Klebsiella variicola engineering bacterium FB0006c as well as construction method and application thereof

Abstract

The invention discloses a Klebsiella variicola engineering bacterium FB0006c as well as a construction method and application of the Klebsiella variicola engineering bacterium FB0006c. The engineering bacterium FB0006 is based on a genome of Klebsiella variicola FB006, and a PgtHMGR fragment of a truncated 3-hydroxy-3-methylglutaryl monoacyl coenzyme A reductase gene (PgtHMGR) from a saccharomyces cerevisiae source is integrated on a spr gene locus. On the basis of Klebsiella variicola engineering bacteria FB0006, the Klebsiella variicola engineering bacteria FB0006c are obtained through a genetic engineering means, and the klebsiella variicola engineering bacteria FB0006c are fermented and cultured to prepare the meliosenin. The method disclosed by the invention is simple, good in effect and very good in economic value.

Description

Technical Field

[0001] The invention relates to the field of microbial genetic engineering, and in particular to an engineered Klebsiella variant FB0006c and a construction method and application thereof. Background Art

[0002] Azadirachtin is a limonoid compound that can repel insects by destroying the chemical receptors in the insects' mouthparts to make them refuse to feed, inhibiting the insects' growth and development, and inducing insect cell autophagy and apoptosis. It has obvious repellent and insecticidal effects on more than 200 species of pests. It is safer to use and has less pressure on the environment. It is currently recognized as the best biological pesticide in the world.

[0003] The content of azadirachtin in nature is very low. It exists in the seeds, leaves and bark of neem trees. The content of azadirachtin in the kernel is the highest, with a mass fraction of about 0.02%. When neem grows for 8 years and reaches the peak fruit-bearing period, the yield of seeds with endocarp is 30-50 kg. Neem is only suitable for growing in tropical areas. It is difficult to extract a large amount of azadirachtin from nature for large-scale commercial use.

[0004] Therefore, obtaining azadirachtin through chemical synthesis and biosynthesis has become a research hotspot. Chemical synthesis is limited by high cost and low yield, only 0.00015%; biosynthesis is limited by unknown synthesis pathways.

[0005] Based on previous research, the synthesis pathway of azadirachtin can be divided into three steps. The first step is to generate skeleton compounds. 2,3-Oxidized squalene has been shown to be a common precursor for the formation of steroids and triterpenes. It can generate different skeletons through the catalysis of 2,3-Oxidized squalene cyclase family (OSCs). In 2019, HODGSONH et al. identified AiOSC1 in the synthesis of azadirachtin by mining neem, neem and existing transcriptome information. AiOSC1 catalyzes 2,3-Oxidized squalene to generate tirucalla-7,24-dien-3β-ol, which is the starting triterpene skeleton for the synthesis of azadirachtin.

[0006] Subsequently, LIANX et al. identified a corresponding OSC gene in Melia azedarach, MtOSC1, which can also catalyze 2,3-oxidosqualene to produce tirucalla-7,24-dien-3β-ol.

[0007] The second step is the modification of the backbone compound, which involves demethylation, oxidation reactions involving multiple P450 enzymes, and esterification reactions involving acyltransferases. HODGSON H et al. also identified two P450 enzymes MaCYP71CD2 and MaCYP71BQ5 that can modify the backbone of azadirachtin. MaC-YP71CD2 is a multi-site oxidase that catalyzes C23 hydroxylation and oxygenation between C24 and C25 carbon-carbon bonds. MaCYP71BQ5 catalyzes the C21 hydroxylation of tirucalla-7,24-dien-3β-ol to form tirucal-la-7,24-dien-21,3β-diol.

[0008] The third step is the ring opening of C and D in the synthesis of azadirachtin and the final formation of azadirachtin and other compounds. Figure 1 ).

[0009] Compared with the progress in genome and transcriptome, the progress in the field of functional genomics has been relatively slow. One of the main reasons is the limitation of substrate sources. Summary of the invention

[0010] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an engineered Klebsiella mutans FB0006c and a construction method and application thereof.

[0011] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0012] The present invention provides an engineered Klebsiella trevisan FB0006c, characterized in that the engineered bacterium FB0006 is based on the genome of Klebsiella trevisan FB006, and a PgtHMGR fragment of a truncated 3-hydroxy-3-methylglutaryl-CoA reductase gene (PgtHMGR) from Saccharomyces cerevisiae is integrated at the spr gene site.

[0013] The above-mentioned Klebsiella trevisan FB006 was deposited in the China Center for Type Culture Collection on December 28, 2023. The preservation address is Wuhan University, Wuhan City, Hubei Province. The preservation number is: CCTCC NO: M20232710, and the preservation date is: December 28, 2023.

[0014] Furthermore, the nucleotide sequence of the 3-hydroxy-3-methylglutaryl-CoA reductase gene is shown in SEQ ID NO:1.

[0015] The present invention also provides a method for constructing the engineered Klebsiella variant FB0006c, comprising the following steps:

[0016] 1) According to the 1000bp sequence upstream and downstream of the spr gene in the genomic DNA sequence of Klebsiella mutans FB006, the corresponding homology arm primer pair and sgRNA primer pair were designed, and the genomic DNA of Klebsiella mutans FB006 was used as a template to perform PCR amplification to obtain the required homology arm fragments and sgRNA fragments;

[0017] 2) According to the truncated 3-hydroxy-3-methylglutaryl-CoA reductase gene (PgtHMGR) from Saccharomyces cerevisiae in the genomic DNA sequence of Saccharomyces cerevisiae, a primer pair HMGR-F / R was designed to amplify and obtain the PgtHMGR fragment;

[0018] 3) Connect the homology arm fragment, PgtHMGR gene and sgRNA fragment by overlap extension PCR to obtain the target gene;

[0019] 4) Using the CRISPR / Cas9n plasmid as a template and primer pair Cas9-gj-F / R to amplify a suitable CRISPR / Cas9n backbone;

[0020] 5) Use exonuclease to digest and connect the target gene fragment and the backbone to obtain the integration plasmid CAS9-Δepr::PgtHMGR;

[0021] 6) The integration plasmid CAS9-Δepr::PgtHMGR was transferred into Klebsiella mutans FB006, and the engineered Klebsiella mutans FB0006c was obtained by screening, wherein the PgtHMGR fragment was integrated into the spr gene site.

[0022] Furthermore, in step 1), the homology arm primers are as follows:

[0023] epr-AF: GCTGGACCGTCATCATTACCAGGAACAGACGAGCAA,

[0024] epr-AR:TCAAAGCCATACTCCCGCTTGAAAACCCTTGCAGTCTA;

[0025] epr-BF: TAGACTGCAAGGGTTTTCAAGCGGGAGTATGGCTTTGA, epr-BR: TTTGCCCAAGCTTCTAGACACAGCCCTACGGTGATA;

[0026] The sgRNA primers are as follows:

[0027] epr-sgF: AGTGATAGCGGTACCATTTCGGTTTGAATGTTGCCGAGGTTTTAGAGCTAGAAATAG,

[0028] epr-sgR: TACTCCTTACTCGTTTTGAGAAAAAAGCACCGACTCGG.

[0029] Furthermore, in step 2), the primer pair HMGR-F / R is as follows:

[0030] HMGR-F: TGGGAAGTTGGGAGCCATGGGTCCTTTAGAAGAATT, HMGR-R: CATGTTCTTGAGGGTCTTAGGATTTAATGCAGGTG;

[0031] In the step 4), the primer pair Cas9-gj-F / R is as follows:

[0032] Cas9-gj-F:AATGGTACCGCTATCACTTTATAT,

[0033] Cas9-gj-R:TCTAGAAGCTTGGGCAAAGCGTTTT.

[0034] The present invention also provides a use of the above-mentioned Klebsiella mutans engineered bacteria FB0006c in preparing an azadirachtin precursor.

[0035] The present invention also provides a use of the above-mentioned Klebsiella mutans engineered bacteria FB0006c in preparing fermentation liquid.

[0036] The present invention also provides a method for preparing a fermentation broth of Klebsiella variegata engineered bacteria FB0006c, comprising the following steps:

[0037] 1) inoculating the above-mentioned engineered Klebsiella mutans bacterium FB0006c into LB solid medium and culturing and activating it at a constant temperature;

[0038] 2) inoculating the activated mutans Klebsiella engineered bacteria FB0006c into the seed culture medium and culturing with shaking to obtain the seed solution;

[0039] 3) The seed liquid is inoculated into the fermentation medium, and the fermentation culture is carried out by shaking to transform the fermentation liquid of the Klebsiella engineered bacteria FB0006c.

[0040] Furthermore, in the step 3), the inoculation amount of the seed solution is 1%.

[0041] The present invention also provides an application of the fermentation liquid prepared by the above preparation method in preparing an azadirachtin precursor.

[0042] Beneficial effects of the present invention:

[0043] The invention is based on the engineered Klebsiella variegata FB0006, obtains the engineered Klebsiella variegata FB0006c by genetic engineering means, and ferments and cultures it to prepare azadirachtin. The method of the invention is simple, has good effect, and has good economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 for the putative biosynthetic pathway of azadirachtin;

[0045] Figure 2 Comparison of retention times of four reference substances

[0046] In the figure, lanosterol. Lanosterol; lupeol. Lupeol; tirucallol. Epieuphorbia diene alcohol; butyrospermol. Butyrospermol;

[0047] Figure 3 This is the extracted chromatogram of 393 m / z [EIC(393)]. DETAILED DESCRIPTION

[0048] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0049] Example 1

[0050] A method for constructing a Klebsiella variant engineering bacterium FB0006c, characterized in that it comprises the following steps:

[0051] 1) According to the 1000bp sequence upstream and downstream of the spr gene in the genomic DNA sequence of Klebsiella mutans FB006, the corresponding homology arm primer pair and sgRNA primer pair were designed, and the genomic DNA of Klebsiella mutans FB006 was used as a template to perform PCR amplification to obtain the required homology arm fragments and sgRNA fragments; wherein the homology arm primers are as follows:

[0052] epr-AF: GCTGGACCGTCATCATTACCAGGAACAGACGAGCAA,

[0053] epr-AR:TCAAAGCCATACTCCCGCTTGAAAACCCTTGCAGTCTA;

[0054] epr-BF: TAGACTGCAAGGGTTTTCAAGCGGGAGTATGGCTTTGA, epr-BR: TTTGCCCAAGCTTCTAGACACAGCCCTACGGTGATA;

[0055] The sgRNA primers are as follows:

[0056] epr-sgF: AGTGATAGCGGTACCATTTCGGTTTGAATGTTGCCGAGGTTTTAGAGCTAGAAATAG,

[0057] epr-sgR: TACTCCTTACTCGTTTTGAGAAAAAAGCACCGACTCGG.

[0058] 2) According to the truncated 3-hydroxy-3-methylglutaryl-CoA reductase gene (PgtHMGR) from Saccharomyces cerevisiae in the genomic DNA sequence of Saccharomyces cerevisiae (the nucleotide sequence of the 3-hydroxy-3-methylglutaryl-CoA reductase gene is shown in SEQ ID NO: 1), a primer pair HMGR-F / R was designed to amplify and obtain the PgtHMGR fragment; wherein,

[0059] The primer pair HMGR-F / R is as follows:

[0060] HMGR-F: TGGGAAGTTGGGAGCCATGGGTCCTTTAGAAGAATT, HMGR-R: CATGTTCTTGAGGGTCTTAGGATTTAATGCAGGTG;

[0061] 3) Connect the homology arm fragment, PgtHMGR gene and sgRNA fragment by overlap extension PCR to obtain the target gene;

[0062] 4) Using the CRISPR / Cas9n plasmid as a template, and using the primer pair Cas9-gj-F / R to amplify a suitable CRISPR / Cas9n backbone; wherein the primer pair Cas9-gj-F / R is as follows:

[0063] Cas9-gj-F:AATGGTACCGCTATCACTTTATAT,

[0064] Cas9-gj-R:TCTAGAAGCTTGGGCAAAGCGTTTT;

[0065] 5) Use exonuclease to digest and connect the target gene fragment and the backbone to obtain the integration plasmid CAS9-Δepr::PgtHMGR;

[0066] 6) The integration plasmid CAS9-Δepr::PgtHMGR was transferred into Klebsiella mutans FB006, and the engineered Klebsiella mutans FB0006c was obtained by screening, wherein the PgtHMGR fragment was integrated at the xpt gene site.

[0067] The above-mentioned Klebsiella trevisan FB006 was deposited in the China Center for Type Culture Collection on December 28, 2023. The preservation address is Wuhan University, Wuhan City, Hubei Province. The preservation number is: CCTCC NO: M20232710, and the preservation date is: December 28, 2023.

[0068] In the above steps, specific primer sequences, PCR conditions, restriction enzyme ligation conditions and screening markers can be selected and optimized according to experimental routine.

[0069] Example 2

[0070] The method for preparing the fermentation liquid of Klebsiella mutans engineered bacteria FB0006c comprises the following steps:

[0071] 1) First, prepare a slant LB solid medium, then inoculate the LB solid medium with the engineered Klebsiella variegata bacteria FB0006c, and culture it in a constant temperature incubator at 37°C for 36 hours to activate it (the colony grows well);

[0072] 2) inoculating the activated Klebsiella mutans engineered bacteria FB0006c into the seed culture medium, and shaking cultured at a temperature of 37° C. and a rotation speed of 220 rpm to obtain a seed solution;

[0073] 3) Inoculate the seed liquid into the fermentation medium at an inoculation rate of 1%, and perform shaking fermentation to transform the fermentation liquid of Klebsiella engineering bacteria FB0006c.

[0074] Culture medium formulation

[0075]

[0076] Example 3

[0077] Detection of Azadirachtin in Fermentation Broth of Klebsiella mutans FB0006c

[0078] 1. Extraction of products:

[0079] The fermentation broth of Klebsiella mutans engineered bacteria FB0006c was centrifuged to collect the cells, washed with deionized water, and then added with a disrupting solution (containing 20% ​​KOH, 40% water, and 40% anhydrous ethanol) for lysis, and then placed in a water bath at 90°C for 1 hour. Then, the product was extracted with n-hexane, vortexed and ultrasonically extracted, and the supernatant was centrifuged and the supernatant was combined after repeated operations. The supernatant was filtered and concentrated, and a certain amount was evaporated to dryness and then added with N-methyl-N-trimethylsilane trifluoroacetamide for derivatization treatment.

[0080] 2. Product detection and analysis:

[0081] The treated samples were analyzed and identified using a gas chromatography-mass spectrometer (GC-MS). The detection conditions included: splitless injection, injection port temperature of 250°C, EI ion source temperature of 230°C, voltage of 70V; helium as carrier gas, flow rate of 1.5mL / min; mass spectrometry scanning was set at m / z 50-550. The column oven program was 80°C for 1 minute, then increased to 280°C at a rate of 20°C / min, maintained at 280°C for 32 minutes, and then increased to 300°C at a rate of 5°C / min and maintained for 5 minutes.

[0082] 3. Data processing:

[0083] The total ion current (TIC) obtained by GC-MS Figure 2 ) were analyzed by comparing with reference substances (such as Figure 3 ) were compared with the retention time and ion fragments to infer the presence of the target product tirucalla-7,24-dien-3β-ol.

[0084] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. An engineered Klebsiella variant FB0006c, characterized in that: The engineered bacteria FB0006 is based on the genome of Klebsiella trevisan FB006, and the PgtHMGR fragment of the truncated 3-hydroxy-3-methylglutaryl-CoA reductase gene from Saccharomyces cerevisiae is integrated into the spr gene site.

2. The engineered Klebsiella variant FB0006a according to claim 1, characterized in that: The 3-hydroxy-3-methylglutaryl-CoA reductase gene is shown in SEQ ID NO:

1.

3. A method for constructing a Klebsiella variant engineered bacterium FB0006c, characterized in that: The following steps are involved: 1) According to the 1000bp sequence upstream and downstream of the spr gene in the genomic DNA sequence of Klebsiella mutans FB006, the corresponding homology arm primer pair and sgRNA primer pair were designed, and the genomic DNA of Klebsiella mutans FB006 was used as a template to perform PCR amplification to obtain the required homology arm fragments and sgRNA fragments; 2) According to the truncated 3-hydroxy-3-methylglutaryl-CoA reductase gene (PgtHMGR) from Saccharomyces cerevisiae in the genomic DNA sequence of Saccharomyces cerevisiae, a primer pair HMGR-F / R was designed to amplify and obtain the PgtHMGR fragment; 3) Connect the homology arm fragment, PgtHMGR gene and sgRNA fragment by overlap extension PCR to obtain the target gene; 4) Using the CRISPR / Cas9n plasmid as a template and primer pair Cas9-gj-F / R to amplify a suitable CRISPR / Cas9n backbone; 5) Use exonuclease to digest and connect the target gene fragment and the backbone to obtain the integration plasmid CAS9-Δepr::PgtHMGR; 6) The integration plasmid CAS9-Δepr::PgtHMGR was transferred into Klebsiella mutans FB006, and the engineered Klebsiella mutans FB0006c was obtained by screening, wherein the PgtHMGR fragment was integrated into the spr gene site.

4. The construction method according to claim 3, characterized in that: In the step 1), the homology arm primers are as follows: epr-AF: GCTGGACCGTCATCATTACCAGGAACAGACGAGCAA, epr-AR: TCAAAGCCATACTCCCGCTTGAAAACCCTTGCAGTCTA; epr-BF: TAGACTGCAAGGGTTTTCAAGCGGGAGTATGGCTTTGA, epr-BR:TTTGCCCAAGCTTCTAGACACAGCCCTACGGTGATA; The sgRNA primers are as follows: epr-sgF: AGTGATAGCGGTACCATTTCGGTTTGAATGTTGCCGA GGTTTTAGAGCTAGAAATAG, epr-sgR: TACTCCTTACTCGTTTTGAGAAAAAAGCACCGACTCGG.

5. The construction method according to claim 3, characterized in that: In the step 2), the primer pair HMGR-F / R is as follows: HMGR-F:TGGGAAGTTTGGGAGCCATGGGTCCTTTAGAAGAATT, HMGR-R:CATGTTCTTGAGGGTGCTTAGGATTTAATGCAGGTG; In the step 4), the primer pair Cas9-gj-F / R is as follows: Cas9-gj-F:AATGGTACCGCTATCACTTTATAT, Cas9-gj-R:TCTAGAAGCTTGGGCAAAGCGTTTT.

6. Use of the engineered Klebsiella mutans FB0006c according to claim 1 in preparing an azadirachtin precursor.

7. Use of the engineered Klebsiella mutans FB0006c according to claim 1 in preparing a fermentation broth.

8. A method for preparing a fermentation broth of Klebsiella mutans engineered bacteria FB0006c, characterized in that: The following steps are involved: 1) inoculating the engineered Klebsiella mutans FB0006c described in claim 1 into LB solid culture medium and culturing and activating the culture medium at a constant temperature; 2) inoculating the activated mutans Klebsiella engineered bacteria FB0006c into the seed culture medium and culturing with shaking; Obtain seed liquid; 3) The seed liquid is inoculated into the fermentation medium, and the fermentation culture is carried out by shaking to transform the fermentation liquid of the Klebsiella engineered bacteria FB0006c.

9. The preparation method according to claim 8, characterized in that: In the step 3), the inoculation amount of the seed solution is 1%.

10. Use of the fermentation liquid prepared by the preparation method according to any one of claims 8 to 9 in preparing an azadirachtin precursor.

Images