Application of overexpressed miR-423-3p aging mesenchymal stem cell-derived exosome in preparation of myocardial infarction protection drugs

Abstract

The invention provides application of exosomes from senescence mesenchymal stem cells overexpressing miR-423-3p in preparation of myocardial infarction protection drugs, and the miR-423-3p which is obviously differentially expressed between exosomes from young and senescence bone marrow mesenchymal stem cells (hBMSCs) is screened out, so that the miR-423-3p can be used for preparing the myocardial infarction protection drugs, and the miR-423-3p can be used for preparing the myocardial infarction protection drugs. The protection capability of the exosome for the heart after myocardial infarction is effectively improved in a manner of overexpressing miR-423-3p from the aging mesenchymal stem cell-derived exosome, the heart function is improved, the apoptosis of hypoxia myocardial cells is inhibited, and the treatment effect of the aging stem cell-derived exosome for treating myocardial infarction is improved.

Description

Technical Field

[0001] The present invention specifically relates to the field of biomedicine technology, and in particular to the use of exosomes derived from aged mesenchymal stem cells that overexpress miR-423-3p in the preparation of myocardial infarction protective drugs. Background Art

[0002] Cardiovascular disease now ranks first in the cause of death from disease among urban and rural residents in my country, posing a serious burden on public health and social economy. End-stage cardiovascular disease refers to severe impact or damage to the heart or vascular system, which has reached the advanced stage and is often associated with severe symptoms such as heart failure, myocardial infarction, and stroke. These conditions may be the result of long-term accumulation or may be caused by acute events. The treatment of end-stage cardiovascular disease usually focuses on relieving symptoms, alleviating pain, managing complications, and prolonging the patient's survival time and improving the quality of life as much as possible.

[0003] Autologous stem cell transplantation is a very promising alternative treatment for end-stage cardiovascular disease. Exploring the optimization scheme of autologous stem cell therapy is of great significance in clinical treatment. In addition to the application risks of mesenchymal stem cells themselves, the quality of mesenchymal stem cells isolated and extracted from aging individuals with poor objective conditions is poor. After several passages, they are very likely to undergo significant replicative aging, which greatly reduces the efficacy of autologous stem cell transplantation. Exosomes are a type of vesicle structure that is widely present in organisms, also known as small extracellular vesicles (EVs). Using derived exosomes instead of stem cells for treatment can reduce immunogenicity, improve body tolerance, and be easier to modify and optimize. However, the source of aging will also greatly affect the final therapeutic effect of exosomes. Therefore, finding an effective optimization method is of great significance to the development of clinical treatment. Summary of the invention

[0004] The present invention provides the use of exosomes derived from aged mesenchymal stem cells that overexpress miR-423-3p in the preparation of a myocardial infarction protective drug. The main technical problem to be solved is to screen out miR-423-3p that is significantly differentially expressed between exosomes derived from young and aged bone marrow mesenchymal stem cells (hBMSCs), and to effectively improve the protective ability of the heart after myocardial infarction, improve cardiac function, inhibit apoptosis of hypoxic cardiomyocytes, and improve the therapeutic effect of exosomes derived from aged stem cells in the treatment of myocardial infarction by overexpressing miR-423-3p in exosomes derived from aged bone marrow mesenchymal stem cells.

[0005] In order to achieve the above object, the technical solution provided by the present invention is as follows:

[0006] Application of exosomes derived from aged mesenchymal stem cells overexpressing miR-423-3p in the preparation of myocardial infarction protective drugs.

[0007] Furthermore, the exosomes derived from aged mesenchymal stem cells that overexpress miR-423-3p are obtained by electroporation drug loading to overexpress miR-423-3p in exosomes derived from aged bone marrow mesenchymal stem cells.

[0008] Furthermore, the method for preparing exosomes derived from aged bone marrow mesenchymal stem cells includes: isolating hBMSCs samples by the adhesion method, using P12-P15 cells as aged bone marrow mesenchymal stem cells, culturing them in a special culture medium without extracellular vesicles, and then isolating exosomes derived from aged bone marrow mesenchymal stem cells from the cell culture supernatant by ultracentrifugation.

[0009] Furthermore, the drug is used to increase the expression of miR-423-3p in cardiomyocytes.

[0010] Furthermore, the drug is used to increase the amplitude of cardiac ventricular wall activity.

[0011] Furthermore, the drug is used to increase the thickness of the heart's ventricular wall.

[0012] Furthermore, the drug is used to reduce the degree of ventricular fibrosis of the heart.

[0013] Furthermore, the drug is used to enhance the protective ability of myocardial cells.

[0014] Furthermore, the drug is used to reduce apoptosis of cardiomyocytes.

[0015] Furthermore, the drug is used to up-regulate bcl-2 and down-regulate caspase-3 and p53 in cardiomyocytes.

[0016] The present invention obtains early and late generation human bone marrow mesenchymal stem cells by culture through the adherence method, and proves that bone marrow mesenchymal stem cells gradually age with cell passage through cell senescence SA-β-Gal staining and EdU-555 cell staining detection.

[0017] The present invention separates exosomes derived from human bone marrow mesenchymal stem cells from cell culture supernatant by ultracentrifugation and stores the exosomes at -80°C.

[0018] The present invention screened exosome samples from young and old bone marrow mesenchymal stem cells by miRNA high-throughput sequencing technology, and obtained a total of 16 significantly differentially expressed miRNAs, namely let-7e-5p, miR-1271-5p, miR-184, miR-194-5p, miR-222-3p, miR-23a-3p, miR-23b-3p, miR-3184-5p, miR-369-3p, miR-378a-3p, miR-423-3p, miR-451a, miR-744-5p, miR-92a-3p, miR-146b-5p and miR-372-3p. After multiple verifications and comprehensive comparisons, miR-423-3p was determined as the modification target for exosomes.

[0019] The present invention uses electroporation to overexpress miR-423-3p in exosomes derived from aged bone marrow mesenchymal stem cells, and uses small animal echocardiography, cardiac injury assessment, Masson staining, flow cytometry and other methods to prove that exosomes derived from aged mesenchymal stem cells overexpressing miR-423-3p can improve the protection against myocardial infarction by inhibiting myocardial cell apoptosis.

[0020] The present invention also demonstrated that exosome therapy and miR-423-3p modification would not cause obvious immune damage to mice and had good biosafety by measuring the contents of alanine aminotransferase, aspartate aminotransferase and urea nitrogen in mouse serum and HE staining of multiple organ sections.

[0021] The present invention also provides the most likely downstream regulatory gene FAM222B of miR-423-3p, and uses protein interaction network analysis to confirm Taok2, which is most closely connected to it downstream, and the MAPK signaling pathway in which it is located, laying the foundation for further pathway mining.

[0022] Beneficial Effects

[0023] miRNA is a type of non-coding RNA with a length of about 23 nucleotides. It is widely present in cells. Its essence is a molecular messenger that regulates gene expression by inhibiting mRNA translation or inducing degradation. Compared with mRNA and other non-coding RNAs, miRNA not only has a smaller molecular size and precise regulatory ability, but also can guide complex cell pathways by regulating the expression of multiple target genes, which makes miRNA stand out in the research related to RNA modification.

[0024] The present invention uses electroporation drug loading to make exosomes derived from aged bone marrow mesenchymal stem cells overexpress miR-423-3p, which can effectively improve their protective ability to the heart after myocardial infarction, reduce cardiac damage, improve cardiac function, reduce tissue fibrosis, enhance cardiomyocyte vitality, inhibit hypoxic cardiomyocyte apoptosis, and improve the therapeutic effect of exosomes derived from aged stem cells in the treatment of myocardial infarction. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Identification of bone marrow mesenchymal stem cells. (a) Flow cytometry identification of surface markers of bone marrow mesenchymal stem cells; red is the negative control, blue is the expression intensity of the corresponding surface markers, and the numbers above the figure are the percentages of cells around the positive dividing line (%). (b) Staining of the three-line differentiation ability of young and aged bone marrow mesenchymal stem cells; red is calcium nodules in osteogenic differentiation, red is lipid droplets in adipogenic differentiation, and blue is cartilage tissue in chondrogenic differentiation. The osteogenic and chondrogenic abilities of aged cells are weakened, and the adipogenic ability is enhanced.

[0026] Figure 2 The following are the changes in bone marrow mesenchymal stem cells as they age. (a) Morphological characteristics of bone marrow mesenchymal stem cells with different degrees of aging under a light microscope. (b) SA-β-Gal staining of young and aged bone marrow mesenchymal stem cells; SA-β-Gal expression levels are positively correlated with dark blue deposits. The cytoplasm of aged cells is sparse and deformed, with more blue staining. (c) Representative images of EdU staining comparison of young and aged bone marrow mesenchymal stem cells; red fluorescence is newly synthesized DNA during proliferation, blue fluorescence is the cell nucleus, and the relative proliferation capacity of aged cells is reduced. (d) Quantitative analysis of EdU staining comparison of young and aged bone marrow mesenchymal stem cells.

[0027] Figure 3 Expression validation of 16 differentially expressed miRNAs.

[0028] Figure 4 The relative expression levels of miR-423-3p in cardiomyocytes after treatment in different groups. (a) Schematic diagram of electroporation. (b) Quantitative analysis of relative expression levels.

[0029] Figure 5 The changes in cardiac function of mice in different groups after 28 days of treatment. (a) Changes in ventricular wall motion of mice at 28 days. (b) Changes in left ventricular ejection fraction and fractional shortening of mice at 28 days; * and # indicate that the corresponding groups were compared with the PBS group.

[0030] Figure 6Changes in the hearts of mice 28 days after treatment in different groups. (a) The degree of heart damage in mice with myocardial infarction 28 days after treatment in different groups; (b) Representative images of Masson staining of heart sections of mice 28 days after treatment in different groups; blue is collagen fiber and red is muscle fiber. (c) Quantitative analysis of Masson staining of heart sections of mice 28 days after treatment in different groups.

[0031] Figure 7 The following are the changes of hypoxic cardiomyocytes after treatment in different groups. (a) Comparison of apoptosis ratio of hypoxic cardiomyocytes; the horizontal and vertical axes are the corresponding fluorescence intensity, and the red numbers represent the percentage of cells in this quadrant (%). In the scatter plot, the lower right quadrant marked by the red frame is the early apoptotic cells, the lower left is the normal living cells, the upper right is the necrotic and late apoptotic cells, and the upper left is the cell debris and other errors. (b) Quantitative analysis of apoptosis ratio. (c) Relative cell viability of hypoxic cardiomyocytes. (d) Expression levels of apoptosis-related markers in cardiomyocytes.

[0032] Figure 8 The biosafety verification of different groups after 28 days of treatment. (a) HE staining of the main organs of mice; hematoxylin staining and eosin staining stain the nucleus and cytoplasm respectively. (b) Comparison of GPT, GOT activity and BUN content in fasting plasma of mice.

[0033] Fig. 9 Analysis and verification of downstream target genes of miR-423-3p. (a) FAM222B mRNA and miR-423-3p are highly paired; 8mer means that FAM222B and the seed sequence of miR-423-3p are highly paired, context score is the binding site score, and context score percentile is the binding site score percentage. (b) Protein interaction network (PPI) diagram; each ball in the figure represents a protein, each line represents a connection relationship, and the inner circle is the protein that is most closely connected to FAM222B. (c) RT-qPCR verification of miR-423-3p downstream regulated gene expression;

[0034] Note: ns means no statistical difference, * and # mean p<0.05, ** and ## mean p<0.01, *** and ### mean p<0.001, **** and #### mean p<0.0001. DETAILED DESCRIPTION

[0035] (1) BMSC sample acquisition and phenotypic identification

[0036] The BMSC samples in the bone marrow blood were isolated and cultured using the adherence method. First, the cloudy bone marrow mononuclear cells were separated by lymphocyte separation solution, transferred to a new sterile centrifuge tube containing 10mL PBS for washing, centrifuged at 400g for 5min, and the supernatant was discarded. After repeated washing, complete culture medium was added to resuspend the cells, and the cells were evenly blown and planted in a culture dish. They were cultured in a 37°C carbon dioxide constant temperature incubator, and the medium was replaced by half every 3-4 days until the adherent hBMSCs had a clear morphology. They were then passaged every 3 days. P2-P5 cells were used as early-generation young cells, and P12-P15 cells were used as late-generation senescent cells. The aging phenotype was verified based on the cell status and aging-related staining. The cell morphology of hBMSCs at different generations was observed under an inverted phase contrast microscope under a light microscope. The experimental results are shown in the figure. Figure 2 As shown in the figure, it was found that with the passage, the hBMSCs cell body became larger, the morphology tended to be irregular, the growth density decreased, and the growth rate slowed down. The above results indicate that the cells showed a clear aging trend with in vitro expansion and passage. The cell markers on the surface of BMSCs were identified by flow cytometry. The digested cells were resuspended in PBS to prepare a cell suspension, and the corresponding fluorescent antibodies and isotype controls were added. The cells were incubated in the dark for 30 minutes. After the incubation, they were fully washed with PBS and resuspended again, and flow cytometry was performed on the machine. The experimental results are shown in the figure. Figure 1 As shown in the figure, it was found that the isolated cells highly expressed CD73, CD90, CD29 and CD105 on their surface, and lowly expressed CD11b, CD19, CD45, CD31, CD34 and HLA, proving that the isolated cells are indeed typical bone marrow mesenchymal stem cells. The three-line differentiation ability of BMSC was verified, and the experimental results are as follows Figure 1 As shown in Figure 2, it was found that the isolated BMSCs have typical tri-lineage differentiation potential, but the osteogenic and chondrogenic abilities of aging cells are weakened, and the adipogenic ability is enhanced. By comparing the SA-β-Gal staining results of young and aging BMSCs, the experimental results are as follows Figure 2 As shown in the figure, the cytoplasm of senescent cells was found to be sparse and deformed, and the dark blue deposits increased significantly. The above results show that the degree of senescence of cells in the senescent group is very significant. By comparing the EdU proliferation staining results of young and senescent BMSCs, the experimental results are as follows Figure 2 As shown in the figure, the red fluorescence of senescent cells is significantly less than that of young cells, the blue nuclei are arranged more sparsely, the ratio of red fluorescence to blue fluorescence decreases, and the EdU + The proportion of cells is about 5%, while the EdU + The cell ratio is about 15%, indicating that the relative proliferation ability of senescent cells is weakened, and they have shown significant senescence characteristics with continuous expansion and passaging.

[0037] (2) Extraction and preservation of exosomes derived from bone marrow mesenchymal stem cells

[0038] First, ordinary fetal bovine serum was centrifuged in an ultracentrifuge at 4°C and 110,000g for 8 hours to remove the interference of extracellular vesicles inherent in fetal bovine serum. The extracellular vesicle-free serum obtained after centrifugation was mixed with serum-free complete medium at a ratio of 1:9 to obtain a special medium without extracellular vesicles. When the hBMSCs to be extracted reached about 60% confluence in the culture dish, the original bone marrow mesenchymal stem cell complete medium was removed, rinsed twice with PBS, and replaced with a special medium without extracellular vesicles heated in a 37°C water bath in advance. The cells were cultured for 24-48 hours depending on the cell growth rate, and the cell culture supernatant was collected in a 50mL centrifuge tube, and the cells were passaged normally. The collected cell culture supernatant was subjected to gradient centrifugation. The specific process was as follows: 4°C, 300g centrifugation for 10 min, remove the cells remaining in the supernatant, and take the supernatant after centrifugation to another 50mL centrifuge tube; 4°C, 2000g centrifugation for 10 min, remove the residual dead cells in the supernatant, and take the supernatant after centrifugation to another 50mL centrifuge tube; 4°C, 10000g centrifugation for 30 min, remove the residual cell debris and larger vesicles in the supernatant, and take the supernatant after centrifugation to another 50mL centrifuge tube. Filter the cell supernatant after gradient centrifugation with a 0.22μm filter head and keep it for the next step. The filtered cell culture supernatant was divided into ultracentrifuge tubes, and ultracentrifuged at 4°C, 110000g for 70min. After the centrifugation, the supernatant was discarded, and the sediment at the bottom of the centrifuge tube was resuspended with pre-cooled PBS, and ultracentrifuged again under the conditions of 4°C, 110000g, 70min. Discard the supernatant and resuspend the bottom precipitate with 100 μL pre-cooled PBS to obtain hBMSC-EVs with high purity. The excess vesicles are divided into 1.5 mL centrifuge tubes and frozen at -80 °C. Avoid repeated freezing and thawing when using. For the separated hBMSC-EVs, the concentration needs to be determined before freezing and marked on the wall of the centrifuge tube. The specific operation process is as follows: add the protein standard in the BCA protein concentration determination kit to a 96-well plate in a gradient of 0, 1, 2, 4, 8, 12, 16, and 20 μL, and make up each well with PBS to 20 μL, thereby obtaining a standard curve, and also add 20 μL of EVs sample to each well in the 96-well plate. Add 200 μL of the prepared BCA working solution to the standard and sample, and let it stand in a 37 °C electric constant temperature incubator for 30 min. After standing, quickly place it in a microplate reader to measure the absorbance at a wavelength of 562 nm. Calculate the protein concentration and total extraction volume of the hBMSC-EVs sample based on the measurement results and the drawn standard curve and mark them on the tube wall.

[0039] (3) High-throughput sequencing of miRNA and screening and verification of differentially expressed miRNA

[0040] Total RNA samples were extracted from exosomes to detect the total amount and fragment distribution of RNA. After sample quality inspection, SmallRNA Sample Pre Kit was used, with total RNA as the starting sample. The hydroxyl group at the 3' end of small RNA and the intact phosphate group at the 5' end were used to add adapters to both ends and reverse transcribe into cDNA. Then PCR amplification, PAGE gel electrophoresis to separate the target fragments, and gel cutting and recovery were performed to obtain the constructed library. After the library construction was completed, the Qubit2.0 fluorescence quantification instrument was used for preliminary quantification, the library was diluted to 1 ng / μL, and the highly sensitive Agilent 2100 bioanalyzer was used to detect whether the insert fragment size of the library met expectations. In order to ensure the quality of the library, the effective concentration of the library was accurately quantified by qPCR. Different libraries were mixed according to the effective concentration and target data volume requirements and then sequenced by Illumina SE50. The screening criteria for differential miRNAs were |log2FC|≥1 and p<0.05. The results of the RT-qPCR verification experiment were as follows Figure 3 As shown in the figure, a total of 16 significantly differentially expressed miRNAs were obtained, namely let-7e-5p, miR-1271-5p, miR-184, miR-194-5p, miR-222-3p, miR-23a-3p, miR-23b-3p, miR-3184-5p, miR-369-3p, miR-378a-3p, miR-423-3p, miR-451a, miR-744-5p, miR-92a-3p, miR-146b-5p and miR-372-3p. After multiple RT-qPCR validations and comprehensive comparisons, miR-423-3p (sequence: AGCUCGGUCUGAGGCCCCUCAGU) was determined as the modification target for exosomes.

[0041] (4) Electroporation drug delivery

[0042] Pre-clean and disinfect the electroporation cup to be used with 75% ethanol solution, discard the 75% ethanol solution, and place it in a clean bench under ultraviolet light for 30 minutes. For each separate electroporation, take 100 μg of hBMSC-EVs suspension frozen at -80°C, mix it with 100 pmol of miRNAs to be transferred, make up the system to 100 μL with OPTI-MEM, and add it to the electroporation tank at the bottom of the electroporation cup to avoid bubbles. Perform electroporation in the electroporator, and select "MSC, human" as the program type. After the electroporation is completed, re-isolate the hBMSC-EVs loaded with miR-423-3p related preparations according to the above-mentioned separation method of this study and resuspend them in PBS for use. The RT-qPCR verification results are as follows. Figure 4As shown, the results showed that the simple hypoxia treatment group (only PBS with the same amount of hBMSC-EVs as other experimental groups was added as a negative control, and anaerobic treatment was performed for 24 hours with the help of Mitsubishi anaerobic gas production bags in Japan), hypoxia combined with aging stem cell source group (hBMSC-EVs derived from aging stem cells were added and anaerobic treatment was performed for 24 hours), hypoxia combined with aging stem cell source group overexpressing miR-423-3p (hBMSC-EVs derived from aging stem cells that had been successfully electroporated to load miR-423-3p analogs were added and anaerobic treatment was performed for 24 hours), hypoxia combined with aging stem cell source group overexpressing miRNA nonsense control (hBMSC-EVs derived from aging stem cells that had been successfully electroporated to load miR-423-3p analogs were added and anaerobic treatment was performed for 24 hours), hypoxia combined with aging stem cell source group overexpressing miRNA nonsense control After co-culture with cardiomyocytes, different hBMSC-EVs in the cell source group (hBMSC-EVs derived from aging stem cells that had been successfully electroporated and loaded with miR-423-3p and nonsense control preparations of the same composition were added and subjected to 24h of anaerobic treatment) had different expression levels of miR-423-3p in cardiomyocytes. hBMSC-EVs overexpressing miR-423-3p significantly increased the expression of miR-423-3p in cardiomyocytes. Compared with simple hBMSC-EVs treatment without overexpression treatment, the relative expression of miR-423-3p in cardiomyocytes increased by about 300%.

[0043] (5) Ultrasound detection of mouse heart

[0044] The time points for the mouse cardiac ultrasound examination were selected at day 0 before surgery, day 1, day 4, day 7, day 14 and day 28 after surgery. The specific groups were: PBS control group (the left anterior descending branch of the mouse coronary artery was ligated to construct a myocardial infarction model, and PBS was used instead of drug injection to achieve the purpose of no treatment control), young stem cell-derived exosome group (young stem cell-derived exosomes were injected into the myocardium while constructing a myocardial infarction model for treatment), aging stem cell-derived exosome group (aging stem cell-derived exosomes were injected into the myocardium while constructing a myocardial infarction model for treatment), and aging stem cell-derived exosome group overexpressing miR-423-3p (aging stem cell-derived exosomes loaded with miR-423-3p analogs were injected into the myocardium while constructing a myocardial infarction model for treatment). Mouse cardiac ultrasound examination was performed in a small animal echocardiography room. After turning on the instrument and connecting the ultrasound probe, the mice to be tested were anesthetized with gas in the anesthesia machine. The anesthetized mice were fixed on the constant temperature ECG monitoring board with their front faces, and the anesthetic dose was reduced and anesthesia ventilation was continued. The coupling agent was evenly squeezed on the mouse's limbs and chest, and a 400Hz ultrasound probe was used to find the appropriate slice and position to record the mouse's echocardiogram. After recording, the left ventricular end-diastolic diameter (LVID;d) and left ventricular end-systolic diameter (LVID;s) of the mouse were measured, and the left ventricular ejection fraction (EF) and left ventricular short-axis shortening (FS) were calculated. The experimental results are shown in Figure 2. Figure 5 As shown in the figure, the ventricular wall motion of each group of mice after myocardial infarction was weakened. As time went on, the ventricular wall motion of the three groups treated with different hBMSC-EVs showed different degrees of recovery. On the 28th day, the ventricular wall activity of the mice in the Y_EVs group and the O_EVs+miR-423-3p group was stronger; the overall change trend of the EF value and FS value of each group of mice in 28 days was basically consistent with the change of the strength of the ventricular wall activity, among which the EF value of the PBS group on the 28th day was about 21%, and the FS value was about 11%. The EF value of the O_EVs group on the 28th day was about 35%, and the FS value was about 17%. The heart function of the O_EVs+miR-423-3p group and the Y_EVs group on the 28th day was better, with EF values ​​of about 58% and 61%, and FS values ​​of about 30% and 32%, respectively, and the effect was similar. This is because after overexpression of miR-423-3p, the protective ability of exosomes on the heart of mice after myocardial infarction was re-enhanced, and the phenomenon of decreased protective ability caused by aging of stem cells was improved.

[0045] (6) Evaluation of cardiac changes in mice

[0046] The weight of the mice was accurately weighed and recorded 28 days after surgery. The specific groups were: PBS control group, young stem cell-derived exosome group, aging stem cell-derived exosome group, and aging stem cell-derived exosome group overexpressing miR-423-3p. After removing the mouse heart and tibia, the heart mass and tibia length were accurately measured using an analytical balance and vernier caliper. The ratio of the mouse heart mass to body weight and the ratio of the heart mass to tibia length were calculated to quantitatively analyze the degree of heart damage in the mouse. The experimental results are as follows Figure 6 As shown in the figure, the heart damage in the PBS group was the most serious on the 28th day after surgery, with HW / TL of about 16 mg / mm and HW / BW of about 10 mg / g. The O_EVs group was not much different from the PBS group. The heart damage in the Y_EVs group and the O_EVs+miR-423-3p group was relatively mild and there was no significant difference between the two groups, with HW / TL of about 11 mg / mm and HW / BW of about 7 mg / g. Masson staining was performed on the heart sections of mice in the same group 28 days after myocardial infarction. The experimental results are shown in the figure. Figure 6 As shown in the figure, on the 28th day after surgery, the PBS group had the thinnest ventricular wall thickness and the largest blue fibrosis area, accounting for about 55%, followed by the O_EVs group, accounting for about 37%. The O_EVs+miR-423-3p group was better than the O_EVs group, with thicker ventricular wall thickness and reduced fibrosis area, which was close to the Y_EVs group, accounting for about 21%. The Y_EVs group had the thickest ventricular wall thickness and the smallest blue fibrosis area, only about 18%.

[0047] (7) Detection of changes in hypoxic cardiomyocytes

[0048] Different groups of hBMSC-EVs were co-cultured with cardiomyocytes for 24 hours, and then gently placed flat in a special anaerobic sealed box. The outer packaging of the anaerobic gas-producing bag was opened, and the bag was quickly placed in a sealed box and sealed. Once the outer packaging of the anaerobic gas-producing bag was opened, the gas-producing bag began to react immediately. The sealed box containing the cardiomyocytes was put back into the incubator and continued to be cultured under hypoxic conditions for 24 hours. Flow cytometry was used to detect cardiomyocyte apoptosis in cardiomyocytes co-cultured with different exosomes and anaerobically treated. The specific groups were: a blank control group without treatment, a simple hypoxia treatment control group, a hypoxia-combined exosome group derived from young stem cells, a hypoxia-combined exosome group derived from aging stem cells, a hypoxia-combined exosome group derived from aging stem cells that overexpressed miR-423-3p, a hypoxia-combined exosome group derived from aging stem cells that overexpressed miRNA nonsense control, a hypoxia-combined exosome group derived from aging stem cells that inhibited miR-423-3p, and a hypoxia-combined exosome group derived from aging stem cells that was transferred with miRNA inhibitor nonsense control. The experimental results are as follows. Figure 7As shown in the figure, it was found that the ability of aging hBMSC-EVs to inhibit apoptosis of hypoxic cardiomyocytes was reduced, with the proportion of apoptotic cells in the hypoxia+Y_EVs group being only 20.1%, while the proportion of apoptotic cells in the hypoxia+O_EVs group was 32.7%. Overexpression of miR-423-3p can effectively improve it, and the proportion of apoptotic cells in the hypoxia+O_EVs+agomiR-423-3p group dropped back to 23.1%. CCK8 cell viability detection found that the young group hBMSC-EVs showed a strong cardiomyocyte protection ability, with a relative cell viability of about 65%. However, this ability of the aging group hBMSC-EVs was weak, with a relative cell viability of only about 45%. After overexpressing miR-423-3p, the aging group hBMSC-EVs strengthened the protection ability of in vitro cardiomyocytes, and the relative cell viability rose back to about 65%. The expression levels of apoptosis-related markers in cardiomyocytes after treatment in different groups were detected, and it was found that aged hBMSC-EVs overexpressing miR-423-3p upregulated bcl-2 in cardiomyocytes by about 250%, downregulated caspase-3 by about 35%, and p53 by about 50%, indicating that the cell apoptosis process was inhibited.

[0049] (8) Biosafety Verification

[0050] The liver, spleen, lung and kidney of the myocardial infarction mice were sliced ​​and HE stained 28 days after treatment. The groups were divided into: PBS control group, young stem cell-derived exosome group, aging stem cell-derived exosome group and aging stem cell-derived exosome group overexpressing miR-423-3p. Figure 8 As shown, it was found that the physiological structure of each organ slice was intact, and no obvious pathological changes were observed. 28 days after the operation, the mice were transferred to a special operating room for small animals for eye blood sampling. Grab the mouse's ears to make the scalp taut and one eyeball protruding. After fixing the mouse's front paws, use curved forceps to directly clamp the mouse's eyeball, and drip the blood into a pre-prepared 1.5mL centrifuge tube. After the blood is collected, quickly transfer to the centrifuge and centrifuge at 4°C and 3000rpm for 10 minutes, and take the supernatant for later use. The activity and content of alanine aminotransferase (GPT), aspartate aminotransferase (GOT) and urea nitrogen (BUN) in the supernatant were detected. The experimental results are shown in Figure 8 As shown, it was found that the activities of GPT and GOT as well as the BUN content in plasma samples did not show significant changes and were all within the normal range.

[0051] (9) Bioinformatics analysis of downstream regulatory genes of miR-423-3p and verification

[0052] The downstream regulatory genes of miR-423-3p were predicted and compared in Targetscan, miRanda and miRDB databases, respectively, and the most likely downstream pathway was screened out as the MAPK signaling pathway, and the most likely target gene was FAM222B. The obtained information of miR-423-3p downstream regulatory genes and related pathway proteins was imported into the STRING database to obtain a protein-protein interaction network (PPI network) diagram, and the Cytoscape software was used for visualization analysis, and the downstream targets most closely connected to it were screened out as Taok2 and NIK. The specific results are shown below. Fig. 9 RT-qPCR was used to verify the changes in the predicted genes in hypoxic cardiomyocytes after treatment in different groups, and it was found that only FAM222B and Taok2 changed with the change of miR-423-3p expression, suggesting that miR-423-3p may improve the protection against myocardial infarction by regulating FAM222B and Taok2 genes.

Claims

1. Application of exosomes derived from aged mesenchymal stem cells overexpressing miR-423-3p in the preparation of myocardial infarction protective drugs.

2. The use according to claim 1, characterized in that: The exosomes derived from aged mesenchymal stem cells that overexpress miR-423-3p are prepared by electroporation drug loading to overexpress miR-423-3p in exosomes derived from aged bone marrow mesenchymal stem cells.

3. The use according to claim 1, characterized in that: The method for preparing exosomes derived from aged bone marrow mesenchymal stem cells comprises: separating hBMSCs samples by using an adherence method, using P12-P15 cells as aged bone marrow mesenchymal stem cells, culturing them in a special culture medium without extracellular vesicles, and separating exosomes derived from aged bone marrow mesenchymal stem cells from the cell culture supernatant by ultracentrifugation.

4. The use according to claim 1, characterized in that: The drug is used to increase the expression of miR-423-3p in cardiomyocytes.

5. The use according to claim 1, characterized in that: The drug is used to increase the amplitude of the heart's ventricular wall movement.

6. The use according to claim 1, characterized in that: The drug is used to increase the thickness of the walls of the heart.

7. The use according to claim 1, characterized in that: The drug is used to reduce the degree of fibrosis in the walls of the heart.

8. The use according to claim 1, characterized in that: The drug is used for enhancing the protective ability of myocardial cells.

9. The use according to claim 1, characterized in that: The drug is used for reducing apoptosis of cardiomyocytes.

10. The use according to claim 1, characterized in that: The drug is used to upregulate bcl-2 and downregulate caspase-3 and p53 in cardiomyocytes.

Images