Application of vinetura-199 in preparation of medicine for preventing and treating akabane virus

Abstract

The invention belongs to the technical field of biology, and particularly discloses an application of vinetulaABT-199 in preparation of drugs for preventing and treating akabane viruses, and the vinetulaABT-199 is used as a unique active component in prevention and treatment of the akabane viruses. Through determination of CC50 values and IC50 values in cells and healthy cells after akabane virus infection, it is found that Vinetura can be used as an akabane virus inhibitor. Furthermore, Western blot finds that the vinetura has a good inhibition effect on the akabane virus when the concentration is 1-10 [mu] M, and almost completely inhibits the replication of the akabane virus when the concentration reaches 10 [mu] M, thereby providing a new candidate drug for preventing and treating the akabane virus.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to application of venetoclax ABT-199 in preparing medicines for preventing and treating Akabane virus. Background Art

[0002] Venetoclax (ABT-199) is a BCL-2 inhibitor used to treat chronic lymphocytic leukemia (CLL) and acute myeloid leukemia (AML). By selectively inhibiting the BCL-2 protein, ABT-199 promotes apoptosis of cancer cells that rely on this protein for survival. ABT-199 also shows potential for antiviral applications. Certain viruses (such as herpes viruses and HIV) prolong the survival of infected cells by upregulating BCL-2 family proteins, thereby promoting viral replication and spread. ABT-199 induces apoptosis of infected cells and reduces viral replication and spread by inhibiting BCL-2. At present, the antiviral effect of ABT-199 is mainly in the basic research stage, and studies have shown its potential role in new coronavirus, herpes virus and HIV infection. In general, ABT-199 has potential in antiviral therapy.

[0003] Akabane virus (AKAV) is a member of the Orthobunyavirus genus of the Peribunyaviridae family. It is a single-stranded negative-sense RNA virus. Its genome consists of three segments, namely the L segment encoding transcription and replication-related enzymes, the M segment encoding two glycoproteins (Gc and Gn) and a non-structural protein (NSm), and the S segment encoding the nucleocapsid protein (N) and non-structural protein (NSs). AKAV infection can cause a polymorphic infectious disease characterized by abortion, premature birth, stillbirth, congenital arthrogryposis, hydrocephalus, and encephalomyelitis in cattle and sheep. AKAV infection has broken out in many countries and regions. AKAD is one of the legally notifiable diseases of the World Organization for Animal Health (WOAH) and one of the diseases that must be inspected for imported cattle and sheep in my country. However, there are currently no drugs for AKAV on the market, and it is urgent to develop an effective drug based on ABT-199. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides an application of venetola ABT-199 in preparing a medicine for preventing and treating Akabane virus.

[0005] To achieve the above object, the present invention is implemented according to the following technical solutions: One of the technical solutions of the present invention is the use of venetola ABT-199 as the only active ingredient in the preparation of medicines for preventing and treating Akabane virus.

[0006] The second technical solution of the present invention is a drug for preventing and treating Akabane virus, comprising venetoclax ABT-199, and usually also comprising a pharmaceutically acceptable carrier and / or excipient.

[0007] Preferably, the dosage form of the drug is one of tablets, sprays, granules, capsules, oral liquids, injections, and suspensions.

[0008] Compared with the prior art, the present invention measures the CC of cells infected with Akabane virus. 50 Value and IC 50 The results showed that venetoclax could be used as an inhibitor of Akabane virus. Further WB showed that venetoclax had a good inhibitory effect on Akabane virus at a concentration of 1-10 μM, and almost completely inhibited the replication of Akabane virus at a concentration of 5 μM, providing a new candidate drug for the prevention and treatment of Akabane virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 Venetoclax ABT-199 inhibits CC infected with Akabane virus 50 and IC 50 The value of the measurement diagram: (a) is CC 50 Determination diagram; (b) is IC 50 Determination diagram.

[0010] Figure 2 This is a graph showing the inhibitory effect of venetoclax ABT-199 on the copy number of the Akabane virus genome.

[0011] Figure 3 This is a graph showing the inhibitory effect of venetoclax ABT-199 on the expression of Akabane virus GC protein. DETAILED DESCRIPTION

[0012] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not used to limit the invention.

[0013] The MDBK cells used in the following examples are preserved by the Guangdong Provincial Key Laboratory of Animal Molecular Design and Precision Breeding. MDBK cells are a cell line derived from the kidneys of adult cattle. The cell line can spontaneously differentiate into epithelial-like monolayer cells and is the optimal in vitro model for studying anti-Akabane virus drugs. Vero cells are preserved by the Guangdong Provincial Key Laboratory of Animal Molecular Design and Precision Breeding. Vero cells are African green monkey kidney cells, which are a kind of aneuploid cells derived from macaque kidney cell culture. Like the famous Hela cell line and canine kidney cells (MDCK cells), they are commonly used cell lines. Other related reagents used, if not otherwise specified, are all commercially available agents, and the methods involved, if not otherwise specified, are all well-known methods.

[0014] The compound used, venetolazepine ABT-199, was purchased from Shanghai Yuanye Biotechnology Co., Ltd., and its chemical molecular structure is shown below: ; The Akabane virus strain used was isolated in our laboratory: Akabane virus AKAV_FS202301, with a deposit number of CCTCC NO: V2024119, and a sequence number of PQ567126-PQ567128; it was subcultured on Vero cells.

[0015] In order to verify whether Venetola ABT-199 can be used as the only active ingredient to prepare drugs for the prevention and treatment of Akabane virus, the following tests were conducted: 1. CC of Venetoclax ABT-199 in MDBK cells 50 and IC 50 (1) A 10 mM venetoclax solution dissolved in 30 μL dimethyl sulfoxide (DMSO) was diluted serially with basal DMEM medium to obtain a venetoclax dilution solution with a concentration of 12.5 to 200 μM.

[0016] (2) MDBK cells were cultured at 1×10 5 Cells / well were plated in a 96-well cell plate (the culture medium was DMEM medium containing 20% ​​FBS) to obtain a cell plate containing MDBK and to detect the half cytotoxic concentration CC of venetoclax. 50 , as follows: The experimental wells were set up as follows: venetoclax solutions with final concentrations of 12.5-200 μM were added to the cell plate containing MDBK cells, and each concentration of venetoclax solution was repeated in 8 replicate wells (one column in a 96-well plate); the blank wells were set up as follows: containing only culture medium; the experimental wells were set up as follows: containing cells, culture medium and venetoclax solution treatment; the control wells were set up as follows: no venetoclax solution treatment.

[0017] Cell culture (37°C, 5% CO 2 ) After 24 h, 10 μL of CCK-8 solution was added to each well. After the culture plate was incubated in the incubator for 4 h, the absorbance at 405 nm was measured using a microplate reader, and the cell viability (%) was calculated according to formula I.

[0018] Formula I: Cell survival rate (%) = [(OD value of experimental well - OD value of blank well) / (OD value of control well - OD value of blank well)] × 100 When the cell survival rate is 50%, the concentration of the venetolazepine dilution in the corresponding experimental well is the half cytotoxic concentration CC of venetolazepine. 50 .

[0019] (3) Using the cell plate containing MDBK cells obtained in step (1) as an example, the IC of venetoclax was detected. 50 , as follows: After Akabane virus was infected into MDBK cells at MOI = 0.01, venetoclax was diluted with basal DMEM medium to obtain a venetoclax solution with a concentration of 1.25-20 μM.

[0020] 1.25, 2.5, 5, 10 and 20 μM venetola solution were added to the cell plate, respectively. After culturing for 24 h, the viral genome copy number was finally detected by fluorescence quantitative PCR targeting the NSS gene of AKAV virus. The total volume of the fluorescence quantitative PCR reaction system was 20 μL, including 10 μL of SYBR Green I; 0.4 μL of upstream and downstream primers, 2 μL of template, and sterile deionized water was added to 20 μL; the upstream primer sequence was: TAAGACGCCACAACCAAGTGT; The downstream primer sequence is: CCGAAATGCGATGGAGCGTA; The drug concentration of venetoclax that inhibits half of Akabane virus in MDBK cells was calculated as IC 50 .CC 50 Assay results and IC 50 The results of the test are as follows Figure 1 As shown in (b) and (a).

[0021] Depend on Figure 1 It can be seen that the CC of venetoclax in MDBK cells 50 The value is 18.05 μM, indicating that the half cytotoxic concentration of venetoclax in MDBK cells is 18.05 μM, indicating that it has low cytotoxicity to these cells; the IC 50The value was 2.651 μM, indicating that venetola can exert a good anti-Akabane virus effect at a concentration of 2.651 μM. The results suggest that venetola is a potential inhibitor of Akabane virus.

[0022] 2. Effect of Venetola treatment on Akabane virus infection in MDBK cells Effects on the copy number of Akabane virus in cells MDBK cells (2 × 10 cells / mL) were cultured in 12-well plates using DMEM medium containing 10% FBS. 6 / well), the experimental group was inoculated with Akabane virus (MOI = 0.01) and then treated with different concentrations (1, 1.25, 2.5, 5, 10) of venetoclax, and the infection control group was treated with Akabane virus (MOI = 0.01) mixed with DMSO. The blank control was treated with cells without Akabane virus and culture medium. The cell plate was placed at 37°C and 5% CO 2 After 24 h of conditioned culture, total cell RNA was extracted by the Trozil method and reverse transcribed into cDNA. Finally, the viral genome copy number was detected by fluorescence quantitative PCR targeting the Akabane virus NSS gene. The total volume of the fluorescence quantitative PCR reaction system was 20 μL, including 10 μL of SYBR Green I; 0.4 μL of upstream and downstream primers, 2 μL of template, and sterile deionized water was added to 20 μL; the upstream primer sequence was: TAAGACGCCACAACCAAGTGT; The downstream primer sequence is: CCGAAATGCGATGGAGCGTA; The viral copy number calculation results of MDBK cells after Akabane virus infection were calculated using different concentrations (1, 1.25, 2.5, 5, and 10 μM) of venetoclax. Figure 2 As shown. The results showed that in MDBK cells, compared with the control group, with the increase of venetola concentration, the copy number of Akabane virus genome gradually decreased. The results show that venetola can inhibit the replication of Akabane virus in a dose-dependent manner.

[0023] Effects on the expression of GC protein of Akabane virus in cells MDBK cells (2 × 10 cells / mL) were cultured in 12-well plates using DMEM medium containing 20% ​​FBS. 6 / well), the experimental group was inoculated with AKAV virus (MOI = 0.01), and then treated with different concentrations (1, 1.25, 2.5, 5, 10 μM) of venetoclax, and the infection control group was treated with Akabane virus (MOI = 0.01) mixed with DMSO. The blank control was treated with cells without Akabane virus and culture medium. The cell plate was placed at 37°C and 5% CO2 After 24 h of conditioned culture, the cell culture supernatant was discarded, and the cells were rinsed three times with PBS. After adding 1× SDS-PAGE loading buffer, the proteins were denatured (100°C, 10 min), and then centrifuged for 10 min (12,000 r / min). The protein samples were homogenized and added to the sample tank of the gel. After electrophoresis (120 V, 30 min), the bromophenol blue dye dropped to the edge of the gel and then transferred to a PVDF membrane that had been pre-warmed with methanol (100 V, 1 h). The membrane was blocked with 5% skim milk powder (2 h), and the skim milk powder was discarded. The PVDF membrane was washed with 1× TBST, the primary antibody was added and placed in a refrigerator at 4°C overnight, the PVDF membrane was washed with 1× TBST (10 min / time x 3 times), the corresponding secondary antibody was added (incubated for 2 h), and 1× TBST was used to wash (10 min / time x 3 times). Finally, the ECL luminescent solution was used for exposure to detect the expression of Akabane virus GC protein.

[0024] After MDBK was infected with Akabane virus and treated with different concentrations of venetoclax, the expression results of Akabane virus NSS protein were as follows: Figure 3 As shown. The results showed that in MDBK cells, compared with the control group, with the increase of venetola concentration, the expression of Akabane virus GC protein gradually decreased. The results show that venetola can inhibit the replication of Akabane virus.

[0025] In summary, Venetola ABT-199 can be used as the sole active ingredient to prepare drugs for preventing and treating Akabane virus. Of course, the prepared drugs contain Venetola ABT-199 and also contain pharmaceutically acceptable carriers and / or excipients; the dosage form of the drug is one of tablets, sprays, granules, capsules, oral solutions, injections, and suspensions.

[0026] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. Use of Venetola ABT-199 as the sole active ingredient in the preparation of drugs for preventing and treating Akabane virus.

2. A drug for preventing and treating Akabane virus, characterized in that: Contains Venetola ABT-199.

3. The drug for preventing and treating Akabane virus according to claim 2, characterized in that It also contains pharmaceutically acceptable carriers and / or excipients.

4. The drug for preventing and treating Akabane virus according to claim 2 or 3, characterized in that: The dosage form of the medicine is one of tablets, sprays, granules, capsules, oral liquids, injections and suspensions.

Images