Breeding method of purple-leaf high-quality hybrid rice three-line sterile line

Abstract

The invention relates to the field of rice breeding science, in particular to a breeding method of a purple-leaf high-quality hybrid rice three-line sterile line, which comprises the following steps: hybridizing 112B and wild xiangxiang B, hybridizing an F1 plant with Taifeng B, carrying out whole-course high-quality related gene molecular marker tracking-assisted selective breeding, and carrying out multi-generation directional selection on offspring to breed a purple-leaf fertile material. The method comprises the following steps: hybridizing a purple-leaf rice variety 112A as a male parent, backcrossing an F1 plant with the male parent, selecting a purple-leaf sterile plant from backcrossed progenies, carrying out continuous backcrossing for multiple generations, carrying out whole-course high-quality related gene molecular marker tracking-assisted selective breeding, selecting purple-leaf single plants with excellent agronomic traits and thorough abortion from the progenies, and carrying out high-quality related gene molecular marker tracking-assisted selective breeding. And finally, selecting the high-quality rice three-line sterile line with purple leaves.

Description

Technical Field

[0001] The invention relates to the field of rice breeding, and in particular to a method for breeding a three-line sterile line of purple-leaf high-quality hybrid rice. Background Art

[0002] Hybrid rice breeding for high quality is currently a hot topic in rice breeding research. For a long time, the poor quality of hybrid rice, the difficulty of improvement, and the low planting efficiency have been the most prominent technical and production problems in the development of the rice industry. The South China rice-growing area is the hottest rice-growing area in my country, with high temperature, high humidity and small temperature difference between day and night, which is extremely unfavorable for the formation of high-quality rice. With the development of rice functional genomics, rice quality-related genes are continuously being explored and utilized, and the aggregation breeding of key genes related to rice quality is an important means to improve the quality of hybrid rice. Grain shape, amylose content, gel consistency, gelatinization temperature, etc. are important traits that affect rice quality. Appearance quality-related genes (gs3, GW7 TFA and chalk5, etc.), taste quality-related genes (Wx b and ALK TT ) can significantly improve rice quality.

[0003] The annual planting area of ​​hybrid rice in my country accounts for about half of the total rice planting area, while the output accounts for 58% of the total rice output. Due to self-pollination and weather influences, hybrid F1 often has 3-5% impurities, resulting in a rice loss of 500-600 million kg each year. How to cultivate hybrids with excellent agronomic traits, stable fertility, and the ability to quickly and easily remove impurities and maintain purity during hybrid production is the goal pursued by breeders. To this end, breeders designed to combine leaf color markers with breeding, introduce leaf color markers into sterile lines, and cultivate sterile lines with leaf color markers. Based on the significant differences in leaf color, it is convenient to remove self-pollinated seeds and impurities, and achieve the goal of easily identifying the purity of hybrids. At present, the most commonly used leaf color markers are mainly green-turning albino mutants and purple leaf mutants. In recent years, breeders have used these mutations to develop albino-green leaf color marked sterile lines such as Yutu S, M2S, Biao-1A, and Quanlong A; and used purple leaf mutations to develop two-line sterile lines such as Zhongzi S, Mingzi02S, and Mingzi03S, and three-line indica sterile lines such as Xianhong A, Zhihong A, and Zi A.

[0004] The present invention utilizes the high-quality green leaf maintenance line to introduce high-quality related genes into the purple-leaf three-line sterile line, and cultivates a new purple-leaf sterile line with excellent agronomic traits and high quality. Summary of the invention

[0005] The present invention provides a method for breeding a three-line sterile line of high-quality purple-leaf hybrid rice. The method is based on gene fluorescent functional molecular markers and purple leaf markers discernible by the naked eye, is simple and efficient, and can quickly and accurately breed high-quality three-line sterile lines of purple-leaf.

[0006] The specific scheme is to provide a method for breeding a three-line sterile line of purple-leaf high-quality hybrid rice, comprising the following steps:

[0007] (1) Using the purple leaf rice maintainer line Xianhong B as the female parent and hybridizing it with the green leaf rice maintainer line Yexiang B to obtain F1 generation seeds;

[0008] (2) Planting F1 seeds, and then hybridizing with the high-quality green-leaf variety Taifeng B. Selecting purple-leaf plants from the hybrid offspring and backcrossing with Taifeng B. Using self-designed molecular markers of high-quality related genes to track and assist in selection breeding, and selecting purple-leaf plants carrying all target high-quality genes as seed planting offspring; after multiple generations of self-pollination and directional selection, the offspring are bred to produce purple-leaf fertile materials with excellent agronomic traits as the corresponding maintainer lines;

[0009] (3) The purple leaf fertile material BC1F3 in step (2) is used as the male parent and hybridized with the purple leaf rice variety Xianhong A to obtain F1 seeds, and the F1 generation seeds are planted. The sterile plants of the F1 generation are selected and backcrossed with the male parent, and the sterile plants with purple leaves are selected after backcrossing. After continuous backcrossing for multiple generations, the self-designed high-quality related gene molecular markers are used throughout the process to track and assist in selection breeding. Among the offspring, single plants with purple leaf markers, excellent agronomic traits and complete sterility are selected, and finally the high-quality three-line sterile line of purple leaves is selected.

[0010] Further, in step (1), the purple leaf rice maintainer line Xianhong B carries the high chalky allele Chalk5, the short grain gene GS3, the short and thick grain length-width ratio gene gw7, the high amylose gene Wx a and high gelatinization temperature gene ALK GC The green leaf rice maintainer line Yexiang B carries the low chalkiness superior allele chalk5, the long grain gene gs3, and the medium amylose gene Wx b and low gelatinization temperature gene ALK TT .

[0011] Further, in step (2), the high-quality green leaf variety Taifeng B carries the long grain gene gs3 and the slender grain length-width ratio gene GW7 TFA , medium amylose gene Wx b and low gelatinization temperature gene ALK TT .

[0012] Further, in step (2) and step (3), the self-designed high-quality related gene molecular markers include chalky gene Chalk5, long grain gene gs3, grain length-width ratio gene GW7, medium amylose gene Wx b And fluorescent functional molecular markers of the gelatinization temperature gene ALK.

[0013] Further explanation, in step (2), the fertile material with excellent agronomic traits refers to purple leaves, plant height 98 cm, 10.02 effective ears, 190 grains per ear, 93% fruit set rate, upright and compact plant and leaf shape, grain length-to-width ratio of 4.2, chalkiness rate less than or equal to 1%, amylose content of about 16%, alkali digestion value of about 7.0, and 1000-grain weight of 21 g.

[0014] To further illustrate, in step (2), the multiple generations are 8-10 generations; in step (3), the multiple generations are 7-9 generations.

[0015] Further explanation, in step (3), the excellent agronomic traits include yellow grains and purple lemma tips; in early March in Nanning, the main stem has 12 leaves, and it takes about 78 days from sowing to the initial heading stage; in mid-July in the late season, it takes about 76 days from sowing to the initial heading stage; the plant has a good leaf shape, the leaves are raised, the leaves are luxuriant, and they do not age prematurely; the flowering time is about half an hour later than that of Guizi B, but more concentrated, with a general phimosis degree of 21.9%, a phimosis grain rate of 7.4%, a flowering grain rate of more than 92%, a stigma exposure rate of 83.8%, of which the bilateral stigma exposure rate accounts for 50.5%; the stigma activity test results show that within 4 days after flowering, the cross-pollination fruiting rate is more than 60%, 5 to 7 days after flowering, the cross-pollination fruiting rate is between 15% and 31%, and 10 days after flowering, the cross-pollination fruiting rate is 0.

[0016] Further explanation: the names and specific sequences of the primers for the fluorescent functional molecular markers of the five target genes designed by the self-designed method are:

[0017] The primer names and specific sequences of the fluorescent functional molecular marker Chalk5-a of the rice chalky gene Chalk5 are as follows:

[0018] Chalk5a-FtGAAGGTCGGAGTCAACGGATTCAGACGGTGCCGTTTGTAGT

[0019] Chalk5a-Fc GAAGGTGACCAAGTTCATGCTCAGACGGTGCCGTTTGTTGC

[0020] Chalk5a-RTTTGTCACTGTCTTCTATCTCACC

[0021] The primer names and specific sequences of the fluorescent functional molecular marker gs3-AA of the rice long-grain gene gs3 are as follows:

[0022] RGs3-RTGAAGGTCGGAGTCAACGGATTCAGCAGGCTGGCTTACTCTCTT

[0023] RGs3-RG GAAGGTGACCAAGTTCATGCTCAGCAGGCTGGCTTACTCTCTG

[0024] RGs3-F ACACATGCCCATCTCCCTCG

[0025] The primer names and specific sequences of the fluorescent functional molecular marker GW7-90 of the rice grain length-width ratio gene GW7 are as follows:

[0026] GW7-90Fa GAAGGTGACCAAGTTCATGCTCATCTCACGCGTCCCAAA

[0027] GW7-90FgGAAGGTCGGAGTCAACGGATTCATCTCACGCGTCCCAAG

[0028] GW7-90R CAGCTCACGCACATCCAACT

[0029] Rice medium amylose gene Wx b The primer names and specific sequences of the fluorescent functional molecular marker Wx-b are as follows:

[0030] Wx-b-FtGAAGGTCGGAGTCAACGGATTCATCAGGAAGAACATCTGCAAGT

[0031] Wx-b-Fg GAAGGTGACCAAGTTCATGCTATCAGGAAGAACATCTGCAAGG

[0032] Wx-bR GATCTGAATAAGAGGGGAAACAAA

[0033] The primer names and specific sequences of the fluorescent functional molecular marker ALK-TT of the rice gelatinization temperature gene ALK are as follows:

[0034] alk-Ftt GAAGGTGACCAAGTTCATGCTTACAAGGAGAGCTGGAGGGGtt

[0035] alk-FgcGAAGGTCGGAGTCAACGGATTTACAAGGAGAGCTGGAGGGGgc

[0036] alk-R CTGAGGTCCTGCGACATGC

[0037] The names and specific sequences of the two universal fluorescent primers are as follows:

[0038] #1:GAAGGTGACCAAGTTCATGCT;

[0039] #2: GAAGGTCGGAGTCAACGGATT.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] (1) First, when the sterile lines bred by the scheme of the present invention are propagated, the purity of the parents can be improved. Since the maintainer line Guizi B and the sterile line Guizi A bred by the scheme of the present invention are both marked with purple leaves, the green leaf mixed plants can be easily removed by leaf color identification at the seedling stage when the sterile lines are propagated. In addition, the purity of hybrids can be effectively improved. Since the F1 generation of the purple leaf sterile line all show green leaves, it is easy to identify the sterile lines and maintainer lines mixed in the hybrids, that is, the purple leaf plants are all mixed plants. Third, the purity of field hybrids can be improved. When producing seeds, the purple leaf sterile line and the restorer line are prepared into F1 seeds, and the plants showing green leaves can be regarded as mixed plants and removed, which can quickly, intuitively and accurately remove the self-pollinated hybrid plants produced by parental self-pollination. As long as the pollen purity of the male parent is strictly controlled, the seed purity of the hybrid F1 generation can be improved. Fourth, when testing and matching hybrid rice combinations, it is beneficial to breed high-quality hybrid rice varieties.

[0042] (2) The present invention uses molecular markers to select chalky genes, long grain genes, grain length-width ratio genes, medium amylose genes, low gelatinization temperature genes, and purple leaf traits in each generation, and can quickly select chalk5, gs3, GW7 TFA 、Wx b and ALK TT A stable purple-leaf strain with multi-gene aggregation is produced, and purple-leaf plants with 5 genes homozygous are bred through targeted selection to ensure uniform rice traits from generation to generation. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is a diagram of the breeding process of Guizi A according to the present invention.

[0044] Figure 2 This is the genotyping diagram of the target gene chalky gene Chalk5 in this example, 384 plants in the BC2F2 population; among them, the circled ones are homozygous plants of the superior allele chalk5 type.

[0045] Figure 3 This is the genotyping diagram of the target gene long-grain gene gs3 in this example, 384 plants in the BC2F2 population; among them, the plants in the circle are homozygous plants of the superior allele gs3 type.

[0046] Figure 4This is the genotyping diagram of the target gene grain length-width ratio gene GW7 in this example in 384 plants of the BC2F2 population; the circled ones are the superior alleles GW7 TFA Type homozygous plants.

[0047] Figure 5 The target gene in this embodiment is the medium amylose gene Wx b Genotyping diagram of 384 plants in the BC2F2 population; the circled ones are the superior alleles Wx b Type homozygous plants.

[0048] Figure 6 This is the genotyping diagram of the target gene gelatinization temperature gene ALK in this example in 384 plants of the BC2F2 population; the circled ones are the superior allele type ALK TT Homozygous plants.

[0049] Figure 7 The plant and spike characteristics of Guizi A bred by the technical solution of the present invention are shown in the figure below. The two middle rows in the left figure are Guizi A rice, and the right figure is a spike of Guizi A.

[0050] Figure 8 The hybrid combination of Guizi A bred by the technical solution of the present invention is applied in field seed production. Among them, the middle is the female purple-leaf three-line sterile line Guizi A, and the two sides are the male green-leaf three-line restorer lines.

[0051] Fig. 9 This is a comparison chart of the grain shapes of Guizi A bred by the technical solution of the present invention and its parent Xianhong B. DETAILED DESCRIPTION

[0052] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0053] Example:

[0054] A method for breeding a three-line sterile line of purple-leaf high-quality hybrid rice comprises the following steps:

[0055] (1) hybridizing the purple-leaf rice maintainer Xianhong B with the green-leaf rice maintainer Yexiang B to obtain F1 generation seeds;

[0056] The purple leaf rice maintainer line Xianhong B carries the high chalky allele Chalk5, the short grain gene GS3, the short and thick grain length-width ratio gene gw7, the high amylose gene Wx a and high gelatinization temperature gene ALK GC The green leaf rice maintainer line Yexiang B carries the low chalkiness allele chalk5, the long grain gene gs3, and the medium amylose gene Wx b and low gelatinization temperature gene ALK TT ;

[0057] (2) Planting F1 seeds, and then hybridizing with the high-quality green leaf variety Taifeng B. From the hybrid offspring, purple-leaf plants are selected and then backcrossed with Taifeng B. Self-designed low chalkiness gene molecular markers, long-grain gene molecular markers, grain length-width ratio gene molecular markers, medium amylose gene molecular markers, and low gelatinization temperature gene molecular markers are used throughout the process for tracking and assisted selection breeding. Purple-leaf plants carrying all target high-quality genes and excellent agronomic traits are selected as seed planting offspring; the offspring are self-pollinated for multiple generations of directional selection to select fertile materials with purple leaves as the corresponding maintainer lines;

[0058] The high-quality green leaf variety Taifeng B carries the long-grain gene gs3 and the slender grain length-width ratio gene GW7. TFA , medium amylose gene Wx b and low gelatinization temperature gene ALK TT ;

[0059] The agronomically excellent fertile material refers to purple leaves, plant height 98 cm, effective number of ears 10.02, number of grains per ear 190, fruit set rate 93%, upright and compact plant and leaf type, grain length-width ratio 4.2, chalkiness rate less than or equal to 1%, amylose content of about 16%, alkali digestion value of about 7.0, and thousand-grain weight of 21 g;

[0060] (3) The fertile material BC1F3 with purple leaf marker in step (2) is used as the male parent and hybridized with the purple leaf rice variety Xianhong A to obtain F1 seeds, and the F1 generation seeds are planted. The sterile plants with excellent traits are selected from the F1 generation and backcrossed with the male parent. The sterile plants with purple leaves are selected after backcrossing. After continuous backcrossing for multiple generations, the self-designed chalk gene molecular markers, long grain gene molecular markers, grain length-width ratio gene molecular markers, medium amylose gene molecular markers and low gelatinization temperature gene molecular markers are used throughout the process for tracking and assisted selection breeding. Among the offspring, individual plants with purple leaves, excellent agronomic traits and complete sterility are selected, and finally a high-quality three-line sterile rice line with purple leaves is selected.

[0061] In the present invention, the above five genes were amplified by PARMS technology, carrying the low chalkiness superior allele chalk5, the long grain gene gs3, and the grain length-width ratio gene GW7. TFA, medium amylose gene Wx b and low gelatinization temperature gene ALK TT , are all known rice genes. All primers were designed and verified according to the internal sequence of the gene. The PCR product was quickly detected in a microplate reader containing three fluorescence detection channels: FAM, HEX and ROX. The fluorescence intensity signal value was read, and then the fluorescence signal value file was analyzed by SNPdecoder (http: / / www.snpway.com / snpdecoder01 / ) software to obtain the FAM and HEX fluorescence signal intensity of each sample amplified, and each signal point was output in a graphical form. Finally, genotyping was automatically performed according to the fluorescence signal intensity to obtain the genotype results, see Figure 2-Figure 6 .

[0062] The primer names and specific sequences of the fluorescent functional molecular markers of the above five target genes are:

[0063] The primer names and specific sequences of the fluorescent functional molecular marker Chalk5-a of the rice chalky gene Chalk5 are as follows:

[0064] Chalk5a-FtGAAGGTCGGAGTCAACGGATTCAGACGGTGCCGTTTGTAGT

[0065] Chalk5a-Fc GAAGGTGACCAAGTTCATGCTCAGACGGTGCCGTTTGTTGC

[0066] Chalk5a-RTTTGTCACTGTCTTCTATCTCACC

[0067] The primer names and specific sequences of the fluorescent functional molecular marker gs3-AA of the rice long-grain gene gs3 are as follows:

[0068] RGs3-RTGAAGGTCGGAGTCAACGGATTCAGCAGGCTGGCTTACTCTCTT

[0069] RGs3-RG GAAGGTGACCAAGTTCATGCTCAGCAGGCTGGCTTACTCTCTG

[0070] RGs3-F ACACATGCCCATCTCCCTCG

[0071] The primer names and specific sequences of the fluorescent functional molecular marker GW7-90 of the rice grain length-width ratio gene GW7 are as follows:

[0072] GW7-90Fa GAAGGTGACCAAGTTCATGCTCATCTCACGCGTCCCAAA

[0073] GW7-90FgGAAGGTCGGAGTCAACGGATTCATCTCACGCGTCCCAAG

[0074] GW7-90R CAGCTCACGCACATCCAACT

[0075] Rice medium amylose gene Wx b The primer names and specific sequences of the fluorescent functional molecular marker Wx-b are as follows:

[0076] Wx-b-FtGAAGGTCGGAGTCAACGGATTCATCAGGAAGAACATCTGCAAGT

[0077] Wx-b-Fg GAAGGTGACCAAGTTCATGCTATCAGGAAGAACATCTGCAAGG

[0078] Wx-bR GATCTGAATAAGAGGGGAAACAAA

[0079] The primer names and specific sequences of the fluorescent functional molecular marker ALK-TT of the rice gelatinization temperature gene ALK are as follows:

[0080] alk-Ftt GAAGGTGACCAAGTTCATGCTTACAAGGAGAGCTGGAGGGGtt

[0081] alk-FgcGAAGGTCGGAGTCAACGGATTTACAAGGAGAGCTGGAGGGGgc

[0082] alk-R CTGAGGTCCTGCGACATGC

[0083] The names and specific sequences of the two universal fluorescent primers are as follows:

[0084] #1:GAAGGTGACCAAGTTCATGCT;

[0085] #2: GAAGGTCGGAGTCAACGGATT;

[0086] Specifically, the process of the method for breeding the three-line sterile line of purple-leaf high-quality hybrid rice in this embodiment is as follows:

[0087] ⑴ In the early season of 2016, in Nanning, the purple leaf maintenance line intermediate material Xianhong B was used as the male parent and carried the low chalkiness excellent allele chalk5, long grain gene gs3, medium amylose gene Wx b and low gelatinization temperature gene ALK TT The green leaf maintenance line Yexiang B was hybridized to obtain F1 seeds; F1 plants were planted in late season, and all F1 plants were green. The F1 plants were then hybridized with gs3, a gene for long grains, and GW7, a gene for the length-width ratio of slender grains. TFA , medium amylose gene Wx b and low gelatinization temperature gene ALK TT The green leaf variety Taifeng B with high-quality related genes was hybridized.

[0088] In the early season of 2017, the three-cross F1 was planted in Nanning. Purple-leaved plants were selected for planting in the seedling stage, and the chalk5 molecular marker was screened. The excellent single plants carrying the chalk5 gene were selected and backcrossed with Taifeng B to obtain BC1F1. In the late season of 2017, BC1F1 was planted, and chalk5, gs3, and GW7 were selected. TFA 、Wx b and ALK TT The molecular markers of high-quality related genes were tracked, and 40 plants with excellent agronomic traits such as slender grains and upright and compact plant leaves were selected and seeds were harvested. BC1F2 was planted in the early season of 2018, and all target gene molecular markers were tracked. Two purple-leaved plants with excellent agronomic traits were selected; after 10 generations of self-pollination, BC1F2 was planted in the late season of 2023. 12 The materials with purple leaves, medium plant height, upright and compact plant and leaf shape, high stigma exposure rate (more than 70% for one side and more than 50% for two sides), and good rice quality (grain length-width ratio of 4.2, chalkiness rate less than or equal to 1%, amylose content of about 16%, and alkali elimination value of 7.0) were selected as the maintainer line materials (late rice in 2023 in BC1F 12 generation).

[0089] ⑵ Plant BC1F3 in the late season of 2018, screen for molecular markers, select 5 purple-leaf plants containing all target genes and test cross with Xianhong A to transfer to sterile lines, and harvest F1 seeds. Plant sterile line F1 in the early season of 2019, track target gene molecular markers, select 4 F1 sterile plants for backcrossing to four pairs; plant in the late season of 2019, track target gene molecular markers, select purple-leaf sterile plants from BC1F1, and backcross 30 pairs. Plant BC3F1 in the early season of 2020, conduct pollen microscopy on sterile plants, strictly select completely sterile lines, and backcross 6 pairs. From the late rice of 2020 to the late rice of 2023, two generations will be screened and backcrossed each year. In the late rice of 2023, the purple-leaf sterile plant line with field number D20 carrying all target genes will be selected after pollen microscopy and molecular marker screening. The corresponding male parent D19 area will be selected accordingly, tentatively named D20A and D20B, and named Guizi A (the purple-leaf high-quality hybrid rice three-line sterile line obtained by breeding) and Guizi B in 2024. For details of the breeding pedigree, please see the attached Figure 1 .

[0090] The main characteristics of Guizi A (a three-line sterile line of purple-leaf high-quality hybrid rice) bred after selection are purple plants, yellow grains, and purple lemma tips. It was sown in early March in Nanning in the early season. The main stem had 12 leaves, and it took about 78 days from sowing to the initial heading stage; it was sown in mid-July in the late season, and it took about 76 days from sowing to the initial heading stage. The plant has a good leaf shape, the leaves are raised, the luxuriant nature is strong, and it does not age prematurely; the flowering time is about half an hour later than Guizi B, but it is more concentrated. The general phimosis degree is 21.9%, the phimosis grain rate is 7.4%, the flowering grain rate is more than 92%, and the stigma exposure rate is 83.8%, of which the bilateral stigma exposure rate accounts for 50.5%; the results of stigma vitality test show that within 4 days after flowering, the cross-pollination fruiting rate is more than 60%, 5 to 7 days after flowering, the cross-pollination fruiting rate is between 15% and 31%, and 10 days after flowering, the cross-pollination fruiting rate is 0.

[0091] A rice variety tentatively named Guizi A (a three-line sterile line of high-quality purple-leaf hybrid rice bred) was compared with its parent material, the purple-leaf maintainer line Xianhong B, and it was found that several rice quality indicators were improved.

[0092] in, Figure 7 This is the characteristic diagram of the plant and flower spike of Guizi A bred by the above scheme; Figure 8 This is an actual picture of the hybrid combination of Guizi A bred by the above scheme in the field seed production. In the middle is the female purple-leaf three-line sterile line Guizi A, and on both sides are the male green-leaf three-line restorer lines; Fig. 9 This is a comparison chart of the grain shapes of Guizi A bred using the above scheme and its parent Xianhong B.

[0093] Rice quality indicators are tested in accordance with national standards.

[0094] Table 1 Comparison of rice quality indicators between the selected rice and its parents

[0095]

[0096] It can be seen from the above table that several rice quality-related indicators of the purple-leaf high-quality hybrid rice three-line sterile line (Guizi A) bred in this application have reached the national standard first-class quality (edible rice variety quality NY / T593-2021), which shows that this breeding method can effectively improve the quality of purple-leaf rice Xianhong B.

[0097] The above description is only a preferred embodiment of the present invention. It should be pointed out that it is possible for a person skilled in the art to make several improvements and changes without departing from the creative concept of the present invention, and these all fall within the protection scope of the present invention.

Claims

1. A method for breeding a three-line sterile line of purple-leaf high-quality hybrid rice, characterized in that: The following steps are involved: (1) Using the purple leaf rice maintainer line Xianhong B as the female parent and hybridizing it with the green leaf rice maintainer line Yexiang B to obtain F1 generation seeds; (2) Planting F1 seeds, and then hybridizing with the high-quality green-leaf variety Taifeng B. Selecting purple-leaf plants from the hybrid offspring and backcrossing with Taifeng B. Using self-designed molecular markers of high-quality related genes to track and assist in selection breeding, and selecting purple-leaf plants carrying all target high-quality genes as seed planting offspring; after multiple generations of self-pollination and directional selection, the offspring are bred to produce purple-leaf fertile materials with excellent agronomic traits as the corresponding maintainer lines; (3) The purple leaf fertile material BC1F3 in step (2) is used as the male parent and hybridized with the purple leaf rice variety Xianhong A to obtain F1 seeds, and the F1 generation seeds are planted. The sterile plants of the F1 generation are selected and backcrossed with the male parent, and the sterile plants with purple leaves are selected after backcrossing. After continuous backcrossing for multiple generations, the self-designed high-quality related gene molecular markers are used throughout the process to track and assist in selection breeding. Among the offspring, single plants with purple leaf markers, excellent agronomic traits and complete sterility are selected, and finally the high-quality three-line sterile line of purple leaves is selected.

2. The method for breeding the three-line sterile line of purple-leaf high-quality hybrid rice as claimed in claim 1, characterized in that: In step (1), the purple leaf rice maintainer line Xianhong B carries the high chalkiness allele Chalk5, the short grain gene GS3, the short and thick grain length-width ratio gene gw7, the high amylose gene Wx a and high gelatinization temperature gene ALK GC The green leaf rice maintainer line Yexiang B carries the low chalkiness superior allele chalk5, the long grain gene gs3, and the medium amylose gene Wx b and low gelatinization temperature gene ALK TT .

3. The method for breeding the three-line sterile line of purple-leaf high-quality hybrid rice as claimed in claim 1, characterized in that: In step (2), the high-quality green leaf variety Taifeng B carries the long grain gene gs3 and the slender grain length-width ratio gene GW7 TFA , medium amylose gene Wx b and low gelatinization temperature gene ALK TT .

4. The method for breeding the three-line sterile line of purple-leaf high-quality hybrid rice as claimed in claim 1, characterized in that: In step (2) and step (3), the self-designed high-quality related gene molecular markers include chalky gene Chalk5, long grain gene gs3, grain length-width ratio gene GW7, medium amylose gene Wx b And fluorescent functional molecular markers of the gelatinization temperature gene ALK.

5. The method for breeding the three-line sterile line of purple-leaf high-quality hybrid rice as claimed in claim 1, characterized in that: In step (2), the fertile material with excellent agronomic traits refers to purple leaves, plant height of 98 cm, 10.02 effective ears, 190 grains per ear, 93% fruit set rate, upright and compact plant and leaf shape, grain length-to-width ratio of 4.2, chalkiness rate less than or equal to 1%, amylose content of about 16%, alkali digestion value of about 7.0, and 1000-grain weight of 21 g.

6. The method for breeding the three-line sterile line of purple-leaf high-quality hybrid rice as claimed in claim 1, characterized in that: In step (2), the multiple generations are 8-10 generations; in step (3), the multiple generations are 7-9 generations.

7. The method for breeding the three-line sterile line of purple-leaf high-quality hybrid rice as claimed in claim 1, characterized in that: In step (3), the excellent agronomic traits include yellow grains and purple lemma tips; in early March in Nanning, the main stem has 12 leaves, and it takes about 78 days from sowing to the initial heading stage; in mid-July in the late season, it takes about 76 days from sowing to the initial heading stage; the plant has a good leaf shape, the leaves are raised, the leaves are luxuriant, and they do not age prematurely; the flowering time is about half an hour later than that of Guizi B, but more concentrated, generally the phimosis degree is 21.9%, the phimosis grain rate is 7.4%, the flowering grain rate is more than 92%, the stigma exposure rate is 83.8%, of which the bilateral stigma exposure rate accounts for 50.5%; the stigma activity test results show that within 4 days after flowering, the cross-pollination fruiting rate is more than 60%, 5 to 7 days after flowering, the cross-pollination fruiting rate is between 15% and 31%, and 10 days after flowering, the cross-pollination fruiting rate is 0.

8. The method for breeding the three-line sterile line of purple-leaf high-quality hybrid rice as claimed in claim 4, characterized in that: The names and specific sequences of the primers for the fluorescent functional molecular markers of the five target genes designed by the self-designed method are: The primer names and specific sequences of the fluorescent functional molecular marker Chalk5-a of the rice chalky gene Chalk5 are as follows: Chalk5a-FtGAAGGTCGGAGTCAACGGATTCAGACGGTGCCGTTTGTAGT Chalk5a-Fc GAAGGTGACCAAGTTCATGCTCAGACGGTGCCGTTTGTTGC Chalk5a-RTTTGTCACTGTCTTCTATCTCACC The primer names and specific sequences of the fluorescent functional molecular marker gs3-AA of the rice long-grain gene gs3 are as follows: RGs3-RTGAAGGTCGGAGTCAACGGATTCAGCAGGCTGGCTTACTCTCTT RGs3-RG GAAGGTGACCAAGTTCATGCTCAGCAGGCTGGCTTACTCTCTG RGs3-F ACACATGCCCATCTCCCTCG The primer names and specific sequences of the fluorescent functional molecular marker GW7-90 of the rice grain length-width ratio gene GW7 are as follows: GW7-90Fa GAAGGTGACCAAGTTCATGCTCATCTCACGCGTCCCAAA GW7-90FgGAAGGTCGGAGTCAACGGATTCATCTCACGCGTCCCAAG GW7-90R CAGCTCACGCACATCCAACT Rice medium amylose gene Wx b The primer names and specific sequences of the fluorescent functional molecular marker Wx-b are as follows: Wx-b-FtGAAGGTCGGAGTCAACGGATTCATCAGGAAGAACATCTGCAAGT Wx-b-Fg GAAGGTGACCAAGTTCATGCTATCAGGAAGAACATCTGCAAGG Wx-bR GATCTGAATAAGAGGGGAAACAAA The primer names and specific sequences of the fluorescent functional molecular marker ALK-TT of the rice gelatinization temperature gene ALK are as follows: alk-Ftt GAAGGTGACCAAGTTCATGCTTACAAGGAGAGCTGGAGGGGtt alk-FgcGAAGGTCGGAGTCAACGGATTTACAAGGAGAGCTGGAGGGGgc alk-R CTGAGGTCCTGCGACATGC The names and specific sequences of the two universal fluorescent primers are as follows: #1:GAAGGTGACCAAGTTCATGCT; #2: GAAGGTCGGAGTCAACGGATT.

Images