SiRNA of targeted SYT7 gene and application of siRNA

Abstract

The invention discloses siRNA of a targeted SYT7 gene and application of the siRNA, and belongs to the field of biology. According to the present invention, the expression of SYT7 in lung cancer cells is interfered by using small interfering RNA (siRNA), such that the cloning number of the tumor cells is significantly reduced, the expression of the epithelial marker protein E-cadherin is increased, and the expression of the mesenchymal marker proteins N-cadherin and Vimentin, and the expression of the epithelial-mesenchymal transition (EMT) related transcription factors SNAIL1 and TWIST1 are reduced so as to significantly inhibit the proliferation, the migration and the invasion of the tumor cells, a direction is provided for treatment of lung cancer, a theoretical basis is provided for development of drugs for inhibiting proliferation and metastasis of lung cancer cells, and the application value is high.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a siRNA targeting a SYT7 gene and an application thereof. Background Art

[0002] Lung cancer is a very common malignant tumor with high morbidity and mortality worldwide. Although traditional treatments such as surgery, radiotherapy and chemotherapy have made certain progress, early diagnosis and effective treatment of lung cancer are still very challenging due to the lack of obvious symptoms in the early stages and variable gene mutations. Therefore, exploring new treatment strategies, especially molecular targeted treatments, is the focus of current lung cancer research.

[0003] In recent years, more and more studies have shown that synaptotagmin 7 (SYT7) is highly expressed in a variety of tumors and is closely related to the occurrence and development of tumors, especially in the proliferation, migration and invasion of lung cancer cells. By regulating the expression level of SYT7, the growth and spread of lung cancer cells can be effectively inhibited. siRNA is a molecular tool that can specifically silence the expression of target genes. Its mechanism is to use RNA interference (RNAi) technology to guide RNA-induced silencing complex (RISC) to recognize and degrade specific mRNA, thereby inhibiting the expression of target genes. Therefore, the development of small interfering RNA (siRNA) targeting SYT7 as a therapeutic method has important clinical application prospects. Summary of the invention

[0004] In view of the deficiencies of the prior art, the present invention provides a siRNA targeting the SYT7 gene and its application in the treatment of lung cancer. The siRNA can effectively reduce the expression of the SYT7 gene, inhibit the proliferation and metastasis of lung cancer cells, has good application prospects, and provides a new direction for drug prevention or treatment of lung cancer.

[0005] In order to solve the problems of the prior art, the technical solution adopted by the present invention is:

[0006] siRNA targeting SYT7 gene, the sequence of the siRNA is as follows:

[0007] Justice strand: GCAAUGACGUCAUCGGCAATT;

[0008] Antisense strand: UUGCCGAUGACGUCAUUGCTT.

[0009] Application of the above siRNA targeting the SYT7 gene in reducing the expression of the SYT7 gene.

[0010] Application of the siRNA targeting the SYT7 gene in the preparation of a drug for inhibiting the proliferation and metastasis of lung cancer cells.

[0011] As an improvement, the lung cancer cells are human non-small cell lung cancer A549 cells.

[0012] A pharmaceutical composition or a pharmaceutically acceptable salt thereof comprises the above-mentioned siRNA targeting the SYT7 gene.

[0013] As an improvement, the pharmaceutical composition is in the form of tablets, sprays, granules, capsules, oral solutions or injections.

[0014] Beneficial effects:

[0015] The invention discloses a siRNA targeting the SYT7 gene and its application, which is the first to discover that overexpression of SYT7 in lung cancer cells can significantly increase the number of tumor cell clones, reduce the expression of epithelial marker protein E-cadherin, increase the expression of mesenchymal marker proteins N-cadherin and Vimentin, and epithelial-mesenchymal transition (EMT) related transcription factors SNAIL1 and TWIST1, thereby significantly increasing tumor proliferation, migration and invasion, leading to increased tumor malignancy.

[0016] Compared with the prior art, the present invention utilizes siRNA to interfere with the expression of SYT7 in lung cancer cells, significantly reduces the number of tumor cell clones, increases the expression of epithelial marker protein E-cadherin, and reduces the expression of mesenchymal marker proteins N-cadherin and Vimentin, as well as EMT-related transcription factors SNAIL1 and TWIST1, thereby significantly inhibiting tumor cell proliferation, migration and invasion, and can be used to prepare related drugs for alleviating and treating lung cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The levels of SYT7 mRNA and protein in human non-small cell lung cancer A549 cells after overexpression of SYT7, where A is the mRNA level of SYT7, B is the protein level of SYT7, and C is the relative content of SYT7 protein.

[0018] Figure 2 Proliferation of human non-small cell lung cancer A549 cells after overexpression of SYT7, where A is EdU incorporation assay, B is the percentage of EdU-positive cells, C is CCK8 growth curve assay, D is clone formation assay, and E is quantification of clone number.

[0019] Figure 3Metastasis of human non-small cell lung cancer A549 cells after overexpression of SYT7, where A is the transwell experiment result, B is the number of metastatic cells, C is the level of epithelial-mesenchymal transition marker protein, D is the relative content of epithelial-mesenchymal transition marker protein, E is the protein level of epithelial-mesenchymal transition marker protein-related transcription factors, and F is the relative content of transcription factors.

[0020] Figure 4 The levels of SYT7 mRNA and protein in human non-small cell lung cancer A549 cells after knocking down SYT7, where A is the mRNA level of SYT7, B is the protein level of SYT7, and C is the relative content of SYT7 protein.

[0021] Figure 5 Proliferation of human non-small cell lung cancer A549 cells after knockdown of SYT7, where A is the clone formation assay, B is the quantification of the clone number, and C is the CCK8 growth curve assay.

[0022] Figure 6 Metastasis of human non-small cell lung cancer A549 cells after knockdown of SYT7, where A is the result of the transwell experiment, B is the number of metastatic cells, C is the level of epithelial-mesenchymal transition marker protein, D is the relative content of epithelial-mesenchymal transition marker protein, E is the protein level of epithelial-mesenchymal transition marker protein-related transcription factors, and F is the relative content of transcription factors. DETAILED DESCRIPTION

[0023] In order to make the technical means, creative features, objectives and effects of the present invention easy to understand, the present invention is further described below in conjunction with specific implementation methods. However, the protection scope of the present invention is not limited to the following embodiments.

[0024] The experiments described in the following examples were performed with biosafety approval:

[0025] Human non-small cell lung cancer A549 cells were purchased from the American Tissue Culture Collection (ATCC) cell bank.

[0026] The cell culture medium was RPMI-1640 culture medium purchased from Keygene Biotechnology.

[0027] The lentivirus overexpressing SYT7 was purchased from Nanjing KRS Biotechnology Co., Ltd.

[0028] The transfection reagent was purchased from Novezan (T101-01).

[0029] RNAisolater Total RNAExtraction Reagent was purchased from Novezan (R401-01).

[0030] Example 1

[0031] Design of siRNA targeting SYT7 gene

[0032] (1) Obtain the CDS sequence of the SYT7 gene from GeneBank in NCBI.

[0033] Among them, the CDS sequence is:

[0034] atgtaccgggacccggaggcggccagcccaggggcgccctcgcgcgacgtcctgctggtctctgccatcatcaccgtcagccttagcgtcac

[0035] tgtcgtcctctgcggcctctgccactggtgtcagcgcaaactgggcaaacgctacaagaattccttggagacggtgggcacgccagactcagg

[0036] gcgtgggcgcagtgagaagaaggctatcaatggcaccctcctgtcgggcgccaaagtggccgccgcggcggggctggcggtggagcggg

[0037] aaggccggctgggggagaagccggcaccggtgccgccacccggagaggacgccttgagaagcggcggggctgcccccagcgagccgg

[0038] gcagcggtggcaaggcggggagaggccgctggcggacggtgcagagccacctggccgcagggaagctcaacttgtccaagttgcctgca

[0039] ggagggaaggcggtgaacacagcccccgtgccaggccagacaccccacgatgagtccgaccgccggaccgagccacgttcctccgtctca

[0040] gacctcgtcaactccctcaccagcgagatgctcatgctctccccaggctccgaggaggatgaggcccacgagggttgcagccgagagaacct

[0041] gggccggatccagttcagtgtcggctacaacttccaggagtccacgctcaccgtgaagatcatgaaggcccaggagctgccggccaaggact

[0042] tcagcggcaccagcgaccccttcgtcaagatctacctgctgcccgacaagaagcacaagctggagaccaaggtgaagcggaagaacctgaa

[0043] cccccactggaacgagaccttcctctttgaaggttttccctatgagaaggtggtgcagaggatcctctacctccaagtcctggactatgaccgcttc

[0044] agccgcaacgaccccattggggaggtgtccatcccccttaacaaggtggacctgacccagatgcagaccttctggaaggatctgaagccatgc

[0045] agcgatgggagtgggagccgaggggagctgctcttgtctctctgctacaacccctctgccaactccatcatcgtgaacatcatcaaagcccgga

[0046] acctcaaagccatggacatcgggggcacatcagacccctacgtgaaggtatggctgatgtacaaggacaagcgggtggagaagaagaagac

[0047] ggtgacgatgaagaggaacctgaaccccatcttcaatgagtccttcgccttcgatatccccacggagaagctgagggagacgaccatcatcatc

[0048] actgtcatggacaaggacaagctcagccgcaatgacgtcatcggcaagatctacctgtcctggaagagcgggccaggggaggtgaagcactggaaggacatgattgcccgtccccggcagcccgtggcccagtggcaccagctgaaggcctga。

[0049] (2) siRNA design was performed using the siRNA design website of Thermo Fisher Scientific (https: / / rnaidesigner.thermofisher.com / rnaiexpress / ). The siRNAs with a GC content of 50% and a Star Scoring System score of 5 stars were selected for blast verification.

[0050] (3) In the nucleic acid blast function of the NCBI database, enter the verified sequence in the input sequence box for blast.

[0051] (4) Finally, a pair of siRNA sequences is obtained, wherein the sequences of the siRNAs are as follows:

[0052] Justice strand: GCAAUGACGUCAUCGGCAATT;

[0053] Antisense strand: UUGCCGAUGACGUCAUUGCTT.

[0054] siRNA (including siSYT7 and scramble) was purchased from Beijing Qingke Biotechnology.

[0055] Example 2

[0056] Detection of SYT7 mRNA and protein levels in human non-small cell lung cancer A549 cells after overexpression of SYT7

[0057] 1. Construction of SYT7 stable overexpression cell lines by lentiviral infection and screening

[0058] (1) After transfecting human non-small cell lung cancer A549 cells with the lentiviral suspension for 48 hours, the selection marker puromycin (1 mg / ml, ST551, Beyotime Biotechnology, Shanghai, China) of the eukaryotic expression vector was added to the cells at a ratio of 1:1000 for screening.

[0059] (2) Change the medium every day to wash away dead cells.

[0060] (3) After 72 h, the stable cell strain with puromycin resistance and stably overexpressing SYT7 was used for subsequent experiments.

[0061] 2. Detection of SYT7 mRNA in human non-small cell lung cancer A549 cells after overexpression of SYT7

[0062] (1) Wild-type and SYT7-stably overexpressing A549 cells were seeded in 6-well plates and cultured overnight.

[0063] (2) After washing three times with PBS, add 500 μL RNAisolater Total RNAExtraction Reagent to each well.

[0064] (3) After cooling on ice for 10 min, centrifuge at 12,000 rpm, 4°C, for 15 min.

[0065] (4) Transfer the supernatant to a new tube and add an equal amount of isopropanol. Mix by shaking and place on ice for 10 min.

[0066] (5) Centrifuge at 12000 rpm, 4°C for 10 min and remove the supernatant.

[0067] (6) Add 1 mL of anhydrous ethanol and centrifuge at 12,000 rpm, 4°C, for 5 min. Repeat once.

[0068] (7) After the metal bath is dried, add an appropriate amount of RNase Free ddH2O to dissolve the precipitate, which is the total RNA.

[0069] (8) Reverse to cDNA: Add the following reagents into the tube in sequence and reverse to cDNA in a PCR instrument.

[0070] System per well (10 μL)

[0071]

[0072] (9) Fluorescence real-time quantitative PCR (RT-qPCR): add the following reagents into the tube in sequence and detect the relative mRNA content of the target gene in a qPCR instrument.

[0073] System per well (20 μL)

[0074]

[0075] Among them, the qPCR primer sequence used to detect the SYT7 gene is

[0076] SYT7-qPCR-F: TCATCACCGTCAGCCTTAGC;

[0077] SYT7-qPCR-R:TCTTGTAGCGTTTGCCCAGTT.

[0078] The qPCR primer sequences used to detect β-Actin are:

[0079] β-Actin-qPCR-F:CATGTACGTTGCTATCCAGGC;

[0080] β-Actin-qPCR-R: CTCCTTAATGTCACGCACGAT.

[0081] 3. SYT7 protein detection in human non-small cell lung cancer A549 cells after overexpression of SYT7

[0082] (1) Wild-type and stably overexpressing SYT7 A549 cells were seeded in 6-well plates and cultured overnight.

[0083] (2) After washing with PBS three times, add an appropriate amount of 1% SDS cell lysis buffer (PMSF protease inhibitor is added in advance) and lyse on ice for 5 minutes.

[0084] (4) Scrape off the cells with a cell scraper, transfer the cell lysate to an EP tube, and centrifuge at 12,000 rpm, 4°C, for 5 minutes.

[0085] (5) Sonicate the cell lysate on ice.

[0086] (6) After boiling in water for 5 minutes, add an appropriate amount of 6× Loading Buffer.

[0087] (7) Electrophoresis and membrane transfer: Prepare a 10% SDS-PAGE gel, take an equal amount of protein and perform SDS-PAGE electrophoresis for about 1.5 hours, then transfer the protein on the gel to a PVDF membrane;

[0088] (8) Blocking and antibody incubation: Take out the PVDF membrane and place it in a blocking solution containing 5% skim milk powder for 2 hours at room temperature, then discard the blocking solution. After washing with PBS three times, cut out the bands of the corresponding target protein size and place them in SYT7 and GAPDH antibody dilution solutions respectively, and incubate them at 4°C overnight.

[0089] (9) After washing three times with PBST, incubate with the corresponding species' secondary antibody at room temperature for 2 hours. After washing three more times with PBST, add a 1:1 mixed chemiluminescent solution to the membrane, expose it with an exposure device, and save the image.

[0090] Experimental results: Figure 1 As shown, SYT7 protein was successfully overexpressed in human non-small cell lung cancer A549 cells.

[0091] Example 3

[0092] Detection of proliferation ability of human non-small cell lung cancer A549 cells after overexpression of SYT7

[0093] 1. EdU detection

[0094] (1) 3.5×10 5 Cells were seeded on slides and incubated overnight.

[0095] (2) The experiment was performed according to the EdU-488 cell proliferation detection kit (C0071S, Beyotime, Shanghai, China).

[0096] (3) Fluorescence microscopy was used to detect the incorporation of Edu into intracellular DNA.

[0097] 2.CCK8 detection

[0098] (1) 1000 cells were seeded into a 96-well plate and incubated overnight.

[0099] (2) Before the assay, 10 μL of CCK-8 was added to each well. The cell plate was incubated in a 37°C incubator for 1 hour, and the absorbance at 450 nm was measured using an ELISA reader.

[0100] 3. Colony formation assay

[0101] 600 cells were plated in a 6-well plate. After continuous culture for 1-2 weeks, the cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. The cell colony formation was recorded by taking photos.

[0102] Experimental results: After overexpression of SYT7, the proliferation ability of human non-small cell lung cancer A549 cells was significantly increased.

[0103] Example 4

[0104] Detection of metastatic ability of human non-small cell lung cancer A549 cells after overexpression of SYT7

[0105] 1. Transwell experiment of human non-small cell lung cancer A549 cells overexpressing SYT7

[0106] (1) After digestion with trypsin and collection of cells, wash with PBS three times. After the final centrifugation, resuspend the cells in serum-free medium.

[0107] (2)3×10 5 The cells were seeded into the upper chamber of the Transwell, and 600 μL of culture medium containing 20% ​​serum was added to the lower chamber.

[0108] (3) After overnight incubation, the cells in the upper chamber were scraped off with a cotton swab, washed three times with PBS, fixed with 4% paraformaldehyde at room temperature for 15 min, and stained with 0.1% crystal violet for 10 min.

[0109] (4) Migrating cells are located below the membrane and are observed and photographed under an inverted microscope. For invasion experiments, a layer of matrix gel is added above the membrane.

[0110] 2. Detection of EMT-related proteins in human non-small cell lung cancer A549 cells overexpressing SYT7

[0111] The specific steps are as described in the step of "3. SYT7 protein detection in human non-small cell lung cancer A549 cells after overexpression of SYT7" in the above Example 2. The primary antibody dilution solution is E-cadherin, N-cadherin, Vimentin, SYT7 and GAPDH antibodies.

[0112] 3. Detection of EMT-related transcription factors in human non-small cell lung cancer A549 cells overexpressing SYT7

[0113] The specific steps are as described in the step of "3. SYT7 protein detection in human non-small cell lung cancer A549 cells after overexpression of SYT7" in the above Example 2. The primary antibody diluent is SNAIL1, TWIST1, SYT7 and GAPDH antibodies.

[0114] Experimental results: After overexpression of SYT7, the migration and invasion of human non-small cell lung cancer A549 cells, the expression of EMT-related proteins and related transcription factors were Figure 3 As shown, overexpression of SYT7 significantly increased tumor cell metastasis.

[0115] Example 5

[0116] Knockdown of SYT7 in human non-small cell lung cancer A549 cells by transfection of siRNA

[0117] (1) 3×10 6 A549 cells were seeded in 6-well plates and cultured overnight.

[0118] (2) Mix 10 μL of 20 nM siRNA and 5 μL of ExFect Transfection Reagent and add to the cell plate. Incubate in an incubator for 48 h.

[0119] Example 6

[0120] Detection of SYT7 mRNA and protein levels in human non-small cell lung cancer A549 cells after knockdown of SYT7 gene

[0121] 1. Detection of SYT7 mRNA in human non-small cell lung cancer A549 cells after knockdown of SYT7 gene

[0122] (1) Knockdown of SYT7. The specific steps are as described in the steps of “knockdown of SYT7 in human non-small cell lung cancer A549 cells by transfecting siRNA” in Example 5 above.

[0123] (2) The specific steps are as described in steps (2) to (9) of "2. Detection of SYT7 mRNA in human non-small cell lung cancer A549 cells after overexpression of SYT7" in Example 2 above.

[0124] 2. Detection of SYT7 protein level in human non-small cell lung cancer A549 cells after knocking down SYT7 gene

[0125] (1) Knockdown of SYT7. The specific steps are as described in the steps of “knockdown of SYT7 in human non-small cell lung cancer A549 cells by transfecting siRNA” in Example 5 above.

[0126] (2) The specific steps are as described in steps (2) to (9) of "3. Detection of SYT7 protein in human non-small cell lung cancer A549 cells after overexpression of SYT7" in Example 2 above.

[0127] The experimental results are as follows Figure 4 As shown, siRNA successfully reduced the expression of SYT7 in human non-small cell lung cancer A549 cells.

[0128] Example 7

[0129] Detection of proliferation ability of human non-small cell lung cancer A549 cells after knockdown of SYT7

[0130] 1. Colony formation assay

[0131] (1) Knockdown of SYT7. The specific steps are as described in the steps of “knockdown of SYT7 in human non-small cell lung cancer A549 cells by transfecting siRNA” in Example 5 above.

[0132] (2) For specific steps, refer to the steps in "3. Clone formation detection" in the above Example 3.

[0133] 2.CCK8 detection

[0134] (1) Knockdown of SYT7. The specific steps are as described in the steps of “knockdown of SYT7 in human non-small cell lung cancer A549 cells by transfecting siRNA” in Example 5 above.

[0135] (2) For specific steps, refer to the steps in "2. CCK8 detection" in the above Example 3.

[0136] The experimental results are as follows Figure 5 It is described that after knocking down the SYT7 gene, the proliferation ability of human non-small cell lung cancer A549 cells was significantly reduced.

[0137] Example 8

[0138] Detection of metastatic ability of human non-small cell lung cancer A549 cells after knockdown of SYT7

[0139] 1. Transwell experiment of human non-small cell lung cancer A549 cells with knockdown of SYT7

[0140] (1) Knockdown of SYT7. The specific steps are as described in the steps of “knockdown of SYT7 in human non-small cell lung cancer A549 cells by transfecting siRNA” in Example 5 above.

[0141] (2) The specific steps are as described in “1. Transwell experiment of human non-small cell lung cancer A549 cells overexpressing SYT7” in Example 4 above.

[0142] 2. Detection of EMT-related proteins in human non-small cell lung cancer A549 cells with SYT7 knockdown

[0143] (1) Knockdown of SYT7. The specific steps are as described in the steps of “knockdown of SYT7 in human non-small cell lung cancer A549 cells by transfecting siRNA” in the above Example 5.

[0144] (2) The specific steps are as described in the steps of "3. SYT7 protein detection in human non-small cell lung cancer A549 cells after overexpression of SYT7" in the above Example 2. The primary antibody diluent is E-cadherin, N-cadherin, Vimentin, SYT7 and GAPDH antibodies.

[0145] 3. Detection of EMT-related transcription factors in human non-small cell lung cancer A549 cells with SYT7 knockdown

[0146] (1) Knockdown of SYT7. The specific steps are as described in the steps of “knockdown of SYT7 in human non-small cell lung cancer A549 cells by transfecting siRNA” in Example 5 above.

[0147] (2) The specific steps are as described in the steps of "3. Detection of SYT7 protein in human non-small cell lung cancer A549 cells after overexpression of SYT7" in the above Example 2. The primary antibody dilution solution is SNAIL1, TWIST1, SYT7 and GAPDH antibodies.

[0148] Experimental results: After knocking down the SYT7 gene, the migration and invasion of human non-small cell lung cancer A549 cells, the expression of EMT-related proteins and related transcription factors were Figure 6 As shown in the figure, it can be shown that knocking down the SYT7 gene can significantly reduce tumor cell metastasis.

[0149] In summary, the present invention significantly reduces the number of tumor cell clones, increases the expression of epithelial marker protein E-cadherin, and reduces the expression of mesenchymal marker proteins N-cadherin and Vimentin, as well as EMT-related transcription factors SNAIL1 and TWIST1, after interfering with the expression of SYT7 in human non-small cell lung cancer A549 cells, thereby significantly inhibiting tumor cell proliferation, migration and invasion; the present invention provides a direction for the treatment of lung cancer and a theoretical basis for the development of drugs for inhibiting the proliferation and metastasis of lung cancer cells, and has a high application value.

[0150] The present invention and its embodiments are described schematically above, and the description is not restrictive. The drawings show only one embodiment of the present invention, and the actual structure is not limited thereto. Therefore, if a person skilled in the art is inspired by it and designs a structural method and an embodiment similar to the technical solution without creativity without departing from the purpose of the invention, they shall all fall within the protection scope of the present invention.

Claims

1. An siRNA targeting the SYT7 gene, characterized in that: The sequence of the siRNA is as follows: Justice strand: GCAAUGACGUCAUCGGCAATT; Antisense strand: UUGCCGAUGACGUCAUUGCTT.

2. Use of the siRNA targeting the SYT7 gene according to claim 1 in reducing the expression of the SYT7 gene.

3. Use of the siRNA targeting the SYT7 gene according to claim 1 in the preparation of a drug for inhibiting the proliferation and metastasis of lung cancer cells.

4. The use according to claim 3, characterized in that: The lung cancer cells are human non-small cell lung cancer A549 cells.

5. A pharmaceutical composition or a pharmaceutically acceptable salt thereof, characterized in that: The method comprises the siRNA targeting the SYT7 gene according to claim 1.

6. The pharmaceutical composition according to claim 5 or a pharmaceutically acceptable salt thereof, characterized in that: The drug or its pharmaceutically acceptable salt is in the form of tablets, sprays, granules, capsules, oral solutions or injections.

Images