Targeted NGS library establishment kit for detecting BCR-ABL tyrosine kinase region mutation by using multiple PCR method

Abstract

The invention provides a targeted NGS library construction method and a kit for detecting BCR-ABL tyrosine kinase region mutation by utilizing a multiple PCR (Polymerase Chain Reaction) method. All mutation conditions of the BCR-ABL tyrosine kinase region in a clinical sample can be rapidly obtained through one-time detection, meanwhile, the kit is easy and convenient to operate and low in time consumption, automatic detection is extremely easy to achieve, all mutation sites of the BCR-ABL tyrosine kinase region can be rapidly found clinically in an auxiliary mode, and the detection accuracy is high. The kit can be used for monitoring the conditions of patients with chronic myelogenous leukemia (CML) and partial acute lymphoblastic leukemia (ALL), provides more accurate treatment, and is wide in clinical application prospect and convenient to popularize.

Description

Technical Field

[0001] The present invention relates to a targeted NGS library construction kit for detecting BCR-ABL tyrosine kinase region mutations by using a multiplex PCR method. Background Art

[0002] BCR-ABL tyrosine kinase region mutations are the main reason for the resistance of patients with chronic myeloid leukemia (CML) and some acute lymphoblastic leukemia (ALL) to tyrosine kinase inhibitors (TKIs). These mutations occur in the tyrosine kinase domain of the BCR-ABL fusion gene, leading to the continuous activation of the ABL protein, thus causing drug resistance.

[0003] Next-generation sequencing (NGS) technology has significant clinical application value in detecting mutations in the BCR-ABL tyrosine kinase region. NGS technology can provide high-throughput sequencing data. Compared with the traditional Sanger sequencing method, it can more efficiently detect mutations in the BCR-ABL tyrosine kinase region, including point mutations, insertions, and deletions. This makes NGS an ideal tool for identifying mutations in the BCR-ABL tyrosine kinase region, which helps guide clinical treatment decisions and optimize patient treatment plans.

[0004] In clinical practice, the application of NGS detection of BCR-ABL tyrosine kinase mutations includes but is not limited to: monitoring the molecular response of CML and Ph+ALL patients during TKI treatment and timely detection of drug-resistant mutations. Providing personalized treatment recommendations for TKI-resistant patients and selecting the most appropriate second-line TKI or other treatment strategies. Evaluating treatment effects and predicting disease progression provide a molecular basis for clinical decision-making.

[0005] With the development of NGS technology, its ability to detect low-frequency mutations is also constantly improving, which is of great significance for early detection of drug-resistant clones and guiding early intervention. In the future, with the advancement of technology and the reduction of costs, NGS is expected to become a routine method for detecting mutations in the tyrosine kinase region of BCR-ABL, providing more accurate guidance for the treatment of CML and Ph+ALL patients. However, NGS technology also faces some challenges in detecting mutations in the tyrosine kinase region of BCR-ABL, including sample quality, data analysis, and sensitivity of mutation detection.

[0006] The present invention sets strict quality control for each link such as sample collection, nucleic acid extraction, cDNA preparation, library construction, selection of sequencing platform and data analysis when detecting mutations in the BCR-ABL tyrosine kinase region. It aims to achieve standardization of laboratory testing, ensure the accuracy and reliability of the results, and serve as one of the necessary bases for formulating treatment plans for CML and Ph+ALL. It can detect mutations as low as 3% of VAF, thereby guiding the clinic to take corresponding treatment measures as early as possible. The present invention significantly improves the sensitivity of ABL kinase mutation detection and the detection ability of compound mutations, and further improves the treatment level of CML and Ph+ALL. Summary of the invention

[0007] The present invention describes a targeted NGS library construction kit for detecting mutations in the BCR-ABL tyrosine kinase region by a multiplex PCR method. Using extremely low starting amounts of genomic RNA as a template, the designed specific multiplex PCR primers are used to simultaneously amplify all fusion types of the BCR-ABL fusion gene and multiple target regions of the housekeeping gene GADPH to obtain amplicon products. After magnetic bead purification, the products are subjected to a second step of enzyme cutting, linker addition, and magnetic bead purification to obtain a PCR-Free library. The library is quantified, quality inspected, and sequenced on a machine. After the sequencing data is downloaded from the machine, the detection of mutations in the BCR-ABL tyrosine kinase region can be quickly completed by bioinformatics analysis and comparison and by using an independently constructed bioinformatics analysis process.

[0008] The present invention provides a multiple primer set for detecting mutation targeting in the tyrosine kinase region of BCR-ABL, comprising at least one of the primers of the sequences described in SEQ ID NOs 1 to 4;

[0009] Sequence number Primer sequences SEQ ID 1 ACCGCATGTTCCGGGACAAAAG SEQ ID 2 GGGAGCAATGGAGACACG SEQ ID 3 CTGCTCCTCCTGTTCGACAGT SEQ ID 4 CATGACAAGGTGCGGCTCCC .

[0010] Furthermore, the multiple primer set consists of primers with sequences shown in SEQ ID NOs 1 to 4.

[0011] The present invention also provides a targeted NGS library construction kit for detecting BCR-ABL tyrosine kinase region mutations using a multiplex PCR method. The library construction kit comprises a multiplex primer set, and the multiplex primer set consists of primers with sequences shown in SEQ ID NOs 1 to 4.

[0012] The present invention also provides an application of a targeted NGS library construction kit for detecting BCR-ABL tyrosine kinase region mutations by using a multiplex PCR method in detecting BCR-ABL tyrosine kinase region mutations.

[0013] The present invention also provides a method for detecting mutations in the BCR-ABL tyrosine kinase region, the method using a library construction kit, the method comprising the following steps:

[0014] (1) extracting DNA from the sample to be tested;

[0015] (2) The DNA of the sample to be tested is subjected to a multiplex PCR reaction using a multiplex primer set, and the obtained multiplex PCR reaction products are subjected to a linker sequence PCR reaction to obtain a targeted NGS library; the multiplex primer set is composed of primers with sequences shown in SEQ ID NOs 1 to 4;

[0016] (3) The targeted NGS library was sequenced and all mutation sites in the BCR-ABL tyrosine kinase region in the sample were detected based on the sequencing results.

[0017] Compared with the prior art, the technical solution of the present invention has the following advantages:

[0018] The library construction kit manufactured by the present invention can detect all mutations in the BCR-ABL tyrosine kinase region by multiple PCR method; only a trace amount of genomic RNA is needed to construct the NGS library, and the starting amount of RNA template can be as low as 100 ng; by designing specific multiple PCR primers, all fusion types of BCR-ABL fusion genes and multiple target regions of the housekeeping gene GADPH are amplified in one system, and then the purified amplified products are cut by enzymes, and then adapters are added and magnetic beads are purified to quickly complete the construction of the targeted PCR-Free library, and finally the library fragment size is 300 The kit is about 100 bp long and is compatible with various Illumina sequencing platforms for sequencing. Through the simple and easy-to-use NGS sequencing-by-synthesis solution, it can realize rapid and accurate detection of all possible mutations in the BCR-ABL tyrosine kinase region. At the same time, this kit is easy to operate, time-saving, reproducible, and easy to realize automated detection. It can assist the clinic to quickly find the mutation sites that cause the BCR-ABL tyrosine kinase region, monitor the condition of patients with chronic myeloid leukemia (CML) and some acute lymphocytic leukemia (ALL), provide more accurate treatment, and has broad prospects for clinical application and is easy to promote. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the electrophoresis diagram of the multiplex PCR products in Example 2.

[0020] Figure 2 This is the fragment analysis result of the library constructed in Example 2. DETAILED DESCRIPTION

[0021] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0022] Example 1: Construction of a library

[0023] 1. RNA Reverse Transcription

[0024] Take out the required components of 10×RT Mix, HiScript III Enzyme Mix, and Random Hexamers (Novozyme, Catalog No. R312-01), thaw on ice, mix by inverting and centrifuging briefly after fully thawing, and place on ice.

[0025] 1.1 Template denaturation

[0026] Take 8ul of RNA extraction product and put it in a PCR tube, place it in a PCR instrument, set the hot cover to 105°C, and run the following program: 65°C---5min, cool on ice for 2min.

[0027] 1.2 cDNA synthesis

[0028] Prepare the system shown in Table 1 on ice:

[0029] Table 1

[0030] Components volume Previous step product 8ul 10×RT Mix (Novozyme, R312) 2ul HiScript III Enzyme Mix (Novozyme, R312) 2ul Random Hexamers (Novozymes, R312) 1ul RNase-free ddH2O (Novozyme, R312) 7ul Total 20ul

[0031] ▲If white precipitate appears after 10×RT Mix melts, please invert repeatedly at room temperature to mix thoroughly and use after the precipitate is completely dissolved.

[0032] Place the PCR tube in a PCR instrument, set the heated cover to 105°C, and run the following program in Table 2:

[0033] Table 2

[0034] temperature time 25℃ 5min 37℃ 45min 85℃ 5sec 4℃ Hold

[0035] ▲The product can be used immediately for PCR reaction, or stored at -20℃ and used within six months to avoid repeated freezing and thawing. 2. The first round of multiplex PCR: targeted amplification

[0036] 2.1 Take out the AL Primer pool and 2×Phanta UniFi Master Mix (Novozyme, Cat. No. P516) in the kit from the -20℃ refrigerator in advance, place them on an ice box to melt, vortex briefly to mix and centrifuge them instantly, and place them on an ice box for later use.

[0037] The AL Primer pool multiplex PCR primer sequences are as follows in Table 3:

[0038] Table 3

[0039] Sequence number Primer sequences Primer length (bp) GC% TM℃ SEQ ID 1 ACCGCATGTTCCGGGACAAAAG 22 54.50％ 60.23 SEQ ID 2 GGGAGCAATGGAGACACG 18 61.10％ 55.17 SEQ ID 3 CTGCTCCTCCTGTTCGACAGT 21 57.10％ 60.21 SEQ ID 4 CATGACAAGGTGCGGCTCCC 20 65.00％ 60.45

[0040] 2.2 Calculate the number of PCR reactions and prepare PCR premix: The volume of reagents to be added to each PCR reaction system is shown in Table 4 below:

[0041] Table 4

[0042] Reagent name Dosage(ul) AL Primer pool 4 2×Phanta UniFi Master Mix 25 H2O 20 Total 49

[0043] 2.3 Take a clean 1.5ml centrifuge tube, calculate the amount of various reagents required for the PCR reaction of all samples according to the table above, and then add each reagent to the 1.5ml centrifuge tube in order to prepare the PCR premix. Keep the centrifuge tube on ice during the preparation process. When preparing the reaction premix, it is necessary to increase the reagent volume appropriately according to the number of reactions to ensure that the premix is ​​sufficient for aliquoting.

[0044] 2.4 Oscillate the centrifuge tube containing the premix on an oscillator for 10 seconds and centrifuge it instantaneously to avoid bubbles. Dispense 49ul of the premix into each well of a 96-well plate or eight-well tube strip.

[0045] 2.5 Add template: Add 1ul of the corresponding reverse transcription product to each reaction well of a 96-well plate or eight-well tube strip.

[0046] 2.6 Seal the plate and mix: Use sealing film or eight-strip PCR reaction tube cover to gently seal the PCR reaction plate or eight-strip PCR reaction tube, and vortex mix for 15 seconds.

[0047] 2.7 Centrifugation: Centrifuge the PCR reaction plate or eight-tube strip briefly to remove bubbles in the reaction solution before amplification. The amplification primer is the AL Primer pool in 2.1.

[0048] 2.8 Run PCR: Turn on the PCR instrument, wait until the temperature of the heated cover reaches 105°C, place the PCR reaction plate or eight-tube strip in the PCR instrument, and run the following program in Table 5:

[0049] Table 5

[0050]

[0051]

[0052] Note: Do not keep the PCR reaction products at 8°C overnight. Otherwise, precipitation may occur in the PCR products.

[0053] 2.9 Carry out the next experiment within half an hour after the PCR is completed.

[0054] 3. PCR Product Purification

[0055] 3.1 Preparation before purification:

[0056] a) Take out the nucleic acid purification reagent magnetic bead solution (Novozyme, catalog number N411-02) from the 4°C refrigerator, vortex and resuspend the magnetic beads, then place them at room temperature for 25-30 minutes to equilibrate the magnetic beads, and vortex and resuspend the magnetic beads before use to ensure that the magnetic beads are uniform and have a consistent concentration.

[0057] Note: Before purification, be sure to allow the magnetic bead solution to equilibrate to room temperature. The temperature of the magnetic bead solution will affect the purification effect.

[0058] b) The purified magnetic bead suspension equilibrated at room temperature was shaken for 1 min and dispensed into each well of a 96-well plate at a rate of 40 μL (0.8 times the sample volume) per sample.

[0059] c) Then, according to the sample volume, freshly prepare 80% ethanol for washing the magnetic beads with anhydrous ethanol and Nuclease-Free Water in advance, 800ul / sample, and place it at room temperature for use.

[0060] d) Aliquot 2 ml of Nuclease-Free Water into 2 ml centrifuge tubes.

[0061] 3.2 After the first step of the multiplex PCR reaction is completed, remove the PCR reaction plate or eight-tube strip from the PCR instrument, centrifuge it instantly to allow the side droplets to fall to the bottom of the well, and then carefully remove the sealing film or tube cap of the PCR reaction plate or eight-tube strip.

[0062] 3.3 Adding magnetic beads to samples: Number each well of the 96-well plate containing magnetic beads, transfer all products in the PCR reaction tube to the magnetic beads in the corresponding wells in turn, and use a pipette to slowly pipette 50 times. Avoid bubbles in the wells during the pipetting process.

[0063] 3.4 Product binding: Incubate the 96-well plate at room temperature for 5 minutes.

[0064] 3.5 Separation of magnetic beads: Place the 96-well plate on a 96-well magnetic stand for 3 minutes until the solution becomes clear.

[0065] 3.6 Remove the supernatant completely: Carefully aspirate the supernatant in each well, while being careful not to touch the magnetic beads.

[0066] 3.7 Washing the magnetic beads: Keep the 96-well plate on the magnetic stand. Add 180ul of freshly prepared 80% ethanol to each well in turn, then use a pipette to pipette 8 times in the opposite direction of the magnetic beads. After incubation for 30 seconds, remove all the supernatant. Be careful not to touch the magnetic beads. Note: Try to avoid contact between 80% ethanol and air. Long-term contact with air will cause the ethanol concentration to change, affecting the effect of washing the magnetic beads. Prepare enough 80% ethanol each time.

[0067] 3.8 Second cleaning: Repeat the previous step.

[0068] 3.9 Keep the PCR plate on the magnetic stand and carefully use a 10μL pipette to remove the ethanol remaining at the bottom, being careful not to suck up the magnetic beads. Note: Thoroughly remove the ethanol in each tube.

[0069] 3.10 Drying of magnetic beads: Keep the PCR plate on the magnetic rack at room temperature for 5 minutes until all the remaining ethanol evaporates. Note: Do not over-dry the magnetic beads. Over-dried magnetic beads will have cracks and will not be easy to suspend.

[0070] 3.11 Resuspend the magnetic beads: Remove the PCR plate from the magnetic stand. Add 50ul Nuclease-Free Water to each well in turn, and use a pipette to slowly pipette 50 times to resuspend the magnetic beads. Avoid bubbles in the wells during the pipetting process. If bubbles are generated at the bottom of the tube, use a pipette to remove the bubbles at the bottom. Then place the PCR plate at room temperature for 5 minutes to elute the PCR product.

[0071] 3.12 Place the centrifuge tube on the magnetic rack for 2 minutes until the solution becomes clear.

[0072] 3.13 If the next PCR reaction is not performed, 45 μL of supernatant can be aspirated with a pipette and transferred to a new PCR tube. The supernatant in the tube is the purified multiple PCR product. Mark it and store it in a -20℃ refrigerator.

[0073] 4. Enzyme Cutting

[0074] 4.1 Take out FEA Enzyme Mix V3 (Novozyme, ND637), thaw and mix, centrifuge briefly to collect the liquid at the bottom of the tube, and place it on ice for later use. All the following steps are performed on ice.

[0075] 4.2 Prepare the reagents listed in Table 6 in a new 96-well plate or eight-well tube strip:

[0076] Table 6

[0077]

[0078] 4.3 Seal the plate and mix: Use sealing film or eight-tube PCR reaction tube cover to gently seal the PCR reaction plate or eight-tube strips, and vortex mix for 15 seconds.

[0079] 4.4 Centrifugation: Centrifuge the PCR reaction plate or eight-tube strip briefly to remove bubbles in the reaction solution.

[0080] 4.5 Run PCR: Place the PCR reaction plate or eight-tube strip in the PCR instrument. After the temperature of the heated cover reaches 105°C, run the program in Table 7 below:

[0081] Table 7

[0082] Temp Time 30℃ 5min 72℃ 5min 4℃ Hold

[0083] 4.6 After the reaction is completed, proceed to the next step of the experiment immediately.

[0084] 5. Connector connection

[0085] 5.1 In this step, Adapter (Novozyme, N34201) will be connected to the ends of the unrepaired products in the previous step.

[0086] 5.2 Take out Rapid Ligation Buffer V3 and Rapid DNA Ligase V3 (Norvozyme, ND637) from -20℃, thaw and mix, centrifuge briefly to collect to the bottom of the tube, and place on ice for later use.

[0087] 5.3 Prepare the reaction system according to Table 8 below:

[0088] Table 8

[0089] Reagent name Dosage(ul) Previous step product 60 Rapid Ligation Buffer V3 30 Rapid DNA Ligase V3 5 DNA Adapter X 5

[0090] 5.4 Mix and seal the plate: Use a pipette to gently blow and mix, and gently seal the PCR reaction plate or eight-tube strip with a sealing film or eight-tube strip cover.

[0091] 5.5 Centrifugation: Centrifuge the PCR reaction plate or eight-tube strip briefly to remove bubbles in the reaction solution.

[0092] 5.6 Run PCR: Place the PCR reaction plate or eight-tube strip in the PCR instrument. After the temperature of the heated cover reaches 105°C, run the following program in Table 9:

[0093] Table 9

[0094] Temp Time 20℃ 5min 4℃ Hold

[0095] 5.7 After the reaction is completed, proceed to the next step of the experiment immediately.

[0096] 6. Magnetic Bead Purification

[0097] 6.1 Preparation before purification:

[0098] 6.1.1 Take out the nucleic acid purification reagent magnetic bead solution (Novozyme, catalog number N411-02) from the 4℃ refrigerator, vortex and resuspend the magnetic beads, then place them at room temperature for 25-30 minutes to balance the magnetic beads, and vortex and resuspend the magnetic beads before use to ensure that the magnetic beads are uniform and the concentration is consistent. Note: Be sure to balance the magnetic bead solution to room temperature before purification. The temperature of the magnetic bead solution will affect the purification effect.

[0099] 6.1.2 Vortex the purified magnetic bead suspension equilibrated at room temperature for 1 min and dispense 80 μL (0.8 times the sample volume) / sample into each well of a 96-well plate.

[0100] 6.1.3 Then, according to the sample volume, prepare 80% ethanol for washing the magnetic beads with anhydrous ethanol and Nuclease-Free Water in advance, 800ul / sample, and place it at room temperature for use.

[0101] 6.1.4 Aliquot 2 ml of Nuclease-Free Water into 2 ml centrifuge tubes.

[0102] 6.2 After the connector is connected, take out the PCR reaction plate or eight-tube strip from the PCR instrument, centrifuge it instantly to let the side wall droplets fall to the bottom of the well, and then carefully remove the sealing film or tube cap of the PCR reaction plate or eight-tube strip.

[0103] 6.3 Adding magnetic beads to samples: Number each well of the 96-well plate containing magnetic beads, transfer all products in the PCR reaction tube to the magnetic beads in the corresponding wells in turn, and use a pipette to slowly pipette 50 times. Avoid bubbles in the wells during the pipetting process.

[0104] 6.4 Product binding: Incubate the 96-well plate at room temperature for 5 minutes.

[0105] 6.5 Separation of magnetic beads: Place the 96-well plate on a 96-well magnetic stand for 3 minutes until the solution becomes clear.

[0106] 6.6 Remove the supernatant completely: Carefully aspirate the supernatant in each well, while being careful not to touch the magnetic beads.

[0107] 6.7 Washing the magnetic beads: Keep the 96-well plate on the magnetic stand. Add 180ul of freshly prepared 80% ethanol to each well in turn, then use a pipette to pipette 8 times in the opposite direction of the magnetic beads. After incubation for 30 seconds, remove all the supernatant. Be careful not to touch the magnetic beads. Note: Try to avoid contact between 80% ethanol and air. Long-term contact with air will cause the ethanol concentration to change, affecting the effect of washing the magnetic beads. Prepare enough 80% ethanol each time.

[0108] 6.8 Second cleaning: Repeat the previous step.

[0109] 6.9 Keep the PCR plate on the magnetic stand and carefully use a 10μL pipette to remove the ethanol remaining at the bottom, being careful not to suck up the magnetic beads. Note: Thoroughly remove the ethanol in each tube.

[0110] 6.10 Drying of magnetic beads: Keep the PCR plate on the magnetic rack at room temperature for 5 minutes until all the remaining ethanol evaporates. Note: Do not over-dry the magnetic beads. Over-dried magnetic beads will have cracks and will not be easy to suspend.

[0111] 6.11 Resuspend the magnetic beads: Remove the PCR plate from the magnetic stand. Add 24ul Nuclease-Free Water to each well in turn, and use a pipette to slowly pipette 50 times to resuspend the magnetic beads. Avoid bubbles in the wells during the pipetting process. If bubbles are generated at the bottom of the tube, use a pipette to remove the bubbles at the bottom. Then place the PCR plate at room temperature for 5 minutes to elute the PCR product.

[0112] 6.12 Magnetic bead separation: Place the PCR plate on a magnetic stand at room temperature for 2 minutes until the solution is clear. Transfer 20ul of supernatant to a new 0.5ml centrifuge tube with the corresponding label. During the standing period, prepare the solution required for the next step of library quantification.

[0113] 7. Library quality control

[0114] 7.1 The constructed library is quantified using Qubit, and the library concentration is required to be ≥1ng / ul.

[0115] 7.2 Calculate molar concentration: According to 1ng / ul is equivalent to 4.33nM, convert the original concentration (ng / ul) of each library into molar concentration (nM). -1 x[4.33nM·ng -1 ul] = [Z nM] (Y is the Qubit display concentration, Z is the library molar concentration)

[0116] 7.3 The remaining library tubes are labeled with the library numbers and can be stored at 4°C for up to three days, or at -20°C for long term storage.

[0117] 7.4 Library quality control. Use a fragment analyzer or electrophoresis to sample the library. The fragment size of a qualified library should be ~300 bp.

[0118] 8. Library dilution, denaturation and sequencing

[0119] Thaw the NextSeq500 reagent cartridge and hybridization buffer HT1 in a room temperature water bath 1 hour in advance.

[0120] 8.1 Dilute the library to 5 nM: Take out a portion of each library (such as 4 ul) and dilute it to 5 nM with Nuclease-Free Water.

[0121] 8.2 Calculation formula: Library concentration before dilution × library volume before dilution = library concentration after dilution × library volume after dilution

[0122] (Z nM)*(4ul library) / (5nM) = library volume after dilution

[0123] Library volume after dilution – 4ul = volume of Nuclease-Free Water

[0124] 8.3 The diluted library can be stored at 4℃ overnight and used for sequencing the next day. Alternatively, it can be stored at -20℃ for a long time.

[0125] 8.4 Mixing and centrifugation: The diluted library (5 nM) was mixed by vortexing and centrifuged briefly.

[0126] 8.5 Mixed library: Take a new 1.5ml low-adsorption centrifuge tube and mark it. Take the same volume (such as 5ul) of each diluted library (5nM) into the centrifuge tube, shake to mix and centrifuge instantly.

[0127] 8.6 Prepare 0.2N NaOH solution: Take a new 1.5ml centrifuge tube and label it. Add 800ul Nuclease-Free Water and 200ul 1N NaOH solution. Shake to mix. If the existing 1N NaOH is more than one week old, it needs to be re-prepared. Add 500ul 10N NaOH to 4.5mL Nuclease-Free Water. Shake to mix.

[0128] 8.7 Library denaturation: Label a new 1.5 ml low-adhesion centrifuge tube for library denaturation.

[0129] 8.7.1 Take 5ul of the mixed library and add 5ul of freshly prepared 0.2N NaOH.

[0130] 8.7.2 Oscillate the above mixture for 10 seconds and centrifuge for 1 minute.

[0131] 8.7.3 Leave at room temperature for 5 minutes to denature the library.

[0132] 8.7.4 Add 5ul Tris-HCl (200mM) to the denatured library in the previous step.

[0133] 8.7.5 Gently shake the mixture, centrifuge it momentarily, and place it on ice.

[0134] 8.7.6 Add 985ul HT1 solution to the library in the previous step.

[0135] 8.7.7 Invert the mixture several times, centrifuge briefly to obtain a 25 pM library, and place on ice.

[0136] 8.8 Library dilution to 1.8pM: Label a new 1.5ml low-adsorption centrifuge tube for library dilution. Mix 101ul of the 25pM library from the previous step with 1299ul of HT1 solution. Invert the centrifuge tube several times, centrifuge briefly, and place on ice.

[0137] 8.9 Add the library to the cartridge: Take the NextSeq500 reagent cartridge out of the water, check that the reagents inside have completely melted, wipe the surface water stains with absorbent paper, and then gently invert it upside down 10 times to fully mix the reagents. Then place the cartridge on the laboratory bench and tap it several times to remove the bubbles at the bottom of the reagent. Use a clean 1000ul pipette tip to pierce the tin foil at the mouth of the Load Sample tube on the NextSeq cartridge. Use a clean pipette tip to absorb 1300ul of the above library mixture and add it to the cartridge. If there is liquid residue on the wall of the tube or bubbles at the bottom of the tube, gently tap the tube to ensure that the solution is added to the bottom of the tube.

[0138] 8.10 Run NextSeq: Sequence the library on the NextSeq platform, using the sequencing mode of SE50, index1=8, index2=8.

[0139] 8.11 After sequencing is completed, the data is analyzed by the bioinformatics analysis system.

[0140] Example 2 Clinical sample detection

[0141] Three whole blood samples of BCR-ABL tyrosine kinase region mutations with known clinical results were collected to detect the mutations in the BCR-ABL tyrosine kinase region of the three samples. Whole genome RNA of the four samples was extracted, and then multiplex PCR and library construction were performed according to the method described in Example 1, and amplification was successful (see Figure 1 ) and complete the library construction (see Figure 2 ), Figure 2 The fragment size of the constructed library is ~300bp, and the library is sequenced on an Illumina high-throughput sequencer with a sequencing parameter of PE: 2×150. After quality control of the data, the mutation of the BCR-ABL tyrosine kinase region of each sample was obtained by comparing and analyzing with the reference genome and other bioinformatics analysis methods. The results are shown in Tables 10 to 12, and the test results were verified by first-generation sequencing, with a compliance rate of 100%.

[0142] Table 10 Test results of positive sample 3297:

[0143] Fusion Type ABL KD mutation AF / CPY AD BCR-ABL1(B1;A2) Gly250Glu 80.3476 26872

[0144] Table 11 Test results of positive sample 49053:

[0145] Fusion Type ABL KD mutation AF / CPY AD BCR-ABL1(B14;A3) Glu255Lys 44.3054 17499

[0146] Table 12 Test results of negative sample 49162:

[0147] Fusion Type ABL KD mutation AF / CPY AD / / / /

[0148] It can be seen from the test results that the kit of the present invention can detect all mutation sites in the BCR-ABL tyrosine kinase region, and the extraction and library construction internal reference can also effectively detect. The multiplex PCR primers of the present invention can accurately capture the targeted target gene. The detection of conventional samples shows that the method and kit of the present invention can detect all mutation sites in the BCR-ABL tyrosine kinase region.

Claims

1. A multiple primer set for detecting mutations in the tyrosine kinase region of BCR-ABL, characterized in that: At least one of the primers comprising the sequences described in SEQ ID NOs 1 to 4; 。 2. The multiple primer set according to claim 2, wherein: The multiple primer set consists of primers with sequences shown in SEQ ID NOs 1-4.

3. A targeted NGS library construction kit for detecting BCR-ABL tyrosine kinase region mutations using multiplex PCR, characterized in that: The library construction kit comprises the multiple primer set as claimed in claim 2, and the multiple primer set consists of primers with sequences shown in SEQ ID NOs 1 to 4.

4. Use of the targeted NGS library construction kit for detecting BCR-ABL tyrosine kinase region mutations using multiplex PCR as claimed in claim 3 in detecting BCR-ABL tyrosine kinase region mutations.

5. A method for detecting mutations in the tyrosine kinase region of BCR-ABL, characterized in that: The method uses the library construction kit as claimed in claim 3, and the method comprises the following steps: (1) extracting DNA from the sample to be tested; (2) The DNA of the sample to be tested is subjected to a multiplex PCR reaction using a multiplex primer set, and the obtained multiplex PCR reaction products are subjected to a linker sequence PCR reaction to obtain a targeted NGS library; the multiplex primer set is composed of primers with sequences shown in SEQ ID NOs 1 to 4, wherein one pair of primers (SEQ ID 1 and 2) can amplify all fusion types of BCR-ABL, and another pair of primers (SEQ ID 3 and 4) amplifies the housekeeping gene GADPH, and monitors the entire system from RNA extraction, reverse transcription, multiplex PCR and library construction; (3) The targeted NGS library was sequenced and all mutation sites in the BCR-ABL tyrosine kinase region in the sample were detected based on the sequencing results.

Images