCCTTAGGGTAAGCTACTTGAAGTTGCGGCCCTCACGCTGATCCGTTTAGCTAACTAACTGGGGCATATCTCGCTTGCTTTGGTCCCTACAGTTTTGTTTTGTACGTCCAGACAGCTTTGTTCCCCGTTCCATACTGACGATTGACCAAAG TGATTTATAACAAATTAAGCTGTGTCGTAATTTCCTACGTCCCGGC).

[0049] In the present invention, the nucleotide sequence of SEQ ID NO:3 represents the TaACO3 gene haplotype Hap2, and its nucleotide sequence length is 560bp, which is related to the wheat stripe rust resistance trait. The nucleotide sequence shown in SEQ ID NO:4 represents the TaACO3 gene haplotype Hap1, and its nucleotide sequence length is 285bp, which is related to the wheat stripe rust trait. The haplotype molecular marker is preferably amplified by the first primer pair. The first primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO:5 (5'-AGAAGGCAAGCCTTTTCTTACTAG-3') and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:6 (5'-GCCGGGACGTAGGAAATTACG-3'). The present invention has no special restrictions on the source of the primer pair, and the primer pair well known in the art can be used. In an embodiment of the present invention, the primer pair is commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0050] In the present invention, the first primer pair is used in assisting disease-resistant wheat breeding. The first primer pair amplifies the haplotype molecular marker of wheat. When the sequence length of the amplified product is 560 bp, the TaACO3 gene haplotype of the wheat variety to be tested is Hap2, which has a strong resistance to stripe rust, and the wheat variety is selected as a breeding material for disease-resistant wheat breeding; when the sequence length of the amplified product is 285 bp, the TaACO3 gene haplotype of the wheat variety to be tested is Hap1, and the wheat variety to be tested is eliminated.

[0051] In one embodiment of the present invention, the stripe rust resistance of 154 wheat varieties was identified based on the haplotype molecular markers, of which there were 49 Hap1-type wheat varieties and 105 Hap2-type wheat varieties. Combined with the results of wheat stripe rust phenotypic identification, it was shown that the varieties containing Hap2 (average disease index of 15.37 for 105 varieties) were significantly lower than those containing Hap1 (average disease index of 45.01 for 49 varieties). At the same time, the stripe rust infection type analysis of different varieties found that most of the wheat varieties containing TaACO3-Hap1 were susceptible to stripe rust, and the wheat varieties containing TaACO3-Hap2 were resistant to stripe rust. When screening disease-resistant wheat germplasm resources, wheat varieties containing TaACO3-Hap1 can be eliminated, and wheat varieties containing TaACO3-Hap2 can be selected as disease-resistant wheat germplasm resources. Therefore, the haploid molecular markers of the present invention are linked to the wheat stripe rust resistance trait and can be used for screening and identifying wheat varieties with stripe rust resistance, improving wheat breeding efficiency and providing an important technical means for assisting disease-resistant wheat breeding.

[0052] The invention provides an application of a haplotype molecular marker of a wheat TaACO3 gene in assisting disease-resistant wheat breeding. The nucleotide sequence of the haplotype molecular marker is shown in SEQ ID NO:7 (5'-CTTTTCTTGAGGGAAAGGGCAGCCCCTTCTTTCTTCTTTTTTTTAGGGAAAGGGCAG CCCCTTCTATCCTTCGCGCTTGGAGGAAAGTCGAGATACTAGATCCGTCCAATTGTAAGG GCATGTTCGTAGTTCTAAACCGATAATTTAACTAGCTAAACATGTGTTATATTTTTTGA[C / T]GAATGGTGGATTTTATTGACTCGAAATGACGCATCAAATGGAAACAAACACAATGAGTACATATCCAGTCATCG[T / C]ATAGCTAGGATGCACACGGCCAATATAAACGCACACACACA AATAACACACACTGGCAAATACATGTTATATGTGACAAAATATGTGTTTAGAAATCACATTTGTATATGAATACAAAAATATGCTTTTCGTAAATTAAAAAAATTGCTTTCCGTGACGGATAAGACATATTTGGTTAGTAAAGTTGATGACCTAAAACCGCACGCGAGGAAGATTAGGCAGCGCTTGTTGGCTAATTTCATGGGGCTGTCTTC TCTCAGGGCTGTTATTCTCCCGACTGAAATACCAGTCCGGAGGGAGTAGCTAACTTTTGGCTTGCTAATTTGATTCCCACTAGAGGTGGCCGAGTCATGTCA[A / T]GATGTGCTCGATCGTGATAGAACTCGATCCTTTCTTTTTCC[G / C]TGCCTCCATCCGATGGTCTTTGGAACTGCTGGAGATAA[C / G]TTTTCGGACAATGCCAT GGGTCCTGGTGACTGGAGAAGGGAACTTTAACCCGACCCCTACCATGAGGGACAAAGG AGAAAGGAAAGGTTACACTAGGGAGGAGGGAGAGAGAGACCA[T / G]CGATGACGAAGACGCTAGCTCGAGCTGTCCATCG[A / C]TGAGTCGGTCTGGGACATGGCCGGGGTCTGGCGGTCCAGCTGCAAAGCACCATGAAGCTTTGATGCGTACAGGAGTGCAGCAACTTCTGCTCGCATTCCCGCTTTTGTGTCGACGGGCACACAGTAGTCTGGGCAATAAGTGATCTGCATGCCATTTAGCTACTGCTGCTGGCTGTCGCTGAGTAGGACAGACAGCGCTGATCCTGGTAGACACCCGAAATTACAAGCTTTAGACAAGGTGTACGTGCCATGTTTCAGACACAATCGACCGGTGTCCCCGGACAGCAGCAGTCAAATTGATCGATGTTGAAGGAGTACCATCTATTTGTTGACAGCAAAACTCCACTATAAGTGGCCTGGGTCAGGTGTACTAGGCCTAATCTCTGTCATTATCAACGTGTAAAGTAAGGGACAACTCCATCCGTACGCCACAAAGTTCATCAACACTGGCTACTTGCCCGCTTAGATTTAGGTATATAGAATAGTGGCCAACGTAGACTATCAGCCTAGTACTTATCAGACTGCTCCGTCTCCATCAGGGCATATTAGCTAGCAAGAAGCGATATTCTTGG[- / AGACAACTTGG]TTAGGGCATGTACAATG[A / G]TTGATAAGATGGTCTTATC TTAAGTTT[- / T]ATATGTAATTTACAGATGA[A / G]AAAAAAAGATGTCTATAAT[- / AG]GTCA TTTCTTAGTCTT[G / A]TCTTCAATAACTAGTTATTCTTAAAAATATGGTGAGACATACTTGT CTTTTCTTAAATAAGAGAAGGCAAGCCTTTTCTTACTAGTTCTCTCTCCTCCACCTCATTA TTTATCCTACGTGGCACT[T / C]CTAAGATAGCATCATTGTATATGCC[C / T]TTAGGGTAAGCT ACTTGAAGTTGCGGCCCTCACGCTGATCCGTTTAGCTAA[- / GGGCATGTACAATGGTCGATAAGGTAGTCTTATCTTAAATCTTGCATGTAATTTAGAGATGACAAAAAAACATGTCTACAATGGGTCATCTCTTAGCCTTATCTTCAATAGCTAGTTATTCCTAAAAACATGGTGAGACATATTGTGCTAAGAGATCATCTCTTGCCTTCTC TTAATTAAGAGAAGACAAGCCTTATCTTATGATTTCTCTCTCCTCCACCTCATCATTTATCTTATGTGGCATTGCTAAGATAGAACCATTGTATATGCCCTAA]CTAACTGGGGCATATCTCGCTTGCTTTGGTCCCTACAGTTTTGTTTTGT ACGTCCAGACAGCTTGTTC[C / G]CCGTTCCATACTGACGATTGACCAAAGTGATTTATAA CAAATTAAGCTGTGTCGTAATTTCCTACGTCCCGGCCTTCTCCCTCGCGCGGTCGCGCCT ATAAATTGGGAACTCACGCCGGCCTCAGAGCGCACACACACTCTCTGCTTCAGCTAACC AGCACAAGCACACATACAGAG-3');

[0053] The haplotype molecular markers include 15 SNP sites and 2 insertion mutation sites; there is a C / T polymorphic site at the 177 bp in the SEQ ID NO: 7;

[0054] There is a T / C polymorphic site at 252 bp in the SEQ ID NO:7;

[0055] There is an A / T polymorphic site at 609 bp in the SEQ ID NO:7;

[0056] There is a G / C polymorphic site at the 651 bp position in the SEQ ID NO:7;

[0057] There is a C / G polymorphic site at 690 bp in the SEQ ID NO:7;

[0058] There is a T / G polymorphic site at 810 bp in the SEQ ID NO:7;

[0059] There is an A / C polymorphic site at 845 bp in the SEQ ID NO:7;

[0060] There is an insertion polymorphism of the nucleotide sequence shown in SEQ ID NO:8 (AGACAACTTGG) at 1418 bp in SEQ ID NO:7;

[0061] There is an A / G polymorphic site at 1435 bp in the SEQ ID NO:7;

[0062] There is a - / T polymorphic site at 1463 bp in the SEQ ID NO:7;

[0063] There is an A / G polymorphic site at 1482 bp in the SEQ ID NO:7;

[0064] There is a - / AG polymorphic site at 1502 bp in the SEQ ID NO:7;

[0065] There is a G / A polymorphic site at 1518 bp in the SEQ ID NO:7;

[0066] There is a T / C polymorphic site at 1644bp in the SEQ ID NO:7;

[0067] There is a C / T polymorphic site at 1670 bp in the SEQ ID NO:7;

[0068] There is an insertion polymorphism of the nucleotide sequence shown in SEQ ID NO: 2 at 1722 bp in the SEQ ID NO: 7;

[0069] There is a C / G polymorphic site at the 1791 bp position in the SEQ ID NO:7.

[0070] In the present invention, the haplotype molecular marker is preferably located in the region 2kb upstream of the TaACO3 gene, and the Gene ID of the TaACO3 gene in the Chinese Spring Genome Database is TraesCS6A02G325600. All mutation sites in the haplotype molecular marker are tightly linked, and the wheat varieties are divided into two haplotypes Hap2 and Hap1.

[0071]

[0072] In the present invention, the haplotype molecular marker is amplified by a second primer pair. The second primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 11 (CTTTTCTTGAGGGAAAGGGC) and a downstream primer having a nucleotide sequence as shown in SEQ ID NO: 12 (CTCTGTATGTGTGCTTGTGC). The present invention has no special restrictions on the source of the second primer pair, and a primer pair well known in the art can be used. In an embodiment of the present invention, the primer pair is commissioned to be synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0073] In the present invention, the second primer pair can amplify and sequence the haplotype molecular markers described in the above technical solution in wheat, and according to the sequencing results, the haplotypes of the promoter of the TaACO3 gene in the wheat variety are Hap1 and Hap2.

[0074] In another embodiment of the present invention, the haplotype molecular marker identification was used to identify the TaACO3 haplotype in 88 wheat varieties. The sequencing results showed that the difference sites of the two haplotypes were closely linked, and the haplotype molecular markers divided the wheat varieties into two haplotypes, Hap1 and Hap2. The sequence structure diagram of haplotypes Hap1 and Hap2 is shown in FIG. Figure 1 .Depend on Figure 1 It can be seen that the TaACO3-Pro gene includes 15 SNP sites and 2 insertion mutation sites, and each mutation site is closely linked. Analysis of the results of wheat stripe rust phenotypic identification showed that the average disease resistance of wheat varieties containing Hap2 is better than that of wheat varieties containing Hap1. Most varieties containing Hap1 are susceptible to stripe rust, and varieties containing Hap2 are more resistant to stripe rust. When screening disease-resistant wheat germplasm resources, varieties containing Hap1 can be eliminated, and wheat varieties containing Hap2 can be selected as disease-resistant wheat germplasm resources. Therefore, the haplotype molecular markers described in the present invention are linked to the wheat stripe rust resistance trait, which can be used for the screening and identification of wheat varieties with stripe rust resistance, improve wheat breeding efficiency, and provide important technical means for auxiliary disease-resistant wheat breeding.

[0075] In the present invention, the auxiliary disease-resistant wheat breeding preferably includes auxiliary screening of disease-resistant wheat and / or identification of disease-resistant wheat germplasm resources. The disease-resistant disease preferably includes stripe rust.

[0076] The present invention provides a method for comparing disease resistance of different wheat varieties, comprising the following steps: performing PCR amplification on genomic DNA of the wheat variety to be tested using the first primer in the application to obtain a PCR amplification product;

[0077] Detecting the PCR amplification product to obtain the length of the PCR amplification product;

[0078] The disease resistance of the wheat variety to be tested is determined based on the length of the PCR amplification product:

[0079] The average disease resistance of wheat varieties with amplification product length of 560bp was better than that of wheat varieties with amplification product length of 285bp.

[0080] The present invention provides a method for screening disease-resistant wheat germplasm resources, comprising the following steps: using the primers in the application to perform PCR amplification on the genomic DNA of the wheat variety to be tested to obtain a PCR amplification product;

[0081] Detecting the PCR amplification product to obtain the length of the PCR amplification product;

[0082] Screening wheat germplasm resources according to the length of the PCR amplification product of the wheat variety to be tested:

[0083] Wheat varieties with amplification product length of 285 bp were eliminated, and wheat varieties with amplification product length of 560 bp were selected as disease-resistant wheat germplasm resources.

[0084] The present invention uses the first primer in the application to perform PCR amplification on the genome DNA of the wheat variety to be tested to obtain a PCR amplification product.

[0085] The present invention does not specifically limit the method for extracting the genomic DNA of the wheat variety to be tested, and the conventional plant genomic DNA extraction method in the art or the commercial kit can be used for extraction. The present invention does not specifically limit the extraction tissue of the genomic DNA, and the genomic DNA extracted from any tissue of wheat at any period is suitable for this method. The reaction procedure of the PCR amplification of the present invention is preferably: 95°C pre-denaturation for 5min; 95°C pre-denaturation for 30s, 58°C annealing for 30s, 72°C extension for 40s, 35 cycles; 72°C extension for 5min. The total volume of the PCR amplification reaction system is preferably 20μl, including the following components: 1μL of 100ng / μL template DNA, 10μL of 2×3GTaqMasterMix, 0.4μL of each of 10μmoL / L upstream and downstream primers, and 8.2μL of ddH2O. After the amplification, the PCR product is obtained.

[0086] The PCR amplification product is detected to obtain the length of the PCR amplification product.

[0087] The present invention does not specifically limit the method for detecting the length of the PCR amplification product, and any conventional method for obtaining the length of the PCR amplification product in the art can be used, such as sequencing and electrophoresis. In the embodiment of the present invention, agarose gel electrophoresis is used for detection; the specific steps of the gel electrophoresis detection are not specifically limited, and the steps of conventional gel electrophoresis detection in the art can be used.

[0088] After obtaining the length of the PCR amplification product, the wheat germplasm resources are screened according to the length of the PCR amplification product of the wheat variety to be tested: wheat varieties with an amplification product length of 285 bp are eliminated, and wheat varieties with an amplification product length of 560 bp are selected as disease-resistant wheat germplasm resources.

[0089] The present invention utilizes the haplotype molecular marker to distinguish and / or identify the haplotype of the TaACO3 gene of wheat varieties in any period and any tissue, and detects whether the TaACO3 gene exists in each individual plant of the hybrid breeding generation and its homozygous or heterozygous state. The method is convenient and fast, is not limited by weather and environmental conditions, and has high accuracy. The haplotypes of the TaACO3 gene are haplotypes Hap1 and Hap2, which are very conservative in wheat and can be used for the screening and identification of phenotypic traits of stripe rust resistance in wheat varieties.

[0090] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0091] Example 1

[0092] Acquisition of TaACO3-Pro and analysis of TaACO3-Pro sequence

[0093] According to the Chinese Spring genome (Chinese Spring RefSeq v1.1, http: / / plants.ensembl.org / Triticum_aestivum / Info / Index), specific primers TaACO3-Pro-f / r (Table 1) were designed for the 2 kb sequence upstream of the TaACO3 (Gene ID: TraesCS6A02G325600) gene, and TaACO 3-Pro analysis was performed on 88 wheat varieties. Primers were designed using SnapGene 4.1.9 ( https: / / www.snapgene.com / ).

[0094] Table 1 Primer sequences used to amplify TaACO3-Pro

[0095]

[0096] Extraction of genomic DNA from wheat grains:

[0097] (1) Crush wheat seeds (about 1 g) with a hammer, place in a 2 mL centrifuge tube containing a 5 mm steel ball, mark the seed variety on the tube cap, add 700 μL of seed extract (prepared as follows), and place in a shaker at 37°C for 30 min. (Or place at 50-60°C for 30 min, but shake occasionally).

[0098] (2) The formula of wheat grain DNA extraction solution is shown in Table 2:

[0099] Table 2 Wheat grain DNA extraction solution formula

[0100] Components Original concentration Final concentration Dosage SDS 10％ 0.5％ 25mL NaCl 5M 288mM 28.8mL EDTA(pH8.0) 0.5M, pH 8.0 25mM 25mL Tris-HCl (pH 8.0) 1M, pH 8.0 200mM 100mL

[0101] (3) Add 700 μL of phenol:chloroform (1:1, volume ratio) reagent to the centrifuge tube, shake on a shaker for 10-20 min, and then centrifuge at 12000 rpm for 10 min.

[0102] (4) Transfer the supernatant (about 500 μL) to a 1.5 mL tube, add the same volume of chloroform:isoamyl alcohol (24:1, volume ratio), shake on a shaker for 10-20 min, and centrifuge at 12,000 rpm for 10 min.

[0103] (5) Pipette the supernatant into a new 1.5 mL tube, add 0.7 times the volume of pre-cooled isopropanol, mix well, and place at -20°C for 30 min.

[0104] (6) Centrifuge at 12,000 rpm for 10 min. Discard the supernatant and wash the precipitate with 70% alcohol.

[0105] (7) Repeat step 6.

[0106] (8) Discard the alcohol and place it in a ventilated place for 5-10 minutes to dry the alcohol. Finally, use an appropriate amount of sterile water to dissolve the DNA.

[0107] The DNA extracted by the above method was used as a template and PCR amplification was performed with the primers described in Table 1. The PCR reaction system was 20 μL, including 1 μL of template DNA, 10 μL of 2×3GTaqMasterMix premix (Nanjing Novozyme Biotechnology Co., Ltd.), 0.4 μL of upstream and downstream primers, and the mixture was made up to 20 μL with sterile water.

[0108] PCR reaction program: 95℃ pre-denaturation for 5min, 95℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension rate 1kb / min, 35 cycles; 72℃ extension for 5min, 4℃ storage. PCR products were separated by agarose gel electrophoresis and then cut and sent for testing. Sequencing was completed by Shanghai Shangya Gene Co., Ltd.

[0109] The sequencing results showed that the TaACO3-Pro gene of 88 wheat varieties was divided into two haplotypes, Hap2 and Hap1 (Table 3). Figure 1 .Depend on Figure 1 It can be seen that the TaACO3-Pro gene includes 15 SNP sites and 2 insertion mutation sites, and the mutation sites are closely linked.

[0110] Table 3 Statistics of TaACO3-Pro haplotypes of 88 varieties

[0111]

[0112]

[0113]

[0114] Example 2

[0115] Identification of haplotypes of common wheat variety TaACO3 using TaACO3-Pro-GSM and association analysis of resistance to stripe rust

[0116] In view of the results of Example 1, each mutation site in the TaACO3-Pro gene is closely linked to the wheat rust resistance trait, and the TaACO3-Pro gene contains an insertion site mutation TaACO3-Pro-GSM, so the insertion site mutation is also closely linked to the wheat rust resistance trait. Further, primers were designed based on the insertion site in the TaACO3 gene to verify the stripe rust resistance of different varieties of wheat.

[0117] The stripe rust mixed garden identification strains used for the test were the current main stripe rust species or pathogenic types, using 8 physiological species: CYR17, CYR25, CYR29, CYR30, CYR31, CYR32, CYR33, CYR34, etc. The stripe rust disease index and infection type evaluation were statistically analyzed in accordance with the national standard NY_T 2953-2016 Technical regulations for identification of stripe rust resistance in wheat regional trial varieties, "Standards for evaluation of wheat resistance to stripe rust".

[0118] Table 4 TaACO3-Pro-GSM primer sequences

[0119]

[0120]

[0121] DNA of different wheat varieties was used as template and PCR amplification was performed with the primers described in Table 4. The PCR reaction system was 20 μL, including 1 μL template DNA, 10 μL 2×3GTaqMasterMix premix (Nanjing Novozyme Biotechnology Co., Ltd.), 0.4 μL each of upstream and downstream primers, and the mixture was made up to 20 μL with sterile water.

[0122] PCR reaction program: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension rate 1 kb / min, 35 cycles; 72°C extension for 5 min, 4°C storage.

[0123] After the PCR products were separated by agarose gel electrophoresis, the haplotype of TaACO3 could be identified based on the band size. If the length of the amplified product was 560 bp, the haplotype of TaACO3 of the wheat variety to be tested was Hap2; if the length of the amplified product was 285 bp, the haplotype of TaACO3 of the wheat variety to be tested was Hap1.

[0124] The above method was used to amplify and analyze the haplotypes of the TaACO3 gene in 154 wheat varieties.

[0125] The results are shown in Tables 5 and 6. The gel electrophoresis results of some wheat varieties are shown in Figure 2 shown.

[0126] This molecular marker was used to identify TaACO3 haplotypes in 154 wheat varieties, including 49 Hap1 types and 105 Hap2 types.

[0127] According to molecular marker detection, the Hap2 excellent haplotype accounts for a larger proportion in the main cultivated varieties and backbone breeding parents that are widely promoted in my country's Huanghuai wheat region and the middle and lower reaches of the Yangtze River wheat region, which is the result of long-term selection by breeders.

[0128] Table 5 Statistics of TaACO3 gene haplotypes of 154 varieties

[0129]

[0130]

[0131]

[0132]

[0133]

[0134] Table 6 Statistics of TaACO3 gene haplotypes in 154 varieties

[0135]

[0136]

[0137] At the same time, the primers in Table 4 were used to identify the homozygous and heterozygous states of the TaACO3 haplotype of each plant in the wheat F2 segregating population. The parents of the F2 population were Kexing 3302 (Hap1) and Xinong 161 (Hap2), respectively. The results are as follows Figure 3 As shown, if there is an electrophoresis band with an amplification product length of 560bp, the TaACO3-Pro haplotype of the wheat plant to be tested is homozygous Hap2; if there is an electrophoresis band with an amplification product length of 285bp, the TaACO3-Pro haplotype of the wheat plant to be tested is homozygous Hap1; if there is an electrophoresis band with an amplification product length of 560bp and an electrophoresis band with an amplification product length of 285bp, the TaACO3-Pro haplotype of the wheat plant to be tested is a heterozygous haplotype.

[0138] Further correlation analysis was conducted on wheat stripe rust resistance and haplotype. Based on the stripe rust phenotypic identification results of varieties participating in the national Huanghuai South area variety comparison test in 2022-23, combined with the haplotype identification results of the TaACO3 gene in different varieties using the above detection method, statistical analysis showed that varieties containing Hap2 (average disease index of 105 varieties was 15.37) were significantly lower than varieties containing Hap1 (average disease index of 49 varieties was 45.01) ( Figure 4 ). At the same time, the stripe rust infection type analysis of different varieties found that all 20 stripe rust immune varieties were Hap2, 9 of the highly resistant varieties were Hap2, 1 was Hap1, and 14 of the medium resistant varieties were Hap2 and 2 were Hap1 (Table 7).

[0139] Table 7 Statistics on the number of 154 wheat varieties infected by different stripe rust types

[0140] Stripe rust infection type Hap1 Hap2 IM 0 20 HR 1 9 MR 2 14 MS 38 58 HS 8 4

[0141] Through the correlation analysis between wheat stripe rust resistance and haplotype, the following conclusions were drawn: Hap2 type varieties are more resistant to stripe rust. The molecular markers of the present invention can identify the haplotypes of the TaACO3 gene of wheat varieties, and assist in screening wheat varieties with different haplotypes and stripe rust resistance. This detection method is convenient, fast, and highly accurate, providing an important technical means for molecular marker-assisted breeding of the TaACO3 gene.

[0142] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of a haploid molecular marker of wheat TaACO3 gene in assisted disease-resistant wheat breeding, the nucleotide sequence of the haploid molecular marker is shown in SEQ ID NO: 1; At position 143 in the SEQ ID NO: 1, there is an insertion polymorphism of a DNA fragment with a nucleotide sequence as shown in SEQ ID NO:

2.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the haplotype molecular marker is shown as SEQ ID NO: 3 or SEQ ID NO:

4.

3. The application according to claim 2, characterized in that: The haplotype molecular marker is obtained by amplification of the first primer pair; The first primer pair includes an upstream primer whose nucleotide sequence is shown as SEQ ID NO:5 and a downstream primer whose nucleotide sequence is shown as SEQ ID NO:

6.

4. Application of a haploid molecular marker of wheat TaACO3 gene in assisted disease-resistant wheat breeding, the nucleotide sequence of the haploid molecular marker is shown in SEQ ID NO: 7; The haplotype molecular markers include 15 SNP sites and 2 insertion mutation sites; There is a C / T polymorphic site at the 177 bp position in the SEQ ID NO:7; There is a T / C polymorphic site at 252 bp in the SEQ ID NO:7; There is an A / T polymorphic site at 609 bp in the SEQ ID NO:7; There is a G / C polymorphic site at the 651 bp position in the SEQ ID NO:7; There is a C / G polymorphic site at 690 bp in the SEQ ID NO:7; There is a T / G polymorphic site at 810 bp in the SEQ ID NO:7; There is an A / C polymorphic site at 845 bp in the SEQ ID NO:7; There is an insertion polymorphism of the nucleotide sequence shown in SEQ ID NO:8 at 1418 bp in the SEQ ID NO:7; There is an A / G polymorphic site at 1435 bp in the SEQ ID NO:7; There is a - / T polymorphic site at 1463 bp in the SEQ ID NO:7; There is an A / G polymorphic site at 1482 bp in the SEQ ID NO:7; There is a - / AG polymorphic site at 1502 bp in the SEQ ID NO:7; There is a G / A polymorphic site at 1518 bp in the SEQ ID NO:7; There is a T / C polymorphic site at 1644bp in the SEQ ID NO:7; There is a C / T polymorphic site at 1670 bp in the SEQ ID NO:7; There is an insertion polymorphism of the nucleotide sequence shown in SEQ ID NO: 2 at 1722 bp in the SEQ ID NO: 7; There is a C / G polymorphic site at the 1791 bp position in the SEQ ID NO:

7.

5. The application according to claim 4, characterized in that: The nucleotide sequence of the haplotype molecular marker is shown as SEQ ID NO:9 or SEQ ID NO:

10.

6. The use according to claim 4, characterized in that: The haplotype molecular marker is amplified by a second primer pair, wherein the second primer pair comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO:11 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO:

12.

7. The use according to any one of claims 1 to 6, characterized in that: The assisted disease-resistant wheat breeding includes assisted screening of disease-resistant traits of wheat and / or identification of disease-resistant wheat germplasm resources.

8. The use according to claim 7, characterized in that: The disease resistance includes stripe rust.

9. A method for comparing disease resistance of different wheat varieties, characterized in that: The method comprises the following steps: using the first primer in the application of claim 3 to perform PCR amplification on the genomic DNA of the wheat variety to be tested to obtain a PCR amplification product; Detecting the PCR amplification product to obtain the length of the PCR amplification product; The disease resistance of the wheat variety to be tested is determined based on the length of the PCR amplification product: The average disease resistance of wheat varieties with amplification product length of 560bp was better than that of wheat varieties with amplification product length of 285bp.

10. A method for screening disease-resistant wheat germplasm resources, characterized in that: The method comprises the following steps: using the first primer used in the application of claim 3 to perform PCR amplification on the genomic DNA of the wheat variety to be tested to obtain a PCR amplification product; Detecting the PCR amplification product to obtain the length of the PCR amplification product; Screening wheat germplasm resources according to the length of the PCR amplification product of the wheat variety to be tested: Wheat varieties with amplification product length of 285 bp were eliminated, and wheat varieties with amplification product length of 560 bp were selected as disease-resistant wheat germplasm resources.

Images