SNP (Single Nucleotide Polymorphism) molecular marker influencing back fat thickness character of large white pig and application of SNP molecular marker

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) molecular marker influencing the backfat thickness character of a large white pig and application of the SNP molecular marker, and belongs to the technical field of pig character genetic improvement, and the SNP molecular marker is located at a basic group of a 66584554 site of a fifth chromosome of a pig genome Sus scrofa 11.1 version. The SNP site related to the backfat thickness character of the large white pig, provided by the invention, is detected and can be used for breeding pig early-stage selection and remaining, that is, specific genotype individuals under the site are selected for breeding remaining in actual breeding work, so that the accuracy and breeding efficiency of large white pig meat character selection are improved, and the breeding efficiency is improved. Meanwhile, the gene frequency related to excellent characters in the population can be improved, and the backfat thickness character of the population is improved in a targeted manner, so that the production performance and the economic benefit of the whole population are improved.

Description

Technical Field

[0001] The present application relates to the technical field of pig trait improvement, and specifically to a SNP molecular marker affecting the back fat thickness trait of Large White pigs and an application thereof. Background Art

[0002] my country's pig farming industry has a long history, rich pig breed resources, and wide distribution. It has huge utilization potential and broad development prospects. With the rapid growth of my country's pig farming industry, the scale of farming is expanding. How to improve the production efficiency of my country's pigs, promote the cultivation of local high-quality pig breeds, and reduce dependence on Western fine pigs has become the main goal of genetic breeding. In the pig farming industry, the growth performance of pigs directly affects the yield, and excellent growth performance maximizes the economic benefits of the group. The growth performance indicators of pigs mainly include growth rate, feed conversion rate, carcass quality (such as lean meat rate, back fat thickness), etc. Among them, pig back fat thickness is one of the most important economic traits in the pig farming process. However, pig back fat thickness is affected by a variety of environmental factors, such as feed quality, breeding environment and stocking density. In traditional breeding, these factors are often difficult to control accurately, resulting in low selection accuracy and affected breeding efficiency. At the same time, traditional breeding requires a long breeding cycle and slow genetic improvement, and cannot take into account the improvement of multiple traits at the same time. Therefore, it is necessary to use more efficient phenotypic measurement and molecular breeding technology to improve the back fat thickness trait of pigs. Studies have shown that back fat thickness is significantly negatively correlated with lean meat rate. Back fat thickness is an important indicator for evaluating the lean meat rate of pigs in modern pig genetic breeding. The current mainstream market demand is to breed pigs with higher lean meat rates. Therefore, the main goal of pig genetic improvement is to reduce the back fat thickness of pigs and increase the lean meat rate, thereby increasing the economic value of pigs.

[0003] In recent years, although scientists have identified some genetic markers and candidate genes related to backfat thickness through traditional genetic research methods, such as family analysis and selection experiments. However, these studies are often limited to small-scale groups and are affected by the complex interaction of genetic and environmental factors, resulting in limited reliability and scope of application of the results. Therefore, it is difficult to make significant genetic progress in the pig backfat thickness trait by relying solely on traditional breeding work. In addition, traditional breeding for backfat thickness traits may ignore the improvement of meat quality and other traits, which is not conducive to improving the overall production performance of pigs. With the continuous development of technologies such as Genome-wide Association Study (GWAS), genetic variations that affect pig growth traits can be more accurately identified. Through systematic data collection, preprocessing, association analysis and result analysis, the association between genetic variation and phenotype can be revealed. The main idea is to preliminarily screen SNP sites and candidate genes that are significantly associated with traits through GWAS, determine key SNP sites through large-group verification and other analyses, then select mutation sites in genes for SNP typing through sequencing or enzyme cutting, identify genetic variations in different individuals at the DNA level, and thus select excellent individuals with ideal genotypes through molecular breeding practices and keep them for breeding.

[0004] However, there is still a lack of SNP markers related to pig backfat thickness that have clear functions, significant effects, and can be directly used for domestic breeding of Large White pigs in China. Therefore, it is necessary to provide a SNP marker for detecting pig backfat thickness and its application to improve the breeding accuracy of the Large White pig backfat thickness trait. Summary of the invention

[0005] The present application provides a SNP molecular marker affecting the back fat thickness trait of Large White pigs and its application, which can solve the related technical problems existing in the above-mentioned prior art.

[0006] In the first aspect, the present application provides a SNP molecular marker that affects the back fat thickness trait of Large White pigs, using the following technical solution:

[0007] A SNP molecular marker affecting the backfat thickness trait of Large White pigs is located at the base of the 66584554th position of chromosome 5 in the pig genome Susscrofa 11.1 version.

[0008] In combination with the first aspect, in one embodiment, the base at the SNP molecular marker has a C / T polymorphism, wherein:

[0009] At the SNP molecular marker, the backfat thickness of the CT genotype pigs, the backfat thickness of the CC genotype pigs and the backfat thickness of the TT genotype pigs decrease in sequence.

[0010] In a second aspect, the present application provides a multiplex PCR specific primer pair, using the following technical solution:

[0011] The multiplex PCR specific primer pair used to amplify the nucleotide sequence of the SNP molecular marker as described above, the primer pair sequence is:

[0012] F:GGATTGTTTGCAGAGGCTYCATAAG

[0013] R: AACTCCCCTGGGGTCAGAAAG.

[0014] In conjunction with the second aspect, an embodiment of the present application provides an application of the primer pair as described above in identifying pig backfat thickness or in pig genetic breeding.

[0015] In a third aspect, the present application provides a method for obtaining a SNP molecular marker, using the following technical solution:

[0016] A method for obtaining a SNP molecular marker as described above, the method comprising the following steps:

[0017] Obtain phenotypic trait data of pigs;

[0018] Obtaining pig genomic DNA;

[0019] Performing genotype detection on two preset SNP sites in the genomic DNA;

[0020] The genotype data were associated with the pig backfat thickness trait data.

[0021] In a third aspect, the present application provides a method for identifying or assisting in identifying pig backfat thickness, using the following method:

[0022] A method for identifying or assisting in identifying pig backfat thickness, the method comprising the following steps:

[0023] Obtaining genomic DNA of the pig to be tested;

[0024] Perform PCR amplification on the genomic DNA of the pig to be tested to obtain an amplified product;

[0025] The amplified product was sequenced, and the base genotype of the tested pig at position 66584554 of chromosome 5 of the pig genome Sus scrofa11.1 was determined based on the sequencing results.

[0026] In a fourth aspect, an embodiment of the present application provides an application of the SNP molecular marker as described above or the SNP molecular marker obtained by the acquisition method in identifying or assisting in identifying pig backfat thickness.

[0027] In a fifth aspect, an embodiment of the present application provides an application of the SNP molecular marker as described above or the SNP molecular marker obtained by the acquisition method in screening a population of pigs with low backfat thickness.

[0028] In combination with the fifth aspect, further, the application includes the step of determining the genotype at the base position 66584554 of chromosome 5 of the pig genome Sus scrofa version 11.1.

[0029] In combination with the fifth aspect, further, the application includes selecting pigs with a genotype of TT at the above-mentioned SNP molecular site as breeding pigs, so as to increase the frequency of the homozygous genotype TT of the SNP molecular marker generation by generation.

[0030] The beneficial effects brought by the technical solution provided in the embodiments of the present application include:

[0031] By detecting the SNP loci associated with the back fat thickness trait of Large White pigs proposed in this case, it can be used for early selection in breeding. In actual breeding, individuals with specific genotypes under this locus can be selected for seed retention, which helps to improve the efficiency and accuracy of breeding. At the same time, it can increase the gene frequency of excellent traits in the group, improve the back fat thickness trait of the group in a targeted manner, thereby improving the production performance and economic benefits of the entire group. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is a schematic diagram of the results of the genotype-phenotype association analysis of the rs331547641 locus. DETAILED DESCRIPTION

[0033] In order to enable those skilled in the art to better understand the solution of the present application, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0034] In recent years, although scientists have identified some genetic markers and candidate genes related to backfat thickness through traditional genetic research methods, such as family analysis and selection experiments, these studies are often limited to small-scale groups and are affected by the complex interaction of genetic and environmental factors, resulting in limited reliability and scope of application of the results. Therefore, it is difficult to make significant genetic progress in the pig backfat thickness trait by relying solely on traditional breeding work. In addition, in the traditional breeding for backfat thickness, the improvement of meat quality and other traits may be neglected, which is not conducive to pig breeding. With the continuous development of technologies such as Genome-wide Association Study (GWAS), genetic variations that affect pig growth traits can be more accurately identified. Through systematic data collection, preprocessing, association analysis and result interpretation, the association between genetic variation and phenotype can be revealed. The main idea is to determine the SNP sites and genes with significant trait through GWAS, select heterozygous and mutant sites in the gene for SNP typing by sequencing or enzyme cutting, obtain the differences between different individuals at the DNA level, and then obtain genotype individuals with guidance for breeding practice through association analysis. However, there is still a lack of SNP markers related to pig back fat thickness with clear functions, significant effects and direct breeding. Therefore, it is necessary to provide a SNP marker for detecting pig back fat thickness and its application to improve the accuracy of breeding for the back fat thickness trait of Large White pigs.

[0035] Based on the above problems, the present application provides a SNP molecular marker that affects the back fat thickness trait of Large White pigs and its application. The key point of the invention is that by detecting the SNP site related to the back fat thickness trait of Large White pigs proposed in this case, it can be used for early selection in breeding. In actual breeding, individuals with specific genotypes under this site are selected for seed retention, which helps to improve the efficiency and accuracy of breeding, and at the same time can increase the gene frequency of excellent traits in the group, and improve the back fat thickness trait of the group in a targeted manner, thereby improving the production performance and economic benefits of the entire group.

[0036] In order to make the objectives, technical solutions and advantages of the present application clearer, the implementation methods of the present application will be further described in detail below with reference to the accompanying drawings.

[0037] On the first aspect, the present application example discovered for the first time that different genotypes at the rs331547641 site in the pig CRACR2A gene have an effect on the back fat thickness of the Large White pig. The site is located at the base of the 66584554 site of chromosome 5 of the pig genome Sus scrofa11.1. Specifically, the base of the reference genome at this site is C, and there is a C / T polymorphism here, that is, the mutation here is C mutated to T, wherein the back fat thickness of the TT genotype pig is less than the back fat thickness of the CC genotype pig and less than the back fat thickness of the CT genotype pig. In actual breeding, selecting individuals with the genotype of TT at this site for seed retention helps to improve the efficiency and accuracy of breeding, and at the same time can increase the gene frequency of excellent traits in the group, improve the back fat thickness trait of the group in a targeted manner, thereby improving the production performance and economic benefits of the entire group.

[0038] In the second aspect, the present application provides a multiplex PCR specific primer pair for amplifying the nucleotide sequence of the above-mentioned SNP molecular marker, wherein the primer pair sequence is:

[0039] F:GGATTGTTTGCAGAGGCTYCATAAG

[0040] R:AACTCCCCTGGGGTCAGAAAG

[0041] Furthermore, the present application also provides the use of the above primer pair in identifying pig backfat thickness or in pig genetic breeding, wherein the pig genetic breeding is pig molecular marker-assisted breeding.

[0042] In a fourth aspect, the present application provides a method for obtaining the above-mentioned SNP molecular markers, which comprises the following steps:

[0043] S100, obtaining phenotypic trait data of pigs;

[0044] S200, obtaining pig genomic DNA;

[0045] S300, performing genotype detection on two preset SNP sites in the genomic DNA;

[0046] S400. Perform association analysis on the genotype data and the pig backfat thickness trait data.

[0047] Exemplarily, in this embodiment, the above steps can be subdivided into the following processes:

[0048] (I) Phenotyping, ear tissue sample collection and DNA extraction were performed on the experimental pig herd.

[0049] (II) A total of 4060 qualified DNA samples from group 1 were sent to Wuhan Yingzi Gene Technology Co., Ltd. for SNP genotyping (pig 80K functional site gene chip), a total of 3280 qualified DNA samples from group 2 were sent to Neogen Biotech (Shanghai) Co., Ltd. for SNP genotyping (GeenSeek GGP-Porcine 50K SNP chip), and a total of 2764 qualified DNA samples from group 3 were sent to Neogen Biotech (Shanghai) Co., Ltd. for SNP genotyping (GeenSeek GGP-Porcine 50K SNP chip).

[0050] (III) Perform comprehensive quality control on the chip data obtained by SNP genotyping. The standards for chip data quality control in this experiment are as follows (the following quality control process can be completed using Plink software):

[0051] (1) Eliminate SNPs with unknown physical locations or located on chromosome X;

[0052] (2) The call rate of single-site SNPs reaches more than 90%;

[0053] (3) The individual call rate reaches over 90%.

[0054] (IV) Use the PHARP v3 online website to fill in the genotype data after quality control. Use the bcftools software to remove R 2 Sites with a value less than 0.9 and a MAF less than 0.05.

[0055] (V) Since the test samples came from different populations, in order to understand the population structure of the test samples, the GCTA (Genome-wide Complex Trait Analysis) software was used to perform principal component analysis (PCA) on the sample population; the PLINK software was used to evaluate the degree of linkage disequilibrium (LD) of the whole genome of the population. The PCA scatter plot and LD decay plot were drawn using R software. PCA is mainly used to control population stratification and standardize genetic variation, while LD analysis is used to identify and use linkage disequilibrium to improve the efficiency and accuracy of association analysis.

[0056] (VI) In order to avoid false positive sites in the GWAS analysis results due to population stratification, this experiment conducted GWAS analysis on different populations before and after filling. This experiment used the single marker regression analysis method in GCTA software for GWAS analysis, and the mixed linear model was as follows;

[0057] y=Xb+Za+e

[0058] In the above model, y represents the corrected phenotypic value; b represents the SNP effect, and a represents the residual polygenic effect. is the individual additive genetic variance, G is the genetic relationship matrix, X and Z are the association matrices of b and a respectively; e represents the residual effect vector, is the residual variance.

[0059] (VII) The weighted Z-score method in METAL software was used to conduct a meta-analysis of backfat thickness among the three groups based on the results of the GWAS analysis of the Large White pig population after population filling. The P value and effect direction were converted into signed Z-scores. The Z-scores of each allele were weighted and summed according to the sample size of the experimental group. The weight was proportional to the sample size of the experimental group. The specific calculation formula is as follows:

[0060]

[0061] Where P i represents the P value of the GWAS analysis of the i-th population; φ represents the cumulative distribution function of the standard normal distribution; Δ i Indicates the direction of the SNP effect in the GWAS analysis of the i-th population; N i Represents the reference group size for the GWAS analysis of the i-th population.

[0062] (VIII) This study used the Bonferroni method to correct the results of single-trait GWAS and cross-population meta-analysis. The significance threshold at the genome level was 0.05 / N (N is the number of SNPs), and the significance threshold at the chromosome level was 1 / N.

[0063] (IX) After obtaining SNP sites significantly associated with the back fat thickness trait of Large White pigs by using single-trait GWAS and meta-analysis, the pig Sus scrofa version 11.1 database of the Ensemble online platform was used to search for related genes in the 200Kb region upstream and downstream of the significant SNP sites. The relevant gene information in websites such as NCBI and Ensembl was summarized and the function of each gene was annotated. At the same time, combined with the reported pig growth trait SNPs and the biological functions of genes, CRACR2A and others were screened as candidate genes.

[0064] (10) Extract DNA from 50 large white pigs outside the analysis group and pool them with equal quality. Use next-generation sequencing to detect the genetic variation at the whole genome level of the resource group, that is, scan all gene loci to obtain the base variation results at the whole genome level of the large white pig herd after pooling. Then, scan the SNP loci of the CRACR2A gene of 300 large white pigs in the new group for large-scale verification.

[0065] (XI) Multiplex PCR was used to perform genotyping on the SNP sites in the exon region, and the typing results of the corresponding SNP sites of 300 large white pigs used for verification were obtained. The specific reaction is as follows:

[0066] (1) Take 1 μL of DNA sample and perform 1% agarose gel electrophoresis to test the quality of the sample. Then, dilute the sample to a working concentration of 5-10 ng / μL based on the DNA concentration test result.

[0067] (2) Multiplex PCR reaction:

[0068] (a) PCR primers

[0069]

[0070] (b) PCR conditions

[0071] The reaction system (20 μL) contained 1× HotStarTaq buffer, 3.0 mM Mg 2+ , 0.3 mM dNTP, 1 U HotStar Taq polymerase (Qiagen Inc.), 1 μL sample DNA and 1 μL multiplex PCR primer.

[0072] The PCR cycle program is as follows:

[0073]

[0074] (3) PCR product purification

[0075] 5 U SAP enzyme and 2 U Exonuclease I enzyme were added to 20 μL of PCR product, incubated at 37° C. for 1 hour, and then inactivated at 75° C. for 15 minutes.

[0076] (4) SNaPshot multiple single base extension reaction

[0077] (b) Extension primer:

[0078]

[0079] (b) Extension reaction

[0080] The extension reaction system (10 μL) included 5 μL SNaPshot Multiplex Kit (ABI), 2 μL purified multiple PCR product, 1 μL extension primer mixture, and 2 μL ultrapure water.

[0081] The reaction procedure is as follows:

[0082]

[0083]

[0084] (5) Purification of extension products

[0085] Add 1U SAP enzyme to 10μL extension product, incubate at 37℃ for 1 hour, and then inactivate at 75℃ for 15 minutes.

[0086] (6) The extension product is loaded onto the ABI3730XL sequencer

[0087] Take 0.5 μL of the purified extension product, mix it with 0.5 μL Liz120 SIZE STANDARD and 9 μL Hi-Di, denature it at 95°C for 5 minutes, and then load it onto the ABI3730XL sequencer. Use GeneMapper4.1 (Applied biosystems) software to compare the sequencing results of the PCR products, analyze the sequencing peak graph, and complete the typing.

[0088] (XIII) The MIXED process in SAS software was used to conduct association analysis between the genotypes and haplotypes of the 24 SNP loci of CRACR2A and the backfat thickness trait. Finally, it was concluded that different genotypes of the rs331547641 locus had an effect on the backfat thickness of Large White pigs. The specific model is as follows:

[0089] y i =μ+Gi+e i

[0090] y i is the phenotypic value of growth traits, is back fat thickness; μ is the population mean; G i is the genotype effect, i represents different genotypes; e i is a random residual effect.

[0091] Table 1 Analysis of association between genotype and phenotype at rs331547641 locus

[0092]

[0093] Table 2 Least squares analysis of polymorphic sites

[0094]

[0095] From Table 1, Table 2 and Figure 1 It can be seen that different genotypes at the rs331547641 locus have different effects on the back fat thickness of pigs. The back fat thickness of the large white pigs with the TT genotype is 12.60±1.54mm, the back fat thickness of the large white pigs with the CT genotype is 15.17±0.38mm, and the back fat thickness of the large white pigs with the CC genotype is 14.24±0.26mm. The back fat thickness of the TT genotype is thinner than that of the CT and CC genotypes. Both the additive effect and the dominant effect are positive, indicating that the base mutation of this locus to T is associated with thinner back fat thickness. The genotyping results of the 300-head validation population show that there are more individuals with the CC genotype at the rs331547641 locus in the population, and the back fat thickness of the large white pigs with the TT genotype is significantly thinner than that of the CC genotype, indicating that the population still has great potential for genetic improvement. Therefore, in actual breeding, selecting and retaining Large White pigs with the TT genotype can increase the gene frequency of excellent traits in the group, make the back fat thickness of the group thinner, and improve the back fat thickness trait in the population in a targeted manner to achieve the purpose of improving the production performance and economic benefits of the entire group.

[0096] In a fifth aspect, the present application provides a method for identifying or assisting in identifying pig backfat thickness, the method comprising the following steps:

[0097] F100, obtaining genomic DNA of the pig to be tested;

[0098] F200, performing PCR amplification on the genomic DNA of the pig to be tested to obtain an amplified product;

[0099] F300, sequencing the amplified product, and determining the base genotype of the tested pig at position 66584554 of chromosome 5 of the porcine genome Sus scrofa11.1 based on the sequencing result.

[0100] In a sixth aspect, the present application provides an application of the SNP molecular marker as described above or the SNP molecular marker obtained by the acquisition method in identifying or assisting in identifying pig back fat thickness.

[0101] In a seventh aspect, the present application provides an application of the SNP molecular marker as described above or the SNP molecular marker obtained by the acquisition method in screening a population of pigs with low backfat thickness.

[0102] Furthermore, the application in screening a population of pigs with low backfat thickness comprises the step of determining the genotype at the base of position 66584554 of chromosome 5 of the pig genome Susscrofa version 11.1.

[0103] Furthermore, the application includes selecting pigs with genotype TT at the above SNP molecular site as breeding pigs, so as to increase the frequency of homozygous genotype TT at the SNP site generation by generation.

[0104] In summary, the present invention has discovered a SNP molecular marker related to pig backfat thickness. In actual breeding, by detecting the above SNP loci, it can be used for early selection in breeding, retaining TT genotype individuals, so that pigs have thinner backfat. The present invention can improve the accuracy of breeding for the thick backfat trait of Large White pigs, and has potential application value in large-scale molecular precision breeding of Large White pigs.

[0105] The present invention has been described in detail above in conjunction with specific implementation methods and exemplary examples, but these descriptions cannot be understood as limiting the present invention. Those skilled in the art will appreciate that, without departing from the spirit and scope of the present invention, various equivalent substitutions, modifications or improvements may be made to the technical solution of the present invention and its implementation methods, all of which fall within the scope of the present invention.

Claims

1. A SNP molecular marker affecting the backfat thickness trait of Large White pigs, characterized in that: The SNP molecular marker is located at the base of position 66584554 of chromosome 5 of the pig genome Sus scrofa version 11.

1.

2. The AAAA method according to claim 1, characterized in that: The base at the SNP molecular marker has a C / T polymorphism, wherein: At the SNP molecular marker, the backfat thickness of the CT genotype pigs, the backfat thickness of the CC genotype pigs and the backfat thickness of the TT genotype pigs decrease in sequence.

3. A multiplex PCR specific primer pair for amplifying the nucleotide sequence of the SNP molecular marker according to claim 1 or 2, characterized in that: The primer pair sequences are: F:GGATTGTTTGCAGAGGCTYCATAAG R: AACTCCCCTGGGGTCAGAAAG.

4. Use of the primer pair as claimed in claim 3 in identifying pig backfat thickness or in pig genetic breeding.

5. A method for obtaining a SNP molecular marker as claimed in claim 1 or 2, characterized in that: The method comprises the following steps: Obtain phenotypic trait data of pigs; Obtaining pig genomic DNA; Performing genotype detection on two preset SNP sites in the genomic DNA; The genotype data were associated with the pig backfat thickness trait data.

6. A method for identifying or assisting in identifying pig backfat thickness, characterized in that: The method comprises the following steps: Obtaining genomic DNA of the pig to be tested; Perform PCR amplification on the genomic DNA of the pig to be tested to obtain an amplified product; The amplified product was sequenced, and the base genotype of the tested pig at position 66584554 of chromosome 5 of the pig genome Sus scrofa11.1 was determined based on the sequencing results.

7. Use of the SNP molecular marker according to claim 1 or 2 or the SNP molecular marker obtained by the method according to claim 5 in identifying or assisting in identifying pig backfat thickness.

8. Use of the SNP marker according to claim 1 or 2 or the SNP molecular marker obtained by the method according to claim 5 in screening a pig population with low backfat thickness.

9. The use according to claim 8, characterized in that The application comprises the step of determining the genotype at the base of position 66584554 of chromosome 5 of the pig genome Sus scrofa 11.

1.

10. The use according to claim 8, characterized in that: The application includes selecting pigs with genotype TT at the above SNP molecular site as breeding pigs, so as to increase the frequency of homozygous genotype TT at the SNP site generation by generation.

Images