Construction method and antiviral application of recombinant lactic acid bacteria for expressing porcine IFITM3 protein

Abstract

The invention belongs to the technical field of exogenous expression, and particularly discloses a construction method and antiviral application of recombinant lactic acid bacteria for expressing porcine IFITM3 protein. According to the invention, a porcine interferon-induced transmembrane protein 3 (IFITM3) gene is cloned into an expression vector of lactobacillus plantarum through a molecular biological method, so that high-efficiency expression in lactobacillus plantarum is realized. The recombinant lactobacillus plantarum not only maintains all advantages of a food-grade expression system, such as safety, high efficiency and wide application potential in food industry, but also increases a new antiviral function. The invention further discloses detailed steps for constructing and expressing the IFITM3 gene, a new tool and method are provided for researchers and developers in related fields so as to explore and utilize the antiviral characteristics of IFITM3, and development of broad-spectrum antiviral drugs is expected to be promoted.

Description

Technical Field

[0001] The present invention relates to the field of exogenous expression technology, and in particular to a construction method of recombinant lactic acid bacteria expressing porcine IFITM3 protein and its antiviral application. Background Art

[0002] Interferon inducible transmembrane proteins (IFITMs) are a class of small molecule transmembrane proteins encoded by interferon-stimulated genes (ISGs). They are mainly located on the cytoplasmic membrane, endosomal membrane and lysosomal membrane. They have broad-spectrum antiviral activity and inhibit viral infection of host cells in a unique way. They also play an important role in embryonic development, cell adhesion, tumorigenesis, signal transduction, cell homing and maturation, and bone calcification.

[0003] Several studies have shown that IFITM3 can effectively inhibit the entry of a variety of enveloped or non-enveloped viruses into host cells, including Ebola virus, vesicular stomatitis virus, Zika virus, etc., but has no effect on the entry of a variety of DNA viruses into host cells, such as adenovirus, cytomegalovirus, etc. However, some studies have shown that IFITMs can effectively limit the infection of vaccinia virus into host cells; in addition, IFITMs can also promote the entry of some viruses into host cells, such as human coronavirus OC43 (HCoV-OC43) and SARS-CoV-2. Early studies believed that IFITM3 could only prevent enveloped viruses from entering host cells, but with the increasing number of studies and the deepening of the content, researchers found that IFITM3 also has an inhibitory effect on the entry of some non-enveloped viruses. However, its antiviral mechanism has not yet been fully explained.

[0004] At present, there have been many studies on the mechanism of IFITM3, but there are very few studies on its application. In this invention, the antiviral effect of IFITM3 is combined with the lactic acid bacteria expression system to develop a new lactic acid bacteria expression platform with antiviral function. The lactic acid bacteria expression system is valued for its food-grade safety, high efficiency and wide application in the food industry. Using this system to express IFITM3 can not only protect antiviral proteins, but also use these engineered bacteria to develop new antiviral foods or drug delivery systems. Summary of the invention

[0005] The present invention provides a method for constructing a recombinant lactic acid bacteria expressing a porcine IFITM3 protein and its antiviral application, so that the porcine IFTIM3 protein can be expressed in Lactobacillus plantarum, providing data support for the research on the development of a broad-spectrum antiviral oral lactic acid bacteria vaccine.

[0006] The invention provides a recombinant Lactobacillus plantarum vector of porcine interferon-induced transmembrane protein 3. The basic vector skeleton of the recombinant Lactobacillus plantarum vector comprises pMG36e.

[0007] Preferably, the primer pair for amplifying the porcine interferon-induced transmembrane protein 3 includes an upstream primer shown in SEQ ID No.1 and a downstream primer shown in SEQ ID No.2.

[0008] Preferably, the gene fragment of the porcine interferon-induced transmembrane protein 3 is inserted between the KpnⅠ restriction site and the XbaⅠ restriction site of pMG36e.

[0009] The present invention also provides a method for constructing the above-mentioned recombinant Lactobacillus plantarum vector, comprising the following steps: (1) using cDNA obtained by reverse transcription of RNA extracted from pig kidney cells as a template, amplifying using primers shown in SEQ ID No. 1 and SEQ ID No. 2 to obtain an IFITM3 DNA fragment;

[0010] (2) adding a KpnⅠ restriction site and a FLAG tag to the 5' end of the IFITM3 DNA fragment in step (1), adding an XbaⅠ restriction site to the 3' end, and performing double restriction digestion with KpnⅠ and XbaⅠ;

[0011] (3) Connecting the double-digested fragment in step (2) with the pMG36e plasmid linearized after double-digestion with KpnⅠ and XbaⅠ to obtain the recombinant Lactobacillus plantarum vector.

[0012] The present invention also provides an expression method of the recombinant Lactobacillus plantarum vector, comprising transforming the recombinant Lactobacillus plantarum vector into competent Escherichia coli cells, and culturing and expressing the recombinant Escherichia coli.

[0013] Preferably, the culturing comprises culturing on a resistance LB plate containing 50 μg / mL erythromycin.

[0014] The present invention also provides a recombinant Lactobacillus plantarum comprising the recombinant Lactobacillus plantarum vector.

[0015] Preferably, the method comprises transforming the recombinant Lactobacillus plantarum vector into Lactobacillus plantarum competent cells, and culturing and expressing the recombinant lactobacillus.

[0016] Preferably, the host bacteria of the recombinant Lactobacillus plantarum include competent cells of CICC6240.

[0017] The present invention also provides a method for expressing porcine interferon-induced transmembrane protein 3 by the above-mentioned recombinant Lactobacillus plantarum, comprising the following steps: inoculating the recombinant Lactobacillus plantarum into MRS liquid culture medium, inducing expression using nisin after static culture, and the bacterial liquid contains the porcine interferon-induced transmembrane protein 3.

[0018] Preferably, the method comprises static culturing until OD 600 When the value is 0.3-0.4, nisin is used to induce expression.

[0019] Preferably, the recombinant lactic acid bacteria after expression are subjected to a challenge protection experiment.

[0020] The present invention also provides the use of the recombinant Lactobacillus plantarum or the porcine interferon-induced transmembrane protein 3 expressed by the above method in the preparation of oral lactic acid bacteria vaccines.

[0021] Beneficial effects: The present invention clones the porcine interferon-induced transmembrane protein 3 (IFITM3) gene into the expression vector of Lactobacillus plantarum by molecular biological methods, and realizes efficient expression in Lactobacillus plantarum. This recombinant Lactobacillus plantarum not only maintains all the advantages of the food-grade expression system, such as safety, high efficiency, and wide application potential in the food industry, but also adds a new antiviral function. As a food-grade microorganism, the plant lactobacillus described in the present invention has been widely recognized and used in food fermentation processes, ensuring the safety of the expression system. The present invention achieves stable expression of the IFITM3 gene in Lactobacillus plantarum through optimized expression vector design. The engineered strain can stably express IFITM3 in the environment of gastric acid to protect the protein from destruction. Recombinant Lactobacillus plantarum can be used as an antiviral food additive or as a drug delivery system, providing a platform for the development of new antiviral products. The recombinant Lactobacillus plantarum is introduced into mice and piglets orally, and the present invention exhibits excellent antiviral efficacy.

[0022] In addition, the method of the present invention also includes detailed steps for constructing and expressing the IFITM3 gene, providing researchers and developers in related fields with a new tool and method to explore and utilize the antiviral properties of IFITM3. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the electrophoresis detection diagram of the PCR amplification results of the IFITM3 fragment;

[0024] Figure 2 This is the electrophoresis detection diagram of double restriction enzyme digestion verification of pMG36e-IFITM3 recombinant plasmid;

[0025] Figure 3This is the electrophoresis detection diagram of the PCR results of the recombinant Lactobacillus plantarum CICC6240 / pMG36e-IFITM3 bacterial solution;

[0026] Figure 4 This is the result of Western blotting to detect the target protein;

[0027] Figure 5 Figure 1 is a graph showing the survival rate and weight of mice: A is a flowchart showing the infection of mice, B is the weight change of mice, C is the survival rate of mice, and D is the organ index;

[0028] Figure 6 The figure shows the pathological changes and pathological sections of mice: A is the brain, B is the lung, C is the liver, D is the brain pathological section, E is the lung pathological section, and F is the liver pathological section;

[0029] Figure 7 The figure shows the viral load and transcriptional level of inflammatory factors in mouse organs;

[0030] Figure 8 The expression level of inflammatory factors in mice: The relative expression levels of inflammatory factor IL-1β in lung and liver tissues and anti-inflammatory factor IL-10 in brain and spleen of mice challenged with r-LAB-I3 group were significantly lower than those in PBS group and CICC6240 group;

[0031] Fig. 9 The survival rate, weight and body temperature of piglets are shown in Figure 1. A is the experimental flow chart, B is the survival rate, C is the weight change chart, and D is the body temperature change chart;

[0032] Fig.10 This is a picture of the actual anatomy and pathological sections of piglets;

[0033] Fig.11 This is the transcription level diagram of inflammatory factors in piglets with viral load;

[0034] Fig.12 This is the expression level diagram of inflammatory factors in the viral load of piglets. The relative expression levels of inflammatory factors in the jejunal ileum and intestinal tissues of the r-LAB-I3 group-infected piglets were significantly lower than those in the PBS group and the CICC6240 group. DETAILED DESCRIPTION

[0035] The invention provides a recombinant Lactobacillus plantarum vector of porcine interferon-induced transmembrane protein 3. The basic vector skeleton of the recombinant Lactobacillus plantarum vector comprises pMG36e.

[0036] The primer pair for amplifying the porcine interferon-induced transmembrane protein 3 of the present invention comprises an upstream primer shown in SEQ ID No. 1 and a downstream primer shown in SEQ ID No. 2:

[0037] SEQ ID No.1: GGGGTACCCCATGGATTACAAGGATGACGACGATAAGA ATTGCGCTTCCCAG;

[0038] SEQ ID No.2: GCTCTAGATTACATCATCACCATCACCACGTAGCCTCTGT AATC; and when amplifying the IFITM3, preferably, the cDNA obtained by reverse transcription of RNA extracted from pig kidney cells is used as a template, and the primers shown in SEQ ID No.1 and SEQ ID No.2 are used for amplification to obtain the IFITM3 DNA fragment. The pig kidney cells in the embodiment are preferably 3D4 / 21.

[0039] The recombinant Lactobacillus plantarum vector of the present invention contains the DNA sequence of IFITM3, and the gene fragment of IFITM3 is preferably inserted between the KpnⅠ restriction site and the XbaⅠ restriction site of pMG36e.

[0040] The present invention also provides a method for constructing the above-mentioned recombinant Lactobacillus plantarum vector, comprising the following steps: (1) using cDNA obtained by reverse transcription of RNA extracted from pig kidney cells as a template, amplifying using primers shown in SEQ ID No. 1 and SEQ ID No. 2 to obtain an IFITM3 DNA fragment;

[0041] (2) adding a KpnⅠ restriction site and a FLAG tag to the 5' end of the IFITM3 DNA fragment in step (1), adding an XbaⅠ restriction site to the 3' end, and performing double restriction digestion with KpnⅠ and XbaⅠ;

[0042] (3) Connecting the double-digested fragment in step (2) with the pMG36e plasmid linearized after double-digestion with KpnⅠ and XbaⅠ to obtain the recombinant Lactobacillus plantarum vector.

[0043] The present invention preferably uses the Trizol method to extract cell RNA from pig kidney cells (PK-15), then reverse transcribes to obtain cDNA, uses the cDNA as a template to perform PCR amplification to obtain an IFITM3 DNA fragment, and adds a KpnⅠ restriction site and a FLAG tag at the starting position of the 5' end of the sequence, and adds an XbaⅠ restriction site at the 3' end to complete the acquisition of the target gene.

[0044] The present invention preferably performs double enzyme digestion on the IFITM3 gene fragment and the pMG36e plasmid with KpnⅠ and XbaⅠ, respectively, and after being in a water bath at 37°C for 2 hours, performs 1% agarose gel electrophoresis on the double enzyme digestion products, cuts out the correct band, and uses a gel recovery kit to recover and purify the double enzyme digestion products; finally, the target gene IFITM3 after gel recovery is connected with the pMG36e vector at a ratio of 3:1 using T4 ligase at 4°C overnight to obtain the recombinant Lactobacillus plantarum vector.

[0045] The present invention also provides an expression method of the recombinant Lactobacillus plantarum vector, comprising transforming the recombinant Lactobacillus plantarum vector into competent Escherichia coli cells, and culturing and expressing the recombinant Escherichia coli.

[0046] The present invention preferably transfers the above-mentioned ligation product into T1 Escherichia coli competent state, cultures it on LB plate containing 50 μg / mL erythromycin resistance at 37°C overnight, picks monoclonal colonies and cultures them in LB liquid medium containing 50 μg / mL erythromycin resistance at 37°C and 220rpm overnight, and extracts plasmids with a small plasmid extraction kit. The extracted recombinant plasmid is double-enzyme-cut verified, and the plasmid with correct enzyme cutting verification is sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, and the one with correct sequencing is the recombinant plasmid of the recombinant Lactobacillus plantarum vector of the present invention.

[0047] The present invention also provides a recombinant Lactobacillus plantarum comprising the recombinant Lactobacillus plantarum vector.

[0048] The host bacteria of the recombinant Lactobacillus plantarum of the present invention preferably include competent cells of CICC6240. In the embodiment, the recombinant plasmid or the recombinant Lactobacillus plantarum expression vector is preferably transformed into the competent cells of CICC6240 by electroporation.

[0049] The present invention also provides a method for expressing porcine interferon-induced transmembrane protein 3 by the above-mentioned recombinant Lactobacillus plantarum, comprising the following steps: inoculating the recombinant Lactobacillus plantarum into MRS liquid culture medium, inducing expression using nisin after static culture, and the bacterial liquid contains the porcine interferon-induced transmembrane protein 3.

[0050] The present invention preferably inoculates the monoclonal colony of the recombinant Lactobacillus plantarum obtained in the MRS solid medium containing 50 μg / mL erythromycin resistance into the MRS liquid medium, and cultured overnight in a 30°C incubator. The next day, the colony is inoculated into the MRS liquid medium at a ratio of 1:50, and cultured in a 30°C incubator until OD 600 When the nisin concentration was 0.3-0.4, nisin inducer with a final concentration of 10 ng / mL was added to the bacterial solution, and the induction culture was continued at 30°C for 12 h.

[0051] The present invention preferably separates the IFITM3 protein from the induced cultured bacterial solution, more preferably comprising centrifuging the bacterial solution at 10,000 rpm, 4°C for 5 min, discarding the supernatant, resuspending the precipitate with pre-cooled sterile water, centrifuging at 10,000 rpm, 4°C for 5 min, discarding the supernatant, and repeating twice; resuspending the precipitate with a lysozyme solution, and incubating in a 37°C water bath for 1 hour to obtain the total protein of the IFITM3 protein of the present invention.

[0052] The present invention also provides the use of the above-mentioned recombinant Lactobacillus plantarum or the porcine interferon-induced transmembrane protein 3 expressed by the above-mentioned method in the preparation of oral lactic acid bacteria vaccines, and the oral administration to piglets and mice exerts an excellent antiviral effect.

[0053] To further illustrate the present invention, the construction method of a recombinant lactic acid bacteria expressing porcine IFITM3 protein and its antiviral application provided by the present invention are described in detail below in combination with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0054] Unless otherwise specified, the reagents and materials used in the examples of the present invention are conventional commercial products in the art, and the experimental methods used are conventional methods.

[0055] Porcine PK-15 cells were isolated in the laboratory and published in <IFITM3 is ahostrestriction factorthat inhibits porcine traPBSmissible gastroenteritis virus infection> ; T1 competent Escherichia coli was purchased from Shanghai Ruichu Biotechnology Co., Ltd., Lactobacillus plantarum CICC6240 strain and expression plasmid pMG36e were donated by Changsha Green Leaf Biotechnology Co., Ltd.

[0056] Sodium chloride, glucose, sucrose, glycerol, Tween, potassium dihydrogen phosphate, sodium hydrogen phosphate dodecahydrate, potassium chloride, sodium dodecyl sulfate, and β-mercaptoethanol were purchased from Sinopharm Group; glycine, ethylenediaminetetraacetic acid (EDTA), and lysozyme were purchased from Solebao Technology Co., Ltd.; bromophenol blue was purchased from Shanghai Sanais Reagent Co., Ltd.; tris (hydroxymethylaminomethane) (Tris) was purchased from Bio FROXX, Germany; peptone, yeast extract, etc. were purchased from OXOID, UK; M17 broth medium and 50 μg / mL erythromycin were purchased from Beijing Coolbo Technology Co., Ltd.; KpnI, XbaⅠ restriction endonucleases, T4 ligase, HRP Goat-antiMouse IgG was purchased from Thermo Fisher Scientific Inc.; small-scale plasmid extraction kit and agarose gel recovery kit were purchased from Nanjing Novozyme Biotechnology Co., Ltd.; skimmed milk powder was purchased from BD Biotechnology Co., Ltd.; ECL luminescent liquid was purchased from Anolun Biotechnology Co., Ltd.; prestained DNA molecular weight standard was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; prestained protein molecular weight standard was purchased from Wuhan Sewell Biotechnology Co., Ltd.

[0057] PCR amplifier (Jena, Germany); agarose gel electrophoresis instrument (Beijing Liuyi Biotechnology Co., Ltd.); protein electrophoresis instrument, chemiluminescence imaging system (Bio-Rad Life Sciences Co., Ltd.); digital display constant temperature water bath (Changzhou Deke Instrument Co., Ltd.); ultra-micro spectrophotometer (Thermo Fisher Scientific Co., Ltd.); floor-standing high-speed refrigerated centrifuge (Hitachi, Japan); desktop high-speed refrigerated centrifuge (Eppendorf, Germany); UV spectrophotometer (Shanghai Yuanxi Instrument Co., Ltd.); constant temperature oscillator (Shanghai Biaozhuo Scientific Instrument Co., Ltd.); clean bench (Suzhou Antai Air Technology Co., Ltd. of Sujing Group); constant temperature incubator (Tianjin Labteri Instrument Equipment Co., Ltd.); electronic balance (Mettler-Toledo Instrument (Shanghai) Co., Ltd.), etc.

[0058] Preparation of LB liquid medium: weigh 5 g of tryptone, 2.5 g of yeast extract, and 2.5 g of sodium chloride, dissolve in 500 mL of deionized water, and sterilize at 115°C for 20 min.

[0059] Preparation of LB solid medium: weigh 5 g of tryptone, 2.5 g of yeast extract, 2.5 g of sodium chloride, and 7.5 g of agar powder, dissolve in 500 mL of deionized water, and sterilize at 115°C for 20 min.

[0060] Preparation of MRS liquid culture medium: weigh 42.3 g of M17 broth culture medium and 10 g of glucose, dissolve in 1 L of deionized water, and sterilize under high pressure at 115°C for 20 min.

[0061] Preparation of MRS solid culture medium: weigh 42.3 g of M17 broth medium and 10 g of glucose and dissolve them in 1 L of deionized water. Autoclave at 115°C for 20 min. When the temperature drops below 60°C, add 50 μg / mL erythromycin and introduce it into the culture dish.

[0062] Preparation of MRS liquid culture medium: Add 0.5 mol / L sucrose and 2.5% glycine into MRS culture medium.

[0063] Preparation of Lactobacillus plantarum competent cell preparation solution I: 0.5 mol / L sucrose and 100 mL glycerol were dissolved in 1 L of deionized water and sterilized by high pressure at 115°C for 20 min.

[0064] Preparation of Solution II for the preparation of competent cells of Lactobacillus plantarum: Add 0.05 mol / L ethylenediaminetetraacetic acid to Solution I, and add a corresponding volume of sodium hydroxide to adjust the pH to 8.0, and sterilize at 115°C for 20 min.

[0065] Phosphate buffered saline (PBS): weigh 8 g NaCl, 8 g NaH 2 PO 4 1.44g, KH 2 PO 4 Add 0.24g of HCl and 0.2g of KCl to make up to 1L and sterilize by high pressure at 121℃ for 20min.

[0066] PBST: Add 0.05% Tween-20 to PBS solution.

[0067] Preparation of 5Xsds Buffer: Take 4.5mL 1moL / L Tris-HCl, 1g sodium dodecyl sulfate, 0.01g bromophenol blue, add 10mL glycerol, add deionized water to make up to 20mL, dispense 1mL into each tube, and add 50uL β-mercaptoethanol to each tube before use.

[0068] Example 1

[0069] 1. Acquisition of target genes

[0070] The pig kidney cells (PK-15) cultured in the laboratory were used to extract the cell RNA by Trizol method, and then reverse transcribed to obtain cDNA. The cDNA was used as a template for PCR amplification to obtain the IFITM3 DNA fragment, and the KpnⅠ restriction site and FLAG tag were added at the 5' end of the sequence, and the XbaⅠ restriction site was added at the 3' end. The primers shown in SEQ ID No.1 and SEQ ID No.2 were used for amplification, and the amplified band PCR products were identified by nucleic acid gel electrophoresis. The identification results are shown in FIG. Figure 1As shown, an obvious amplified band can be seen at 498 bp, which is consistent with the expected size, proving that the fragment was amplified successfully.

[0071] 2. Enzyme digestion and ligation of target gene and pMG36e vector

[0072] The IFITM3 gene fragment and pMG36e plasmid were double-digested with KpnⅠ and XbaⅠ. After incubation at 37°C in a water bath for 2 hours, the double-digested products were detected by 1% agarose gel electrophoresis, and the correct bands were cut out and the double-digested products were recovered and purified using a gel recovery kit.

[0073] IFITM3 gene fragment double enzyme digestion reaction system (30 μL): IFITM3 gene fragment 25 μL, KpnⅠ1 μL, XbaⅠ1 μL and 10×buffer3 μL.

[0074] pMG36e plasmid double restriction enzyme digestion reaction system (30 μL): pMG36e plasmid 5 μL, KpnⅠ1 μL, XbaⅠ1 μL, 10× buffer 3 μL, ddH 2 20 μL of HO.

[0075] The target gene IFITM3 recovered from the gel was connected to the pMG36e vector at a ratio of 3:1 using T4 ligase at 4°C overnight. The specific ligation reaction system (20 μL) included 14 μL of IFITM3 gene fragment, 3 μL of pMG36e plasmid, 2 μL of 10× buffer and 1 μL of T4 DNA ligase.

[0076] 3. Double enzyme digestion verification and identification of recombinant plasmid

[0077] The ligation product was transferred into T1 Escherichia coli competent cells, cultured overnight at 37°C on an LB plate containing 50 μg / mL erythromycin resistance, and a single clone colony was picked and cultured overnight at 37°C and 220 rpm in LB liquid medium containing 50 μg / mL erythromycin resistance, and the plasmid was extracted using a small plasmid extraction kit. The extracted recombinant plasmid was double-enzyme digestion verified, and the plasmid with correct enzyme digestion verification was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. Specific double-enzyme digestion verification reaction system (10 μL): pMG36e-IFITM3 recombinant plasmid 1 μL, KpnⅠ0.5 μL, XbaⅠ0.5 μL, 10×buffer 1 μL, ddH 2 O 7μL. The recombinant plasmid obtained by the small extraction plasmid was identified by restriction endonucleases Kpn I and Xba I. The recombinant plasmid was double-digested and then subjected to nucleic acid electrophoresis. The results were as follows: Figure 2 As shown, two bands of the expected size were obtained.

[0078] 4. Preparation of competent cells of Lactobacillus plantarum

[0079] Take out the Lactobacillus plantarum CICC6240 strain from the -80℃ refrigerator, wait for it to melt, dip an inoculation loop of the bacterial solution into a three-zone solid medium without anti-MRS, and incubate it inverted overnight at 30℃; the next day, pick a single clone colony and place it in MRS culture medium, and culture it at 30℃ overnight; take 5mL of CICC6240 bacterial solution and inoculate it in 50mL of MRS culture medium, and culture it at 30℃ overnight; take another 5mL of CICC6240 bacterial solution and place it in 400mL of G-SMRS culture medium, and culture it at 30℃ until OD 600 When the pH is about 0.2-0.3, centrifuge at 4℃, 8000rpm for 10min to collect the bacteria. After resuspending with an appropriate amount of solution I, continue to add solution I to 20mL, centrifuge again at 4℃, 8000rpm for 10min, discard the supernatant and add 50mL solution II to resuspend the precipitate, place on ice for 15min, centrifuge at 4℃, 8000rpm for 10min, discard the supernatant, resuspend the precipitate with 20mL solution I, centrifuge at 4℃, 8000rpm for 10min, and collect the bacteria. Finally, resuspend the bacteria with 4mL solution I, place on ice, and divide the bacteria into 40μL per tube and store at -80℃.

[0080] 5. Electrotransformation of recombinant plasmid into competent cells of Lactobacillus plantarum

[0081] Take 40μL of lactic acid bacteria CICC6240 competent cells and place them on ice. After they are completely thawed, add 10μL of the ligation product to the competent cells and mix gently. Let them stand on ice for 15min, transfer them to a 0.2mm pre-cooled electroporation cup, and perform electroporation according to the following parameters: 2500V, 5ms. After the electroporation, quickly put the electroporation cup in ice for 1min, then transfer it to 1mL pre-cooled MRS medium for recovery. After standing at 30℃ for 2h, centrifuge the sample, discard part of the supernatant, resuspend the bacteria, take 50μL and apply MRS solid medium containing 50μg / mL erythromycin resistance, and let it stand in a 30℃ incubator for about 18h. After the monoclonal colony grows, pick the monoclonal colony for culture identification.

[0082] 6. Extraction and identification of recombinant Lactobacillus plantarum CICC6240 / pMG36e-IFITM3 plasmid

[0083] Pick a single clone colony and inoculate it into 5 mL of MRS liquid medium, and culture it in a 30°C incubator overnight. After the bacteria are collected, incubate them with 10 mg / mL lysozyme at 37°C for 1 hour, and then use a plasmid mini-preparation kit to extract the plasmid. The recombinant plasmid is sequenced and verified.

[0084] 7. Induction expression and Western blot identification of recombinant Lactobacillus plantarum CICC6240 / pMG36e-IFITM3

[0085] Pick a single clone colony and inoculate it into 5 mL of MRS liquid medium, incubate it in a 30°C incubator overnight, inoculate it into MRS liquid medium at a ratio of 1:50 the next day, and incubate it in a 30°C incubator until OD 600 When the nisin inducer is about 0.3-0.4, add nisin inducer with a final concentration of 10 ng / mL to the bacterial solution, and continue to induce culture at 30℃ for 12h. Then take 1mL of the induced bacterial solution, centrifuge at 10000rpm, 4℃ for 5min, discard the supernatant, resuspend the precipitate with 1mL of pre-cooled sterile water, centrifuge at 10000rpm, 4℃ for 5min, discard the supernatant, and repeat twice. Resuspend with 200μL of lysozyme solution with a concentration of 1mg / mL, incubate in a 37℃ water bath for 1h, take 80μL of total protein, add 20μL of 5×SDSBuffer, mix well by pipetting, boil for 10min, and store at -20℃.

[0086] 10μL sample was loaded, and the voltage was adjusted to 80V for 30min to run the concentrated gel, and then adjusted to 120V for 1h until the electrophoresis was completed. After the electrophoresis was completed, the gel was removed for transfer, and the transfer filter paper and PVDF membrane were soaked in transfer buffer. The wet filter screen, 4 layers of transfer filter paper, gel, PVDF membrane, 4 layers of filter paper and filter screen were stacked on the negative electrode surface of the carbon plate in sequence, and the clamp was inserted into the electrophoresis tank with a voltage of 80V and 80min. After the transfer, the membrane was immersed in 5% skim milk powder and blocked on a horizontal shaker at room temperature for 3 hours; washed with PBST 3 times, 10 minutes each time; incubated with mouse FLAG tag antibody (1:5000) diluted with PBST as the primary antibody for 2 hours; washed with PBST 3 times, 10 minutes each time; incubated with HRP-labeled goat anti-mouse IgG (1:5000) as the secondary antibody for 1 hour: washed with PBST 3 times, 10 minutes each time; finally, developed with ECL luminescent solution until clear bands appeared, and detected the bands with a protein chemical imaging luminometer. The results are as follows Figure 4 As shown, the protein size is 15 kDa, which is consistent with the target band size.

[0087] 8. CICC6240 lactic acid bacteria and recombinant lactic acid bacteria CICC6240 / pMG36e-IFITM3 were cultured in MRS liquid medium until OD 600 =0.3, add nisin inducer and induce for 12 hours, then take 1 mL of bacterial solution (plate count 3.2×10 12CFU / mL), centrifuged at 4℃12000×g for 5min, discarded the supernatant, washed three times with saline, and finally resuspended with 200μL PBS. Twenty 4-week-old female KM mice were purchased and pre-fed in the mouse room for one week. On the 8th day, PBS, CICC6240 bacterial solution and r-LAB-I3 bacterial solution were gavaged. After 5 consecutive days of gavage, the mice were intramuscularly injected with PRV on the 12th day. On the 20th day, the mice that did not die were uniformly killed. The experimental groups, gavage and challenge schemes are shown in Table 1.

[0088] Table 1 Mouse experimental groups

[0089] Grouping Oral administration (200 μL) <![CDATA[Intramuscular injection (1×10 5 )]]> Quantity (pcs) Blank(Mock) none none 20 Phosphate buffered saline (PBS) PBS 50 μL PRV 20 Lactococcus lactis (CICC6240) CICC6240 bacterial liquid 50 μL PRV 20 Recombinant lactic acid bacteria (r-LAB-I3) r-LAB-I3 bacterial liquid 50 μL PRV 20

[0090] 9. Effects of recombinant lactococcus lactis CICC6240 / pMG36e-IFTIM3 on the body weight, mortality, and organ indexes of mice;

[0091] After one week of pre-feeding, mice were gavaged. The mice were weighed at a fixed time every day from the beginning of gavage, and the weight changes of each group of mice were recorded. The mental state, physical appearance, and behavior of the mice were observed, and the death of mice in each group was recorded. Finally, the survival rate of mice in each group was calculated after statistics. When dead mice were found, they were immediately dissected and their brains, lungs, spleens, and liver tissues were completely removed. After being cleaned with physiological saline, they were weighed and the ratio of organ weight to body weight was calculated.

[0092] 10. Mouse pathological tissue sections;

[0093] After removing the dissected mouse tissues, rinse them with saline, then immediately cut a portion of each tissue and soak it in 4% formaldehyde fixative for one week. Remove the tissues and cut them into slices of about 2 mm, then perform HE staining; then follow the steps below:

[0094] (1) Soak the sliced ​​tissue in 50% alcohol solution, 70% alcohol solution, 80% alcohol solution, and 90% alcohol solution in the order of 20 min in each concentration gradient, and then soak in 100% alcohol solution twice, 30 min each time;

[0095] (2) Soak in alcohol xylene for 20 min, then soak in xylene twice, 20 min each time (the tissue can be observed to become transparent);

[0096] (3) The tissue was immersed in xylene paraffin and placed in a 65°C incubator for 30 min. It was then immersed in paraffin twice, each time in a 65°C incubator for 1 h.

[0097] (4) Place the tissue in the embedding box and position it correctly. Use a tissue embedding machine to add liquid paraffin and quickly place it on a freezer to solidify the paraffin. After it solidifies, store it in a refrigerator at 4°C overnight.

[0098] (5) Cut the embedded tissue into 2-5 μm slices using a biological tissue slicer, and after it is fully unfolded on the water surface, fix it on a glass slide, place the glass slide on a biological tissue baking machine, bake it at 50°C until there is no obvious moisture on the glass slide, and continue to dry it in a 37°C constant temperature box overnight;

[0099] (6) Soak the dried slides in xylene twice, each time for 10 min, then soak them in 100% alcohol solution, 90% alcohol solution, 80% alcohol solution, 70% alcohol solution, and 50% alcohol solution in this order, soaking each concentration gradient for 5 min, and then soaking them in pure water for 5 min;

[0100] (7) Soak in hematoxylin for 3 min, rinse in slow running water for 2 min, soak in ammonia water for 1 min, rinse in slow running water again for 2 min, soak in hydrochloric acid for 10 s (stop immediately when the slice turns red or pink), rinse in slow running water again for 2 min, and soak in ammonia water for 3 min;

[0101] (8) The sections were immersed in 50% alcohol solution, 70% alcohol solution, 80% alcohol solution, and 90% alcohol solution in the order of 1 min in each concentration gradient, immersed in 100% alcohol solution for 3 s, immersed in eosin solution for 3 s, immersed in 100% alcohol solution twice for 30 s each time, and immersed in xylene solution twice for 2 min each time;

[0102] (9) Gently apply neutral resin on a glass slide and cover with a coverslip, then dry in a fume hood.

[0103] 11. Extraction of tissue genomic DNA;

[0104] The mouse tissues stored at -80°C were thawed on ice, and the same mass of each tissue in each group was weighed and placed in a 2 mL centrifuge tube. 1 mL of normal saline and 2 to 3 grinding beads were added to extract DNA using a DNA extraction kit.

[0105] 12. Real-time fluorescence quantitative PCR (absolute quantification) of mouse tissues;

[0106] The concentration of the standard plasmid containing the PRV-specific amplified fragment stored in the laboratory was determined, and the standard plasmid was diluted to 10 -9 Then, QPCR detection is performed together with the sample to obtain a standard curve, and then the sample copy number is calculated based on the standard curve.

[0107] 13. Extraction and reverse transcription of RNA from mouse tissues;

[0108] The mouse tissues stored at -80°C were thawed on ice. The same mass of each tissue in each group (the spleen should be less than 10 mg) was weighed and placed in a 2 mL RNase-free centrifuge tube. 0.5 mL TraPBSZolUp, 0.2 ml RNA ExtractionAgent and 2 to 3 RNase-free grinding beads were added to extract RNA and perform reverse transcription.

[0109] 14. Fluorescence quantitative PCR of mouse tissues (relative quantification);

[0110] The cDNA obtained by reverse transcription was used as a template, and QPCR primers for GAPDH, IL-1β, IL-10, TNF-α, and IFN-γ were designed, followed by QPCR amplification.

[0111] Table 2 QPCR primer sequences

[0112] Name Sequence (5′-3′) SEQ ID No. PRV-gE-F GACCCCGAGGACGAGTTCA 3 PRV-gE-R ACGCCATAGTTGGGTCCATT 4 IL-1β-F GAAATGCCACCTTTTGACAGTG 5 IL-1β-R TGGATGCTCTCATCAGGACAG 6 IL-10-F GCTCTTACTGACTGGCATGAC 7 IL-10-R CGCAGCTCTAGGAGCATGTG 8 TNF-α-F ATGAGCACTGAGAGCATGATCCG 9 TNF-α-R CCTCGAAGTGCAGTAGGCAGA 10 IFN-γ-F AGACAATCAGGCCATCAGCAA 11 IFN-γ-R GTGGGTTGTTGACCTCAAACT 12 GAPDH-F TTCACCACCATGGAGAAGGC 13 GAPDH-R GGCATGGACTGTGGTCATGA 14

[0113] 15. Preparation of protein samples from mouse tissues and Western blot detection;

[0114] Weigh 50 mg of tissue, add 1 mL RIPA lysis buffer, 10 μL PMSF and 20 μL protease inhibitor, then add 2 grinding beads, and then place in a biological sample homogenizer for homogenization; remove the grinding beads, transfer the homogenate to a 1.5 mL centrifuge tube, and vortex; ice bath for 30 minutes, during which time use a pipette to repeatedly blow and beat every 10 minutes to ensure complete lysis of tissue cells; centrifuge at 12000×g for 5 minutes, collect the supernatant, which is the total protein solution; take 80 μL and add 20 μL 5×SDS buffer, boil in a boiling water bath for 10 minutes, and detect by Western blot.

[0115] Four-week-old KM mice were randomly divided into four groups (NC was a blank group, PBS group was gavaged with PBS, CICC6240 group was gavaged with CICC6240, and r-LAB-I3 group was gavaged with recombinant lactic acid bacteria). After five consecutive days of oral gavage treatment, mice in the PBS group, CICC6240 group, and r-LAB-I3 group received intramuscular injection of PRV. The experimental results are shown in Figure 5 As shown in the figure, compared with the PBS group and the CICC6240 group, the mice in the r-LAB-I3 group showed milder clinical symptoms and a significantly improved survival rate. Although there was no significant difference in the organ indexes of each group, the pathological changes in the organs of the mice in the r-LAB-I3 group were milder.

[0116] After the mouse gavage experiment, the weight changes of mice in each group were monitored daily. Figure 5As shown in B, after mice were infected with PRV, the weight gain of mice in the PBS group, CICC6240 group and r-LAB-I3 group slowed down compared with the Mock group, among which the weight gain rate of the r-LAB-I3 group decreased the slowest, indicating that the recombinant lactic acid bacteria alleviated the negative effect of PRV infection on the weight of mice.

[0117] On the third day after mice were infected with PRV, mice in all treatment groups showed depression, reduced appetite, licking of leg hair, and itching at the injection site. However, the clinical symptoms of mice in the r-LAB-I3 group were milder than those in the other two groups. On the fourth day, a large number of mice in the PBS group and the CICC6240 group died, and all mice in both groups died on the fifth day. In contrast, the death rate of mice in the r-LAB-I3 group was significantly slower, and one mouse survived until the end of the experiment ( Figure 5 Middle C).

[0118] During the mouse dissection, the brain, lungs, spleen and liver were completely removed, rinsed with saline and weighed. The ratio of organ weight to body weight was calculated, i.e., the organ index. The analysis results showed that there was no significant statistical difference in the organ index among the experimental groups, indicating that under the experimental conditions, the organs did not undergo obvious hypertrophy or atrophy ( Figure 5 (middle D).

[0119] Histopathological analysis results Figure 6 As shown, the cord-like arrangement of red blood cells in the brain tissue of the r-LAB-I3 group was reduced, the inflammatory cells in the lung tissue were significantly reduced, and the red blood cell infiltration in the liver tissue was also significantly reduced.

[0120] After removing the mouse organs and taking pictures, it was found that there were a lot of blood streaks on the brain surface of the PBS group, while no such significant pathological changes were observed on the brain surface of the r-LAB-I3 group. In addition, for lung tissue, bleeding spots were clearly visible in the PBS group and CICC6240 group compared with the Mock group and r-LAB-I3 group. In the observation of liver tissue, the liver surface of the PBS group and CICC6240 group was dark brown with bleeding spots, while no similar pathological changes were found in the r-LAB-I3 group ( Figure 6 (A).

[0121] In the microscopic observation of the pathological sections made from the various organs of the mice, the brain tissue sections of the PBS group and the CICC6240 group showed cord-like arrangements of red blood cells, while this phenomenon was almost not observed in the r-LAB-I3 group. In terms of lung tissue, inflammatory cell infiltration was observed in the sections of the PBS group and the CICC6240 group, while such inflammatory phenomena were not found in the lung tissue sections of the r-LAB-I3 group. The observation results of liver tissue showed that a large number of red blood cells were aggregated in the PBS group and the CICC6240 group, while the corresponding phenomenon in the r-LAB-I3 group was significantly less ( Figure 6 (middle B).

[0122] Real-time fluorescence quantitative PCR (QPCR) was used to analyze the viral copy number in the brain, lung, spleen and liver of each group of mice. GAPDH of the samples was used as an internal reference. -ΔΔct The results are as follows: Figure 7 As shown, the viral load of organs in the r-LAB-I3 group was significantly reduced. RNA was extracted from the brain, lung, spleen and liver tissues of mice and reverse transcribed into cDNA. Subsequently, the relative transcription levels of mRNA of IL-1β, IL-10, TNF-α and IFN-γ were detected by real-time fluorescence quantitative PCR (QPCR). The results showed that there was no significant change in the level of IFN-γ in the spleen of mice treated with r-LAB-I3, but its level was significantly decreased in other tissues. In addition, the relative transcription levels of mRNA of IL-1β, IL-10 and TNF-α in various organs of the r-LAB-I3 group also showed varying degrees of reduction. Specifically: Among the four tissues, except for the spleen, the PBS group had the highest relative transcription level of IL-1β in the brain, lung and liver tissues. Compared with the PBS group and the CICC6240 group, the relative transcription levels of IL-1β in the brain, lung and spleen of the r-LAB-I3 group were significantly reduced. Although the relative transcription level of IL-1β in the liver group was not significantly different from that in the CICC6240 group, it was still significantly decreased compared with the PBS group. After detecting the relative transcription level of IL-10, it was found that the relative transcription level of IL-10 in the four tissues of the r-LAB-I3 group was significantly reduced, while the relative transcription level of IL-10 in the brain, lung and liver of the CICC6240 group was the highest. In terms of the relative transcription level of TNF-α, there was no significant difference in the lung tissues of the four groups of mice, but in the brain, spleen and liver, the relative transcription level of TNF-α in the r-LAB-I3 group was significantly lower than that in the PBS group and the CICC6240 group. No significant difference was observed in the relative transcription level of IFN-γ in the spleen, but in the brain, lung, and liver, the relative transcription level of IFN-γ in the r-LAB-I3 group was still significantly lower than that in the PBS group and the CICC6240 group ( Figure 7 ).

[0123] Western blot was performed to extract the brain, lung, spleen and liver tissue proteins of mice, and the relative expression of IL-1β and IL-10 proteins in the tissues was analyzed. The experimental results are as follows: Figure 8 As shown in the figure, in the lung and liver, the IL-1β protein expression level of the r-LAB-I3 group was significantly lower than that of the PBS group and the CICC6240 group. At the same time, in the brain and spleen, the IL-10 protein expression level of the r-LAB-I3 group was also significantly lower than that of the PBS group and the CICC6240 group.

[0124] 16. Intragastric administration and virus challenge of recombinant Lactococcus lactis CICC6240 / pMG36e-IFTIM3 in piglets;

[0125] CICC6240 lactic acid bacteria and recombinant lactic acid bacteria CICC6240 / pMG36e-IFITM3 were cultured in MRS liquid medium until OD 600 =0.3, add nisin inducer and induce for 12 hours, then take 50mL of bacterial solution (plate count 3.2×10 12 CFU / mL), centrifuged at 4℃12000×g for 5min, discarded the supernatant, washed three times with saline, and finally resuspended with 200μL PBS. Twenty-four 1-week-old Landrace piglets were pre-fed for one week. On the 8th day, PBS, CICC6240 bacterial solution and r-LAB-I3 bacterial solution were gavaged. After three consecutive days of gavage, the piglets were orally gavaged with TGEV on the 11th day. The surviving piglets were uniformly killed on the 20th day. The experimental groups, gavage and challenge schemes are shown in Table 3.

[0126] Table 3 Piglet experimental grouping

[0127] Grouping Oral administration (50 mL) <![CDATA[Oral (1×10 8 )]]> Quantity (pcs) Blank(Mock) none none 6 Phosphate buffered saline (PBS) PBS 10mlTGEV 6 Lactococcus lactis (CICC6240) CICC6240 bacterial liquid 10mlTGEV 6 Recombinant lactic acid bacteria (r-LAB-I3) r-LAB-I3 bacterial liquid 10mlTGEV 6

[0128] 17. Effects of recombinant lactococcus lactis CICC6240 / pMG36e-IFTIM3 on piglet weight, mortality and organ index;

[0129] After one week of pre-feeding, the piglets were gavaged and weighed at a fixed time every day from the beginning of gavage, and the weight changes of each group of piglets were recorded. The mental state, physical appearance, and behavior of the piglets were observed, and the deaths of the piglets in each group were recorded. Finally, the survival rate of the piglets in each group was calculated after statistics. If a dead piglet was found, it was immediately dissected and its heart, liver, spleen, lung, kidney, duodenum, jejunum, ileum, inguinal lymph nodes, and spleen were completely removed, washed with saline, and weighed.

[0130] The experimental results are as follows Fig. 9 As shown, compared with the PBS group and CICC6240 group, the piglets in the r-LAB-I3 group showed milder body temperature and clinical symptoms, and the survival rate was significantly improved.

[0131] 18. Pathological tissue sections of piglets;

[0132] After the dissected piglet tissues were removed, they were rinsed with saline, and then a portion of each tissue was immediately cut and placed in 4% formaldehyde fixative for one week. The tissues were removed and cut into slices of about 2 mm, and then HE staining was performed. Fig.10 As shown, the r-LAB-I3 group had significantly fewer inflammatory cells in the jejunum and ileum tissues and the largest number of intestinal villi.

[0133] 19. Extraction and reverse transcription of RNA from piglet tissues;

[0134] The piglet tissues stored at -80°C were thawed on ice, and the same mass of each tissue in each group was weighed and placed in a 2 mL RNase-free centrifuge tube, and 0.5 mL TraPBS ZolUp, 0.2 ml RNA Extraction Agent and 2 to 3 RNase-free grinding beads were added.

[0135] 20. Real-time fluorescence quantitative PCR of piglet tissue (absolute quantification);

[0136] The concentration of the standard plasmid containing the TGEV-specific amplified fragment stored in the laboratory was determined, and the standard plasmid was diluted to 10 -9 Then, QPCR detection is performed together with the sample to obtain a standard curve, and then the sample copy number is calculated based on the standard curve.

[0137] Table 4 QPCR detection primers

[0138] Name Sequence(5′-3′) SEQ ID No. TGEV-F GGGCCAACGTAAAGAGCTTC 15 TGEV--R GCAACCCAGACAACTCCATCTA 16 IL-1β-F GAGCATCAGGCAGATGGTGT 17 IL-1β-R AAGGATGATGGGCTCTTCTTC 18 IL-10-F GCTCTTACTGACTGGCATGAC 19 IL-10-R CGCAGCTCTAGGAGCATGTG 20 TNF-α-F ATGAGCACTGAGAGCATGATCCG 21 TNF-α-R CCTCGAAGTGCAGTAGGCAGA 22 IL-6-F AAGCGCCTTCAGTCCAGT 23 IL-6-R GGCATCACCTTTGGCATCT 24 GAPDH-F AGGGCATCCTGGGCTACACT 25 GAPDH-R TCCACCACCCTGTTGCTGTA 26

[0139] Real-time fluorescence quantitative PCR (QPCR) was used to analyze the viral copy number in the duodenum, jejunum, ileum, stomach, kidney, spleen and liver of each group of piglets. Fig.11 As shown, the viral load of organs in the r-LAB-I3 group was significantly reduced. Then the relative transcription levels of IL-1β, IL-10, TNF-α and IL-6 mRNA were detected. The results showed that the relative transcription levels of IL-6, IL-1β, IL-10 and TNF-α in various organs of the r-LAB-I3 group also showed different degrees of reduction.

[0140] 21. Fluorescence quantitative PCR (relative quantification) of piglet tissues;

[0141] The cDNA obtained by reverse transcription was used as a template, and QPCR primers for GAPDH, IL-1β, IL-10, TNF-α, and IL-6 were designed, followed by QPCR amplification. The relative expression levels of IL-1β and IL-10 were detected, and the results were as follows: Fig.12 As shown, the relative expression of inflammatory factors in the tissues of the r-LAB-I3 group was significantly decreased.

[0142] 22. Preparation of protein samples from piglet tissues and Western blot detection;

[0143] Preparation of animal tissue protein samples

[0144] (1) Weigh 50 mg of tissue, add 1 mL of RIPA lysis buffer, 10 μL of PMSF and 20 μL of protease inhibitor, then add 2 grinding beads, and then place in a biological sample homogenizer for homogenization;

[0145] (2) Remove the grinding beads, transfer the homogenate to a 1.5 mL centrifuge tube, and vortex;

[0146] (3) Place the cells in an ice bath for 30 min, pipetting repeatedly every 10 min to ensure complete lysis of the tissue cells;

[0147] (4) Centrifuge at 12000 × g for 5 min and collect the supernatant as the total protein solution;

[0148] (5) Take 80 μL and add 20 μL 5×SDS buffer, boil in water bath for 10 min, and store at -20℃. Preparation of animal tissue protein samples

[0149] (6) Weigh 50 mg of tissue, add 1 mL of RIPA lysis buffer, 10 μL of PMSF and 20 μL of protease inhibitor, then add 2 grinding beads, and then place in a biological sample homogenizer for homogenization;

[0150] (7) Remove the grinding beads, transfer the homogenate to a 1.5 mL centrifuge tube, and vortex;

[0151] (8) Incubate on ice for 30 min, pipetting every 10 min to completely lyse tissue cells;

[0152] (9) Centrifuge at 12000 × g for 5 min and collect the supernatant as the total protein solution;

[0153] (10) Take 80 μL and add 20 μL 5×SDS buffer, boil in water bath for 10 min, load 10 uL sample, adjust voltage to 80 V for 30 min to run the concentrated gel, and then adjust to 120 V for 1 h until the end of electrophoresis. After the electrophoresis is completed, remove the gel for transfer, soak the transfer filter paper and PVDF membrane in transfer buffer, stack the wet filter screen, 4 layers of transfer filter paper, gel, PVDF membrane, 4 layers of filter paper and filter screen on the negative electrode surface of the carbon plate, and insert the clamp into the electrophoresis tank, voltage 80 V, 80 min. After the transfer, the membrane was immersed in 5% skim milk powder and blocked on a horizontal shaker at room temperature for 3 hours; washed with PBST 3 times, 10 minutes each time; incubated with mouse FLAG tag antibody (1:5000) diluted with PBST as the primary antibody for 2 hours; washed with PBST 3 times, 10 minutes each time; incubated with HRP-labeled goat anti-mouse IgG (1:5000) as the secondary antibody for 1 hour: washed with PBST 3 times, 10 minutes each time; finally, developed with ECL luminescent liquid until clear bands appeared, and detected with a protein chemical imaging luminometer. Western blot was performed to extract the duodenum, jejunum, and ileum tissue proteins of piglets. The results are as follows: Fig.12 As shown, the relative expression of inflammatory factors in the tissues of the r-LAB-I3 group was significantly decreased.

[0154] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A recombinant Lactobacillus plantarum vector of porcine interferon-induced transmembrane protein 3, characterized in that: The basic vector skeleton of the recombinant Lactobacillus plantarum vector includes pMG36e.

2. The recombinant Lactobacillus plantarum vector according to claim 1, characterized in that The primer pair for amplifying the porcine interferon-induced transmembrane protein 3 includes an upstream primer shown in SEQ ID No.1 and a downstream primer shown in SEQ ID No.

2.

3. The recombinant Lactobacillus plantarum vector according to claim 2, characterized in that The gene fragment of the porcine interferon-induced transmembrane protein 3 is inserted between the KpnⅠ restriction site and the XbaⅠ restriction site of pMG36e.

4. The method for constructing the recombinant Lactobacillus plantarum vector according to any one of claims 1 to 3, characterized in that: The following steps are involved: (1) using cDNA obtained by reverse transcription of RNA extracted from pig kidney cells as a template, amplifying using primers shown in SEQ ID No. 1 and SEQ ID No. 2 to obtain an IFITM3 DNA fragment; (2) adding a KpnⅠ restriction site and a FLAG tag to the 5' end of the IFITM3 DNA fragment in step (1), adding an XbaⅠ restriction site to the 3' end, and performing double restriction digestion with KpnⅠ and XbaⅠ; (3) Connecting the double-digested fragment in step (2) with the pMG36e plasmid linearized after double-digestion with KpnⅠ and XbaⅠ to obtain the recombinant Lactobacillus plantarum vector.

5. The expression method of the recombinant Lactobacillus plantarum vector according to any one of claims 1 to 3, characterized in that: The method comprises transforming the recombinant plant lactobacillus vector into competent Escherichia coli cells, and culturing and expressing the recombinant Escherichia coli.

6. The expression method according to claim 5, characterized in that: The culturing included culturing on a resistance LB plate containing 50 μg / mL erythromycin.

7. A recombinant Lactobacillus plantarum comprising the recombinant Lactobacillus plantarum vector according to any one of claims 1 to 3.

8. The recombinant Lactobacillus plantarum according to claim 7, characterized in that The method comprises transforming the recombinant lactobacillus plantarum vector into a lactobacillus plantarum competent cell, and culturing and expressing the recombinant lactobacillus plantarum.

9. Use of the recombinant Lactobacillus plantarum according to claim 7 or 8 in preparing animal challenge test materials.

10. Use of the recombinant Lactobacillus plantarum according to claim 7 or 8 or the porcine interferon-induced transmembrane protein 3 expressed by the method according to claim 5 or 6 in the preparation of oral lactic acid bacteria vaccines.

Images