Alcoholic liver disease animal model construction of GATA4 gene and application of alcoholic liver disease animal model in prevention and treatment drugs

Abstract

The invention discloses construction of an alcoholic liver disease animal model of a GATA4 gene and application of the alcoholic liver disease animal model in prevention and treatment drugs, and belongs to the technical field of mouse model construction. The construction method of the animal model comprises the following steps: hybridizing a GATA flox transgenic hybrid mouse and a Vill-Cre transgenic mouse to obtain an F1 generation, selfing the transgenic mice with the genotypes of GATA4flox / + and Vill-Cre in the F1 generation to obtain an F2 generation mouse, identifying the genotypes of the mice by using a polymerase chain reaction (PCR) amplification reaction system, and screening to obtain a GATA4flox / flox / Vill-Cre transgenic hybrid mouse with the genotype of GATA4flox / + and Vill-Cre transgenic hybrid mouse with the genotype of GATA4flox / + and Vill-Cre transgenic hybrid mouse with the genotype of GATA4flox / + and Vill-Cre transgenic hybrid mouse. A GATA4 intestinal specific knockout mouse of the Vill-Cre is obtained; then, a Lieber-DeCarli liquid alcohol feed is given to the GATA4 intestinal specific knockout mouse, and after 7 weeks, the alcoholic liver injury mouse model with the GATA4 intestinal specific knockout is obtained. The invention provides a construction method of an alcoholic liver disease animal model with intestinal GATA4 gene specific knockout and application of GATA4 serving as a target spot in preparation of drugs for preventing and treating liver injury, liver diseases and other related diseases caused by alcohol, and the construction method has important clinical prospects.

Description

Technical Field

[0001] The present invention relates to the field of animal model construction, and more specifically, to an alcoholic liver disease animal model with intestinal-specific knockout of GATA4 gene, a construction method and application thereof, and application of GATA4 gene as a target in the development of drugs for preventing and treating ALD. Background Art

[0002] Alcoholic liver damage is a liver disease caused by long-term heavy drinking. The development of this damage is usually divided into several stages: fatty liver, alcoholic hepatitis, liver fibrosis and cirrhosis. Alcoholic liver disease (ALD) usually manifests as simple fatty liver in the early stage, and can then develop into alcoholic hepatitis, liver fibrosis and cirrhosis.

[0003] ALD is pathologically characterized by multi-stage features ranging from hepatic steatosis (fatty liver) to alcoholic hepatitis and then to alcoholic cirrhosis, among which fatty liver is a common early manifestation; hepatitis is manifested by ballooning of hepatocytes and the formation of Mallory bodies; cirrhosis is manifested by extensive fibrosis and the formation of hepatocyte regenerative nodules, which may lead to portal hypertension and liver failure, and ultimately increase the risk of liver cancer. Clinically, early liver disease may be asymptomatic or only have mild fatigue and upper abdominal discomfort. As the disease worsens, patients may experience symptoms such as jaundice, loss of appetite, tenderness in the liver area, and fever. In the late stage of cirrhosis, patients often have ascites, edema, and bleeding tendency, and may even have manifestations such as hepatic encephalopathy. If the disease progresses further to liver cancer, symptoms such as lumps in the liver area, severe pain, and severe weight loss may occur. Laboratory examinations show that serum AST (aspartate aminotransferase), ALT (alanine aminotransferase), GGT (γ-glutamyl transferase), TBil (total bilirubin), PT (prothrombin time), MCV (mean corpuscular volume) and CDT (glycogen-deficient transferrin) are elevated. Imaging examinations such as B-ultrasound, CT, MRI or transient elastography can show abnormal liver structure and function. Extensive research has also been conducted on the occurrence, development and repair of alcoholic liver injury, but there is still a lack of specific drugs for alcoholic liver injury in clinical practice. Therefore, it is extremely important to deeply explore the molecular mechanisms of hepatocyte proliferation and repair in the occurrence and development of acute liver injury in order to find more effective intervention targets for acute liver injury.

[0004] At present, the clinical treatment of ALD is still mainly based on quitting drinking, nutritional support, improving symptoms and preventing complications. The development of new ALD drugs is relatively slow. Some drugs such as corticosteroids (prednisolone), pentoxifylline, TNF-α inhibitors (Infliximab), etc. are still in the clinical trial stage, but most of them have a single target and it is difficult to delay or prevent the progression of alcoholic liver disease. Therefore, it is of great significance to deeply understand the pathogenesis of alcoholic liver disease and develop safe and effective anti-ALD drugs. However, there are still many deficiencies and areas for improvement in the research and technology of ALD, especially the lack of specific treatment for alcohol-induced liver damage in clinical practice, which needs to be solved urgently. Summary of the invention

[0005] In view of the problems existing in the prior art, the first purpose of the present invention is to provide an animal model of alcoholic liver disease with intestine-specific knockout of the GATA4 gene. Compared with the alcoholic liver injury model constructed by the traditional Lieber-DeCarli liquid alcohol feed, the pathological damage of the animal model, such as transaminase and liver steatosis and inflammation, is more severe; the second purpose of the present invention is to provide the application of the GATA4 gene as a target in drugs for the prevention and treatment of alcoholic liver injury.

[0006] To solve the above problems, the present invention adopts the following technical solutions.

[0007] A method for constructing an alcoholic liver disease animal model with intestinal-specific knockout of GATA4 gene is as follows: GATA flox transgenic heterozygous mice and Vil1-Cre transgenic mice are hybridized to obtain F1 generation, and transgenic mice with genotype of GATA4 flox / + and Vil1-Cre in the F1 generation are screened and self-crossed to obtain F2 generation mice, 1 mm of mouse tails are cut off, 250 μL of lysis solution is added for digestion, mouse genomic DNA is extracted, primers are designed, and polymerase chain reaction, i.e., PCR amplification reaction system, is used to identify the mouse genotype, and GATA4 intestinal-specific knockout mice with genotype of GATA4 flox / flox and Vil1-Cre are screened; GATA4 intestinal-specific knockout mice are then given Lieber-DeCarli liquid alcohol feed, and a GATA4 intestinal-specific knockout mouse model of alcoholic liver injury is obtained after 7 weeks.

[0008] Furthermore, the PCR amplification reaction system is 25 μL, including 9 μL of ddH2O, 12.5 μL of Premix TaqPolymerase, 1.5 μL of DNA template, and 1 μL of each primer; the reaction conditions are: pre-denaturation reaction at 94°C for 3 min, denaturation reaction at 94°C for 30 s, annealing reaction at 62°C for 35 s, and extension reaction at 72°C for 35 s, and the three steps of denaturation → annealing → extension are repeated for 35 cycles, and finally the DNA is finally extended at 72°C for 5 min, and maintained at 12°C after the extension is completed; the PCR product is detected by 1% agarose gel electrophoresis, and the genotype of the mouse is analyzed to determine whether the mouse is a GATA4 intestinal-specific knockout mouse.

[0009] The present invention also provides an alcoholic liver disease animal model with intestinal specific knockout of GATA4 gene, which is obtained by the method for constructing the alcoholic liver disease animal model with intestinal specific knockout of GATA4 gene.

[0010] The present invention also provides an application of an alcoholic liver disease animal model with intestinal specific knockout of GATA4 gene, which is used to study the influence of intestinal GATA4 gene on alcoholic liver disease.

[0011] The present invention also provides the use of GATA4 gene as a target in a drug for preventing or treating alcoholic liver disease, and the use of GATA4 gene as a drug target for preventing or treating alcoholic liver disease.

[0012] Furthermore, the GATA4 gene is used in the preparation of a drug for alleviating liver dysfunction caused by alcohol.

[0013] Furthermore, the GATA4 gene is used in the preparation of a drug for improving alcohol-induced liver inflammation and fatty degeneration.

[0014] Furthermore, the GATA4 gene is used in the preparation of a drug for improving alcohol-induced intestinal hepatic bile acid and cholesterol metabolism disorders.

[0015] The present invention also provides a method for constructing an animal model of alcoholic liver disease with intestinal overexpression of GATA4 gene, including constructing an adeno-associated virus (OE-GATA4-AAV9) containing a GATA4 coding region sequence, injecting OE-GATA4-AAV9 into C57BL / 6 mice by intraperitoneal injection, and detecting intestinal GATA4 protein expression after 3 weeks. Increased GATA4 expression represents successful construction of intestinal overexpression GATA4 mice. After one week of adaptive feeding, mice in the control group were given a liquid feed without alcohol and with the same calories, and mice in the alcohol group were given a Lieber-DeCarli alcohol liquid feed. Samples were collected and analyzed after fasting for 12 hours after the last feeding.

[0016] Compared with the prior art, the advantages of the present invention are:

[0017] 1. Compared with the alcoholic liver injury model constructed by the traditional Lieber-DeCarli liquid alcohol feed, the animal model prepared by the present invention has more severe pathological damages such as transaminase and liver steatosis and inflammation.

[0018] Second, the present invention constructed a mouse model with intestinal specific knockout of the GATA4 gene, and prepared an animal model of alcohol-induced liver damage by feeding 5% liquid alcohol feed (Lieber-DeCarli liquid alcohol feed) for 7 weeks. The mice in the control group were given a liquid feed without alcohol and with the same calories. After the last feeding, the mice were fasted for 12 hours and the samples were taken for analysis. After the experiment, the results showed that long-term alcohol intake caused significant liver function abnormalities and liver damage, and the knockout of intestinal GATA4 aggravated the liver damage caused by alcohol and the level of inflammation in the body.

[0019] 3. The application of the GATA4 gene as a target in preventive and therapeutic drugs provided by the present invention aims at the lack of specific treatment for alcohol-induced liver damage in clinical practice, and expands the application of the intestinal GATA4 gene in the prevention and treatment of alcoholic liver damage.

[0020] Fourth, the present invention also constructed an adeno-associated virus (OE-GATA4-AAV9) containing the GATA4 coding region sequence, and constructed an intestinal overexpression GATA4 mouse model by intraperitoneal injection. After the mice were successfully constructed, they were given Lieber-DeCarli alcohol liquid feed to prepare an alcohol liver injury model. After the last feeding, they were fasted for 12 hours and the samples were collected for analysis. The results showed that the overexpression of intestinal GATA4 significantly improved the abnormal transaminase, liver steatosis and inflammatory response caused by chronic alcohol. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The graphs show the liver function and liver pathology results of GATA4 intestinal-specific knockout mice (GATA4-CKO), littermate negative control mice (WT), and intestinal GATA4-overexpressing mice (AAV-GATA4) injected intraperitoneally with OE-GATA4-AAV9;

[0022] Figure 2 The results of the graphs are as follows: the expression levels of inflammatory cytokines CXCL5 and IL-33 in the liver of GATA4 intestinal-specific knockout mice (GATA4-CKO), littermate negative control mice (WT), and intestinal overexpressing GATA4 mice (AAV-GATA4) after intraperitoneal injection of OE-GATA4-AAV9;

[0023] Figure 3The results of the effects of intestinal GATA4 and ASBT expression levels in GATA4 intestinal-specific knockout mice (GATA4-CKO), littermate negative control mice (WT), and intestinal overexpressing GATA4 mice after intraperitoneal injection of OE-GATA4-AAV9;

[0024] Figure 4 The graph shows the results of the effects on cholesterol deposition in the liver and the expression of FGFR4 and CYP7A1 proteins in liver tissue of GATA4 intestinal-specific knockout mice (GATA4-CKO), littermate negative control mice (WT), and intestinal overexpressing GATA4 mice after intraperitoneal injection of OE-GATA4-AAV9. DETAILED DESCRIPTION

[0025] Example 1: Establishment of an animal model of alcoholic liver disease in GATA4 intestinal-specific knockout mice

[0026] 1. Experimental animals and principles for constructing GATA4 intestinal-specific knockout mice: The mice used in the present invention are GATAflox and Vil1-Cre transgenic mice. GATA flox mice have LoxP sites flanking the exons of the GATA binding protein 4 (GATA4) gene. GATA4 is a zinc finger transcription factor belonging to the GATA family. Villin-Cre is a transgenic mouse model that uses the Vil1 gene promoter to control the expression of Cre recombinase, and Vil1 is a gene encoding the villin 1 protein. Vil1-Cre mice carry the Cre recombinase expression element driven by the endogenous mouse Vil1 promoter. When hybridized with mice containing LoxP flanking sequences, Cre recombinase-mediated recombination will result in the deletion of the sequence between the two unidirectional LoxP sites on the chromosomes in the villi and crypt epithelial cells of the small and large intestines of the offspring mice. The expression of the Cre recombinase transgene begins 12.5 days after fertilization, and some chimeric activity can also be observed in the colon.

[0027] 2. Source of animals: All experimental animals used in the present invention are constructed, raised and bred in the animal center of Saiye (Suzhou) Biotechnology Co., Ltd. The above mice are raised in an SPF-level clean environment with a temperature controlled at 18-22°C, a humidity of 50-70%, and automatic light control (12h light / 12h dark). Mouse cages, feed and bedding are sterilized, and drinking water is sterilized at high temperature and high pressure. The breeding room is disinfected daily to ensure that the breeding environment meets the requirements of the SPF-level animal environment, and the bedding is replaced every 3 days. Animal breeding, maintenance and experimental treatment are carried out in accordance with the guidelines of the Ethics Committee.

[0028] 3. The method for constructing the GATA4 intestinal-specific knockout mouse model of the present invention comprises the following steps:

[0029] (1) GATA flox transgenic heterozygous mice and Vil1-Cre transgenic mice were hybridized to obtain the F1 generation.

[0030] The identification method and results of F1 generation mice are as follows:

[0031] (1.1) PCR identification

[0032] (a) PCR primer information

[0033] The primer sequences for GATA4 flox genotype identification are as follows:

[0034] F: TAGAGTACCACAGACCAGAAAGC;

[0035] R:CACCTAACCTACTCAGACTCTTTTCTTC.

[0036] The primer sequences for Vil1-Cre genotype identification are as follows:

[0037] F: CATATTGGCAGAACGAAAACGC;

[0038] R: CCTGTTTCACTATCCAGGTTACGG.

[0039] (b) Amplify the PCR product according to the following reaction system and reaction conditions:

[0040] The amplification reaction system is 25 μL, including 9 μL ddH2O, 12.5 μL Premix Taq Polymerase, 1.5 μL DNA template and 1 μL each of primers;

[0041] The reaction conditions were as follows: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 s, annealing at 62°C for 35 s, and extension at 72°C for 35 s, and repeating the three steps of denaturation → annealing → extension for 35 cycles, and finally reacting at 72°C for 5 min for final DNA extension. After the extension, the PCR product was obtained and kept at 12°C.

[0042] (1.2) Agarose gel electrophoresis

[0043] The PCR amplification product obtained in step (1.1) was subjected to 1% agarose gel electrophoresis; and the identification result was obtained by comparing it with the judgment criteria.

[0044] (a) Judgment indicators

[0045] I. The GATA4 flox genotype determination index is: there are two genotypes, the one with both about 282bp band and 242bp band is the GATA4 flox heterozygous genotype (flox / +), and the one with only about 242bp band is the wild type;

[0046] II. The Vil1-Cre genotype determination index is: there are two genotypes, the one with a band of about 413 bp is the Vil1-Cre genotype, and the one without a band is the wild type.

[0047] (b) Identification results

[0048] There are four genotypes of F1 mice: ①GATA4 flox / +, Vil1-Cre; ②GATA4 flox / +; ③Vil1-Cre and ④ wild-type mice.

[0049] (2) The F1 transgenic mice of step (1) with the genotype of GATA4 flox / +, Vil1-Cre are self-fertilized to obtain F2 mice.

[0050] The identification method and results of F2 generation mice are as follows:

[0051] (2.1) PCR identification

[0052] (a) PCR primer information

[0053] The primer sequences for genotyping GATA4 flox transgenic mice are as follows:

[0054] F: TAGAGTACCACAGACCAGAAAGC;

[0055] R:CACCTAACCTACTCAGACTCTTTTCTTC.

[0056] The primer sequences for identifying the genotype of Vil1-Cre transgenic mice are as follows:

[0057] F: CATATTGGCAGAACGAAAACGC;

[0058] R: CCTGTTTCACTATCCAGGTTACGG.

[0059] (b) Amplify the PCR product according to the following reaction system and reaction conditions:

[0060] Amplification reaction system 25 μL, including 9 μL ddH2O, 12.5 μL Premix Taq Polymerase, 1.5 μL DNA template and 1 μL each of primers;

[0061] Reaction conditions: pre-denaturation reaction at 94°C for 3 min, denaturation reaction at 94°C for 30 s, annealing reaction at 62°C for 35 s, extension reaction at 72°C for 35 s, and repeat the 3 steps of denaturation → annealing → extension for 35 cycles, and finally react at 72°C for 5 min for final DNA extension. After the extension, the PCR product is obtained and kept at 12°C.

[0062] (2.2) Agarose gel electrophoresis

[0063] The PCR amplification product obtained in step (2.1) was subjected to 1% agarose gel electrophoresis and the identification result was obtained by comparing it with the judgment criteria.

[0064] (a) Criteria:

[0065] I. GATA4 flox genotype determination indicators: There are 3 genotypes. The one with only about 282bp band is the GATA4 flox homozygous genotype (GATA4 flox / flox); the one with about 282bp band and 242bp band at the same time is the GATA4 flox heterozygous genotype (GATA4 flox / +); the one with only about 242bp band is the wild type.

[0066] II. Indicators for judging the results of Vil1-Cre gene knockout: the presence of a band of about 413 bp indicates the Vil1-Cre genotype, and the absence of a band indicates the wild type;

[0067] (b) Identification results:

[0068] There are 6 genotypes of F2 mice, namely: ①GATA4 flox / flox, Vil1-Cre (GATA4 intestine-specific knockout mice); ②GATA4 flox / flox (flox homozygous); ③GATA4 flox / + (flox heterozygous); ④GATA4 flox / +, Vil1-Cre; ⑤Vil1-Cre and ⑥wild-type mice.

[0069] After identification, the F2 generation GATA4 gene-specific homozygous knockout mice (GATA4 flox / flox, Vil1-Cre) were obtained, namely the GATA4 intestine-specific knockout mouse model.

[0070] 4. Establishment of an Animal Model of Alcoholic Liver Injury

[0071] The preparation of the alcoholic liver injury model of GATA4 intestinal specific knockout mice is as follows: After breeding a sufficient number of GATA4 intestinal specific knockout mice, we selected control mice (WT group, littermate negative control mice) of uniform age and weight and intestinal knockout GATA4 male mice (GATA4 flox / flox, Vil1-Cre). According to the feed instructions, normal control liquid feed and alcohol-containing Lieber-DeCarli liquid feed were weighed and prepared. After 1 week of adaptive feeding with normal control liquid feed, paired feeding was used to prepare the alcoholic liver injury model after 7 weeks of liquid feed feeding. After preparation, the samples were dissected and the relevant experimental indicators were detected.

[0072] The biochemical indices of the two alcoholic liver injury animal models were compared, and the comparison results are shown in Table 1.

[0073] Table 1 Comparison of biochemical indicators of two animal models of alcoholic liver injury

[0074] Intestinal knockout of GATA4 in male mice Control mice Serum alanine aminotransferase ALT level 845.1±130.7(U / L) 96.65±6.84(U / L) Serum aspartate aminotransferase AST 864.2±103.9(U / L) 316.8±42.37(U / L) Liver tissue fatty degeneration and inflammation score 6 points 3 points

[0075] Scoring criteria for fatty degeneration and inflammation of liver tissue (final score = fatty degeneration score + hepatocyte ballooning degeneration score + inflammation score):

[0076] 1. Steatosis: The score is 0 to 3 points, divided into no steatosis (0 points), mild (<33% hepatocytes, 1 point), moderate (33-66% hepatocytes, 2 points) and severe (>66% hepatocytes, 3 points).

[0077] 2. Ballooning degeneration of hepatocytes: The score is 0 to 2 points, divided into no ballooning degeneration (0 points), mild (1 point) and significant (2 points).

[0078] 3. Inflammation: The score ranges from 0 to 3 points, including no inflammation (0 points), mild (inflammatory cell infiltration in a single lobule, 1 point), moderate (inflammation in the lobule and portal area, 2 points), and severe (extensive inflammation in the lobule and portal area, 3 points).

[0079] 4. Total score: 0-8 points, which comprehensively evaluates the activity and severity of alcoholic liver disease in mice by scoring fatty degeneration, hepatocyte ballooning degeneration and inflammation (the higher the final score, the more severe the fatty degeneration and inflammation of the liver tissue).

[0080] As shown in Table 1, the alcoholic liver injury animal model provided by this protocol is more severe in terms of liver damage phenotypes such as transaminase, liver steatosis and inflammation compared to the alcoholic liver injury model constructed by the traditional Lieber-DeCarli liquid alcohol feed.

[0081] Embodiment 2:

[0082] 1. Experimental animals: The present invention uses C57BL / 6 mice, all of which are male mice of 7 to 8 weeks old. All experimental animals were raised in the Experimental Animal Center of Zhejiang Chinese Medical University, with room temperature maintained at 18 to 22°C, humidity maintained at 50 to 70%, 12h light / 12h dark alternating lighting, and free access to water and food. Animal breeding, maintenance and experimental treatment were carried out in accordance with the guidelines of the Ethics Committee of Zhejiang Chinese Medical University.

[0083] Second, intraperitoneal injection, as a technology for regulating gene expression at the animal level, has been widely used in liver research and other fields. In order to further explore the function of GATA4 in alcohol-induced liver injury, we used intraperitoneal injection of mouse OE-GATA4-AAV9 virus to achieve overexpression of GATA4 in the intestine.

[0084] 3. Method for constructing GATA4 gene into GPAAV-CMV-MCS-WPRE vector: First, design and synthesize GATA4 primers, amplify the target fragment, and then connect it to the vector after enzyme digestion. The ligation product is transferred into the prepared bacterial competent cells, and the grown monoclonal colonies are sent to the sequencing company for sequencing. The correct clone is the successfully constructed vector. Then, the adeno-associated virus vector and its auxiliary packaging element vector plasmid with high purity and no endotoxin are extracted, and the constructed virus vector and its auxiliary packaging element plasmid are co-transfected into AAV Pro-293T cells using HG transgenereagent. After transfection for 6 to 8 hours, fresh culture medium is replaced with Enhancing buffer. After continuing to culture for 72 hours, the cells and supernatant rich in virus particles are collected after the cells fall off, and the high-titer virus concentrate is obtained after concentration and purification. The primer sequences of AAV-GATA4 constructed in this experiment are: 46671FW-60046: CGCGAATTCGAAGTAACCTCGAGGCCACCATGTACCAAAGCCTGGCCATGG; 46671RW-60047: GACTGTGTCTGACTGTGTCGGATCCTTACGCGGTGATTATGTCCCCA.

[0085] Preparation of intestinal GATA4 overexpression mouse model by intraperitoneal injection of OE-GATA4-AAV9: Select experimental mice of uniform age and weight (25-30 g) and place them in a 2x10 11vg virus volume, diluted according to the injection volume of 0.1mL saline. Grasp the mouse, expose the abdomen, tilt the animal with the abdomen facing up and the head down, and insert the injection needle into the subcutaneous tissue 3 to 5mm at the 1 / 3-1 / 4 position of the lower abdomen, about 5mm away from the midline, and then insert the needle into the peritoneum at a 45° angle toward the head. After entering the abdominal cavity, there is no resistance, pull back the needle plug, and inject the virus injection solution if there is no blood, urine or intestinal contents flowing in. In order to prevent leakage, slightly rotate the needle, then slowly pull it out, and disinfect the injection site with an alcohol cotton ball.

[0086] 5. The preparation of the alcoholic liver injury model in mice overexpressing GATA4 is as follows: OE-GATA4-AAV9 was injected into C57BL / 6 mice by intraperitoneal injection. After 3 weeks, the intestinal GATA4 protein expression was identified. The increased GATA4 expression represented the successful construction of intestinal overexpression GATA4 mice. Intestinal overexpression GATA4 mice and WT mice of the same age were selected for subsequent alcoholic liver injury model construction. Normal control liquid feed and Lieber-DeCarli liquid feed containing alcohol were weighed according to the feed instructions. After 1 week of adaptive feeding with normal control liquid feed, Lieber-DeCarli alcohol liquid feed was given, and the alcoholic liver injury model was prepared after 7 weeks of liquid feed feeding.

[0087] VI. Reagents: The alcohol liquid feed used in the present invention was purchased from Nantong Trofi Feed Technology Co., Ltd., the HE dye kit was purchased from Wuhan Saiweier Company, the Filipin staining kit was purchased from Shanghai Biyuntian Company, and the CXCL5 and IL-33 ELISA detection kits were purchased from Hangzhou Lianke Biotechnology Co., Ltd. OE-GATA4-AAV9 adeno-associated virus was purchased from Shanghai Yuan Biotechnology Co., Ltd. GATA4, ASBT, FGFR4 and CYP7A1 antibodies (rabbit) were purchased from ABCAM, AFFNINTY, ABCLONE Co., Ltd., and GAPDH antibody (rabbit) was purchased from Wuhan Sanying Biotechnology Co., Ltd.

[0088] Experimental methods:

[0089] The GATA4 intestinal specific knockout mice obtained in Example 1, the intestinal overexpression GATA4 mice obtained by intraperitoneal injection of OE-GATA4-AAV9, and the negative control mice of the same litter were selected, and the normal control liquid feed and the alcohol-containing Lieber-DeCarli liquid feed were weighed according to the feed instructions. After 1 week of adaptive feeding, the paired-feeding method was adopted, and the control group was given a liquid feed without alcohol and the same calories, and the alcohol group was fed with 5% Lieber-DeCarli alcohol liquid feed. After 7 weeks of feeding, after the last feeding, fasting but not water was allowed for 12 hours. After the preparation was completed, the samples were dissected and the various indicators of the mice were detected.

[0090] The detection methods for various indicators of mice are as follows:

[0091] (1) Determination of biochemical indicators:

[0092] The levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum of the above mice were detected using a biochemical detector. Figure 1 shown.

[0093] (2) HE staining analysis:

[0094] (a) The mouse liver tissue obtained after dissection was immersed in 4% neutral formaldehyde solution for fixation overnight, and then the tissue was dehydrated using a fully automatic tissue dehydrator, and paraffin was heated to enable the tissue to be embedded. After complete embedding, the paraffin block was frozen at -20°C and serially sliced ​​using a paraffin slicer;

[0095] (b) baking the slices obtained in step (a) at 65° C. for 15 min, and then performing a conventional dewaxing procedure;

[0096] (c) immersing the tissue sections subjected to conventional dewaxing procedures in step (b) in hematoxylin for staining for 3 minutes, observing the nuclear staining under a microscope, and then rinsing with tap water for 2 minutes;

[0097] (d) The tissue sections washed in step (c) were differentiated with 1% hydrochloric acid alcohol for several seconds, and then rinsed with tap water for 2 minutes after differentiation;

[0098] (e) staining the material washed in step (d) with eosin for 3 minutes, and then rinsing with tap water for 2 minutes after staining;

[0099] (f) subjecting the rinsed material in step (e) to gradient alcohol dehydration treatment, and then using xylene to clear for 3 minutes, and clearing three times in succession;

[0100] (g) sealing the transparent material obtained in step (f) with a neutral resin and drying the piece in a fume hood;

[0101] (h) photographing the dried film obtained in step (g) using a conventional upright optical microscope.

[0102] (3) Filipin staining to observe cholesterol content in liver tissue:

[0103] (a) Preparation of staining solution: Preparation of mother solution: Add 1 mg of philipid powder into 1 mL of DMSO (dimethyl sulfoxide) and completely dissolve to prepare a 1 mg / mL stock solution, and freeze it in aliquots to avoid repeated freezing and thawing, and store it away from light; Preparation of working solution: Before use, take an appropriate amount of mother solution and add it to PBS (phosphate buffered saline), dilute it into a certain concentration of working solution (such as 0.1 mg / mL) for use;

[0104] (b) washing the fixed liver tissue with PBS buffer for 2 to 3 times, each time for 5 minutes, and then immersing the sample in the working solution of step (a) and incubating at room temperature in the dark for 30 to 60 minutes;

[0105] (c) After staining, wash with PBS 2 to 3 times, each wash for 5 min;

[0106] (d) The fluorescence signal of cholesterol stained with Filipin was observed under a fluorescence microscope using 360nm ultraviolet excitation light. Free cholesterol stained with Filipin usually appears as blue fluorescence at 480nm.

[0107] (4) QAH-TH-1 chip detects inflammatory factors in liver tissue:

[0108] (a) Tissue homogenization: Weigh the mouse liver tissue and transfer it into a micro manual glass homogenizer and homogenize it in ice water for 5 minutes. Add 1×PBS buffer at a mass volume ratio of 1 / 8 to wash the homogenized tissue and transfer it to a 1.5 ml EP tube. After diluting it by half, place it in a low-temperature high-speed centrifuge and centrifuge it at 1000×g for 10 minutes at 4°C. After centrifugation, extract the supernatant and transfer it to another 1.5 ml EP tube; and centrifuge it in a low-temperature high-speed centrifuge at 25000r / min at 4°C for 20 minutes, and take the supernatant for the determination of CXCL5 and IL-33 concentrations;

[0109] (b) Take the glass slide out of the box, equilibrate at room temperature for 20 to 30 minutes, open the packaging bag, remove the sealing strip, and then place the slide in a vacuum desiccator or dry it at room temperature for 1 hour;

[0110] (c) Preparation of BSA standard solution: prepare BSA protein standard solution with a concentration gradient of 2000 μg / mL, 1500 μg / mL, 1000 μg / mL, 750 μg / mL, 500 μg / mL, 250 μg / mL, 125 μg / mL, 25 μg / mL, and 0 μg / mL;

[0111] (d) Chip operation:

[0112] 1. Add 100 μL of liver homogenate dilution to each well, incubate on a shaker at room temperature for 1 hour, and block the quantitative antibody chip.

[0113] 2. Drain the buffer in each well, add 100 μL of standard solution and sample to the well, and incubate overnight at 4°C on a shaker.

[0114] 3. Washing: Wash the slides using the Thermo Sciemific Wellwash Versa chip washer in two steps. First, wash with 1× Wash Solution I, 250 μL of 1× Wash Solution I per well, wash 10 times, and shake for 10 seconds each time. Then switch to 1× Wash Solution II for washing, 250 μL of 1× Wash Solution II per well, wash 6 times, and shake for 10 seconds each time.

[0115] 4. Incubation of the detection antibody mixture: Centrifuge the detection antibody mixture tube, then add 1.4 mL of sample diluent, mix well and centrifuge quickly again. Add 80 μL of CXCL5 and IL-33 antibodies to each well and incubate on a shaker at room temperature for 2 hours.

[0116] 5. Washing: Wash the slides using the Thermo Scientific Wellwash Versa chip washer in two steps. First, wash with 1× Wash Solution I, 250 μL of 1× Wash Solution I per well, wash 10 times, and shake for 10 seconds each time. Then switch to 1× Wash Solution II for washing, 250 μL of 1× Wash Solution II per well, wash 6 times, and shake for 10 seconds each time.

[0117] 6. Cy3-streptavidin incubation: Centrifuge the Cy3-streptavidin tube, then add 1.4 mL of sample diluent, mix well and centrifuge quickly again. Add 80 μl of Cy3-streptavidin to each well, cover the slide with aluminum foil and incubate in dark, incubate on a shaker at room temperature for 1 hour.

[0118] 7. Washing: Wash the slides using the Thermo Scientific Wellwash Versa chip washer in two steps. First, wash with 1× Wash Solution I, 250 μL of 1× Wash Solution I per well, wash 10 times, and shake for 10 seconds each time. Then switch to 1× Wash Solution II for washing, 250 μL of 1× Wash Solution II per well, wash 6 times, and shake for 10 seconds each time.

[0119] 8. Fluorescence detection: Remove the slide frame, being careful not to touch the side of the slide printed with antibodies. Use a laser scanner such as InnoScan 300 to scan the signal, using Cy3 or green channel (excitation frequency = 532nm).

[0120] 9. Use QAH-TH-1 data analysis software to perform data analysis.

[0121] (5) RNA-seq of intestinal tissue

[0122] RNA-Seq is the science of studying the overall expression of all transcripts (mainly mRNA) in cells or tissues at a specific time or under specific conditions. The main goal of RNA-Seq is to reveal the expression patterns and regulatory mechanisms of genes under different conditions, thereby helping us understand the functions of genes under different physiological and pathological states. To further explore the role of intestinal-specific GATA4 knockout in alcohol-induced liver damage, we performed RNA-Seq analysis on the ileum of each group of mice. The specific analysis steps are as follows:

[0123] (a) Preparation of tissue samples: The ileum stored at -80°C was taken out, the intestinal contents were removed, and the intestinal tissue samples were washed with pre-cooled HBSS (Hanks balanced salt solution);

[0124] (b) Total RNA extraction: Intestinal tissue samples were homogenized in an appropriate amount of TRIzol lysis buffer. The homogenate was treated with chloroform to separate RNA from protein and DNA. Isopropanol was added to precipitate RNA and collected by centrifugation. The RNA precipitate was washed with 75% ethanol and then dried. The dried RNA was dissolved in RNase-free water. The RNA purity and quantification were identified using a NanoDrop 2000 spectrophotometer (ThermoScientific, USA);

[0125] (c) RNA quality control and library construction: RNA integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). The transcriptome library was constructed using the VAHTSUniversal V5 RNA-seq Library Prep Kit according to the instructions;

[0126] (d) Library quality control and sequencing: Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) was used to detect the quality and concentration of the library to ensure uniform fragment distribution. Sequencing was performed using the Illumina Novaseq6000 sequencing platform to generate 150 bp double-end reads. Fastp software was used to process the rawreads in fastq format, and cleanreads were obtained after removing low-quality reads for subsequent data analysis;

[0127] (e) Data analysis: HISAT2 software was used for reference genome alignment and gene expression calculation, and gene read counts were obtained by HTSeq-count. Differentially expressed genes were analyzed using DESeq2 software, and genes that met the thresholds of p < 0.05 and |Log2 (fold change) > 1| were defined as differentially expressed genes (DEGs). Transcriptome sequencing and analysis were performed by Shanghai Ouyi Biotechnology Co., Ltd.

[0128] (6) Western Blot method to detect the expression of FGFR4 and CYP7A1 in liver tissue

[0129] (a) Prepare 10% PAGE gel: Prepare gel according to the operating procedures of the Yazyme PAGE Gel Rapid Preparation Kit. Take 4 gels as an example. After the kit is rewarmed at room temperature, absorb 16 mL of the lower gel solution and lower gel buffer for each gel, and then add 320 μL of coagulant. After fully mixing, quickly add it to the fixed gel plate, and gently add anhydrous ethanol to seal the gel. Let it stand for 15 to 20 minutes. After the lower layer separation gel is fully solidified, fully absorb the anhydrous ethanol. Prepare the lower gel again, and absorb 6 mL of the lower gel solution and lower gel buffer for each gel. Add 120 μL of coagulant to the lower gel solution and lower gel buffer, mix it thoroughly, immediately add it to the gel plate, and quickly and slowly insert the corresponding tooth comb, let it stand at room temperature for 20 to 30 minutes for use;

[0130] (b) Electrophoresis: Add 1000 mL of the prepared electrophoresis solution to the stationary fixed gel plate in step (a), then remove the comb, add an equal amount of protein sample, add a protein maker and set the electrophoresis conditions: upper layer compression gel (constant voltage 70 V) and lower layer separation gel (constant current 320 mA). When the band moves to the appropriate position, terminate the electrophoresis;

[0131] (c) Transfer: Carefully remove the gel and soak it in transfer solution, then soak and activate the PVDF membrane with methanol, and transfer it using a wet transfer instrument: place filter paper, gel and PVDF membrane layer by layer in the order of black gel and white membrane, remove bubbles with the filter paper, and transfer the membrane at a constant current of 320 mA for 60 min;

[0132] (d) Blocking: The PVDF membrane obtained in step (c) was placed in a blocking solution and blocked at room temperature for 60 min;

[0133] (e) Incubate with primary antibody and secondary antibody separately: After blocking, add primary antibody to the blocking solution and incubate overnight at 4°C. On the next day, wash three times with 1x TBST buffer, 5 min each time. Add secondary antibody, incubate at room temperature for 60 min, and wash four times with 1x TBST buffer, 5 min each time;

[0134] (f) Protein development: Prepare chemiluminescent solution and develop the PVDF membrane using the Bio-Rad Protein Gel Imaging System.

[0135] (7) Immunofluorescence detection of GATA4 and ASBT expression in intestinal tissue

[0136] (a) Tissue fixation: Mouse intestinal tissue was fixed with 4% paraformaldehyde (PFA) solution at room temperature for 24 h to maintain the stability of tissue structure and antigens. After fixation, the tissue was thoroughly washed with PBS buffer (pH 7.4) to remove residual fixative.

[0137] (b) Dehydration and embedding: The fixed tissue is dehydrated in a gradient concentration of sucrose solution, with each level treated for 1 to 2 hours until the tissue sinks. After dehydration, the tissue is embedded in OCT (Optimal Cutting Temperature) compound, quickly frozen in liquid nitrogen or dry ice, and stored frozen.

[0138] (c) Sectioning: Use a freezing microtome to cut the frozen tissue in step (b) into 5-10 μm thick sections, place them on a glass slide, and store them frozen at -80°C.

[0139] (d) Drying and fixing of sections: Dry the sections at room temperature for 10-15 min. Fix them with -20°C cold methanol for 10 min to preserve cell morphology; then rinse with PBS three times, 5 min each time.

[0140] (e) Blocking: Add an appropriate amount of 10% normal goat serum to the slices obtained in step (d) for blocking, incubate at room temperature for 30 minutes to block non-specific binding, and wash with PBS for 3 times, 5 minutes each time.

[0141] (f) Primary antibody incubation: Add appropriately diluted primary antibody solution to the slice tissue obtained in step (e) and incubate overnight at 4° C. After incubation, wash with PBS three times, 5 minutes each time.

[0142] (g) Secondary antibody incubation: Add the diluted fluorescently labeled secondary antibody to the slices obtained in step (f) and incubate at room temperature in the dark for 1 hour. After the secondary antibody incubation is completed, rinse again with PBS 3 times, 5 minutes each time, to prevent nonspecific fluorescent background.

[0143] (h) DAPI nuclear staining: Use diluted DAPI solution (1 μg / mL) to incubate for 5 min in dark conditions to stain the cell nuclei. Rinse the sections with PBS 2 to 3 times, 5 min each time.

[0144] (i) Sealing and observation: Add anti-fluorescence quenching sealing solution to the slices. Gently cover with a coverslip to avoid bubbles and fix the coverslip with light pressure. After sealing, store at 4°C away from light and observe under a fluorescence microscope.

[0145] Test results such as Figure 1 As shown, Figure 1 A and C in the middle show the changes in ALT and AST levels in the serum of GATA4 intestinal-specific knockout mice and the same littermate negative control mice (WT) after normal diet and alcohol liquid feed, respectively; B and D show the changes in ALT and AST levels in the serum of intestinal overexpressing GATA4 mice (AAV-GATA4) injected intraperitoneally with OE-GATA4-AAV9 and the same littermate negative control mice (WT) after normal diet and alcohol liquid feed, respectively; E shows the pathological changes in liver HE of the same littermate negative control mice, GATA4 intestinal-specific knockout mice, and intestinal overexpressing GATA4 mice fed with normal diet or alcohol diet, respectively.

[0146] We found that the levels of ALT and AST in the blood of GATA4 intestinal-specific knockout mice (not given alcohol liquid feed) had increased significantly ( Figure 1 A, C), HE staining of the liver showed some liver tissue damage ( Figure 1 Middle E). Alcohol liquid diet treatment exacerbated liver steatosis and inflammation in GATA4 intestinal-specific knockout mice, as shown by a significant increase in the levels of transaminases ALT and AST in mice ( Figure 1 A, C); The lipid droplet vacuolar area in the liver tissue of GATA4 intestinal-specific knockout mice increased significantly, and the neutrophil infiltration increased significantly ( Figure 1 The above results confirmed that intestinal-specific knockout of GATA4 significantly aggravated alcohol-induced liver damage. In addition, mice with intestinal overexpression of GATA4 significantly reversed alcohol-induced liver dysfunction in mice ( Figure 1 In B, D), pathological results showed that intestinal overexpression of GATA4 could significantly alleviate alcohol-induced liver steatosis and inflammation ( Figure 1 Middle E).

[0147] Figure 2 The results of the QAH-TH-1 chip detecting the expression levels of inflammatory cytokines CXCL5 and IL-33 in liver tissue (Normal represents control mice fed normal liquid feed, EtOH represents control mice fed alcohol feed, GATA4-CKO represents GATA4 intestinal-specific knockout mice fed normal liquid feed, GATA4-CKO+EtOH represents GATA4 intestinal-specific knockout mice fed alcohol feed, and OE GATA4+EtOH represents intestinal overexpression GATA4 mice fed alcohol feed). Figure 2It can be seen that chronic alcohol intake will lead to a significant increase in the levels of inflammatory factors CXCL5 and IL-33 in mice. After intestine-specific knockout of GATA4, the levels of inflammatory factors CXCL5 and IL-33 in mice will further increase, while intestinal overexpression of GATA4 can significantly reduce the levels of CXCL5 and IL-33 inflammatory factors.

[0148] Depend on Figure 3 As shown in the volcano plot, under the condition of p<0.05&|LogFoldChange>0.58|, the EtOH group and the WT group obtained differentially expressed genes ( Figure 3 Middle A), differentially expressed genes were obtained between the GATA4-CKO+EtOH group and the GATA4-CKO group ( Figure 3 (B) Figure 3 As shown in Figures A and B, chronic alcohol stimulation can induce abnormal changes in the GATA4 / ASBT / FGF15 signaling pathway in the intestine of WT mice.

[0149] In GATA4 intestinal-specific knockout mice, the GATA4 / ASBT / FGF15 signaling pathway in the ileum was abnormal, and chronic alcohol stimulation further exacerbated the disorder of this signaling axis ( Figure 3 The immunofluorescence staining results were consistent with the RNA-Seq data, indicating that chronic alcohol stimulation can lead to abnormalities in the intestinal GATA4 / ASBT signaling pathway in WT mice, and in GATA4 intestinal-specific knockout mice, abnormalities in the ileum GATA4 / ASBT signaling pathway were further aggravated by chronic alcohol stimulation ( Figure 3 (middle D). Figure 3 In the table, WT represents control mice fed a normal liquid diet, EtOH represents control mice fed an alcohol diet, GATA4CKO represents GATA4 intestinal-specific knockout mice fed a normal liquid diet, and GATA4CKO+EtOH represents GATA4 intestinal-specific knockout mice fed an alcohol diet.

[0150] Therefore, the above results indicate that intestinal-specific knockout of GATA4 significantly aggravated the alcohol-induced disorder of intestinal experimental bile acid metabolism gene expression.

[0151] To further explore its molecular mechanism, we used Western blot technology to detect the expression levels of FGFR4 and CYP7A1, key proteins in the liver that are closely related to bile acid and cholesterol metabolism. Figure 4 It can be seen that the results of cholesterol Filipin staining of mouse liver tissue showed that long-term alcohol intake can induce elevated cholesterol levels in mouse liver. In GATA4 intestinal-specific knockout mice, this phenomenon of liver cholesterol accumulation caused by chronic alcohol stimulation was more serious ( Figure 4(A). The results showed that long-term alcohol exposure led to a significant decrease in the expression of FGFR4 and CYP7A1 in the mouse liver. This downward trend was more obvious in GATA4 intestinal-specific knockout mice. This may be related to GATA4 inhibiting ASBT, which increases ASBT expression after knockout, increases intestinal bile acid reabsorption, and negative feedback inhibition of CYP7A1, resulting in the blockage of the pathway for cholesterol metabolism into bile acid, which aggravates cholesterol accumulation and inflammation in hepatocytes ( Figure 4 Chinese BC).

[0152] In summary, we first achieved specific knockout of the GATA4 gene in the mouse intestine through the Cre-LoxP system, and obtained a sufficient number of GATA4 intestinal specific knockout mice through identification. Subsequently, by intraperitoneal injection (injection of AAV adeno-associated virus packaged with mouse GATA4 overexpression plasmid), intestinal GATA4 overexpression mice were obtained by detecting intestinal GATA4 protein expression. According to the preparation method of the Liber-Decarli alcoholic liver injury model, after one week of adaptive feeding, the control group mice were given liquid feed without alcohol and the same calories, and the GATA4 intestinal specific knockout mice, intestinal overexpression GATA4 mice and the negative control mice in the same litter were all given liquid feed containing 5% alcohol. After feeding for 7 weeks, the last feeding was fasted for 12 hours before sampling and analysis. The above results show that chronic alcohol intake can lead to abnormal liver function, hepatic steatosis and cholesterol deposition in mice, as well as aggravated inflammatory response, and cause disordered expression of bile acid metabolism genes in the liver and intestine. It is worth noting that this damage trend in GATA4 intestinal-specific knockout mice significantly exacerbates the above-mentioned alcoholic liver damage phenomenon, while the liver function abnormalities and liver pathological damage in GATA4 intestinal overexpression mice are significantly improved. On the one hand, the above study provides an ALD animal model with more severe liver damage phenotypes such as transaminase, liver steatosis and inflammation compared to the traditional Liber-Decarli alcoholic liver injury model. On the other hand, the above study fully demonstrates that GATA4 can be used as an effective target for the prevention or treatment of ALD, and has important guiding significance in the development of drugs for the prevention and treatment of such diseases.

Claims

1. A method for constructing an animal model of alcoholic liver disease with intestinal-specific knockout of GATA4 gene, characterized in that: The construction method is as follows: GATA flox transgenic heterozygous mice and Vill-Cre transgenic mice are hybridized to obtain the F1 generation, and the transgenic mice of the F1 generation with the genotype of GATA4 flox / +, Vill-Cre are screened and self-pollinated to obtain the F2 generation mice, 1 mm of the mouse tail is cut off, 250 μL of lysis solution is added for digestion, the mouse genomic DNA is extracted, primers are designed, and the mouse genotype is identified using the polymerase chain reaction, i.e., PCR amplification reaction system, and the GATA4 intestinal-specific knockout mice with the genotype of GATA4 flox / flox, Vill-Cre are screened; the GATA4 intestinal-specific knockout mice are then given the Lieber-DeCarli liquid alcohol feed, and after 7 weeks, the GATA4 intestinal-specific knockout mouse model of alcoholic liver injury is obtained.

2. The method for constructing an alcoholic liver disease animal model with intestinal-specific knockout of GATA4 gene according to claim 1, characterized in that: The PCR amplification reaction system is 25 μL, including 9 μL of ddH2O, 12.5 μL of Premix Taq Polymerase, 1.5 μL of DNA template, and 1 μL of each primer; the reaction conditions are: pre-denaturation reaction at 94°C for 3 minutes, denaturation reaction at 94°C for 30 seconds, annealing reaction at 62°C for 35 seconds, and extension reaction at 72°C for 35 seconds, and the three steps of denaturation→annealing→extension are repeated for 35 cycles, and finally the DNA is finally extended at 72°C for 5 minutes, and maintained at 12°C after the extension is completed; PCR products are detected by 1% agarose gel electrophoresis, and the genotype of mice is analyzed to screen GATA4 intestinal-specific knockout mice.

3. An animal model of alcoholic liver disease with intestinal-specific knockout of GATA4 gene, characterized by: The method for constructing an alcoholic liver disease animal model with intestinal-specific knockout of the GATA4 gene according to any one of claims 1 to 2 is obtained.

4. The use of an alcoholic liver disease animal model with intestinal-specific knockout of GATA4 gene according to claim 3, characterized in that: Used to study the impact of intestinal GATA4 gene on alcoholic liver disease.

5. Use of GATA4 gene as a target in a drug for preventing or treating alcoholic liver disease, characterized in that: The GATA4 gene is used as a drug target for preventing or treating alcoholic liver disease.

6. The use of the GATA4 gene as a target in a drug for preventing or treating alcoholic liver disease according to claim 5, characterized in that: The GATA4 gene is used in the preparation of a drug for alleviating liver dysfunction caused by alcohol.

7. The use of the GATA4 gene as a target in a drug for preventing or treating alcoholic liver disease according to claim 5, characterized in that: The GATA4 gene is used in the preparation of a drug for improving liver inflammation and fatty changes caused by alcohol.

8. The use of the GATA4 gene as a target in a drug for preventing or treating alcoholic liver disease according to claim 5, characterized in that: The GATA4 gene is used in the preparation of a drug for improving intestinal hepatic bile acid and cholesterol metabolism disorders caused by alcohol.

Images