Real-time fluorescent PCR (polymerase chain reaction) detection method for detecting and identifying nontuberculous mycobacteria

Abstract

The invention provides a real-time fluorescent PCR (polymerase chain reaction) detection method aiming at nontuberculous mycobacterium detection and identification, and relates to the technical field of biological detection, the method comprises the following operation steps: S1, extracting DNA (deoxyribonucleic acid) of a to-be-detected sample; S2, carrying out first PCR amplification: designing primers: designing primers Mp1 and Mp2 by using a 16S rRNA gene 3'end and a 23S rRNA gene 5 'end of mycobacterium; taking the extracted DNA of the sample to be detected as a template, and carrying out primary PCR amplification by using primers Mp1 and Mp2; s3, carrying out real-time fluorescent PCR detection and identification on the nontuberculous mycobacterium species by taking a first PCR amplification product as a real-time fluorescent PCR template; a plurality of groups of specific detection primers and probes are designed and are used for detecting and identifying the nontuberculous mycobacteria; and carrying out real-time fluorescent PCR detection and second detection and identification by using the specific detection primer and the probe. Real-time fluorescent PCR detection and identification are carried out by using the specific detection primer and the probe, the detection sensitivity is improved while the specificity of the nontuberculous mycobacterium species is maintained, and the kit is suitable for blood specimen detection and is also suitable for other clinical specimens such as sputum specimens, culture isolates and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of biological detection, and in particular to a real-time fluorescence PCR detection method for detecting and identifying non-tuberculous mycobacteria. Background Art

[0002] Mycobacterium includes Mycobacterium tuberculosis and dozens of other mycobacteria (collectively referred to as non-tuberculous mycobacteria). The mycobacteria associated with human diseases are mainly Mycobacterium tuberculosis and more than a dozen non-tuberculous mycobacteria, such as Mycobacterium avium, Mycobacterium gordonii, etc.

[0003] Currently, there are three main types of clinical experimental diagnostic methods: smear acid-fast staining microscopy, mycobacterial culture and real-time fluorescence PCR. Among them, smear microscopy has the lowest sensitivity and specificity, bacterial culture has the second highest positive rate and is time-consuming (about 10-45 days), while real-time fluorescence PCR has the best sensitivity and specificity and is the fastest.

[0004] The current mainstream real-time fluorescent PCR detection method is represented by the GeneXpert detector in the United States. The sensitivity of this method is only about 40% positive rate, and it can only detect Mycobacterium tuberculosis, but not non-tuberculous mycobacteria. This is because the detection system is only designed with primers and probes for detecting Mycobacterium tuberculosis, and no corresponding detection and identification primers and probes for non-tuberculous mycobacteria are designed. Therefore, it cannot detect non-tuberculous mycobacteria, but can only detect Mycobacterium tuberculosis.

[0005] Compared with Mycobacterium tuberculosis, the pathogenicity / virulence of nontuberculous mycobacteria is much weaker, the clinical symptoms are not as typical as those after Mycobacterium tuberculosis infection, and the lesion sites are not as definite as those of Mycobacterium tuberculosis (mostly in the lungs). Therefore, when testing sputum specimens, the positive rate of Mycobacterium tuberculosis is less than 40%, and the detection rate of nontuberculous mycobacteria is even lower. When testing other specimens, such as blood specimens, the detection sensitivity is not reached (for example, Mycobacterium tuberculosis PCR detection of blood specimens is basically negative), so no company has yet developed a nontuberculous mycobacterium PCR detection kit. Summary of the invention

[0006] The object of the present invention is to provide a real-time fluorescence PCR detection method for detecting and identifying non-tuberculous mycobacteria for non-diagnostic purposes, so as to improve the detection and diagnosis rate of Mycobacterium tuberculosis and also detect the technical effect of non-tuberculous mycobacteria.

[0007] The present invention is implemented by the following technical solution: comprising the following steps:

[0008] S1: Extract DNA from the sample to be tested:

[0009] S2: First PCR amplification:

[0010] Primer design: Primers Mp1 and Mp2 were designed based on the 3' end of the 16S rRNA gene and the 5' end of the 23S rRNA gene of mycobacteria;

[0011] The extracted DNA of the sample to be tested was used as a template and primers Mp1 and Mp2 were used for the first PCR amplification;

[0012] S3: Real-time fluorescence PCR detection and identification of nontuberculous mycobacterial species

[0013] The first PCR amplification product was used as the real-time fluorescence PCR template;

[0014] Design multiple sets of specific detection primers and probes for the detection and identification of nontuberculous mycobacteria;

[0015] Real-time fluorescence PCR detection and identification are performed using specific detection primers and probes to maintain the specificity of real-time fluorescence PCR and enhance the detection sensitivity. In order to better implement the present invention, further,

[0016] The gene sequences of the primers Mp1 and Mp2 are as follows:

[0017] Mp1:GAAGGTGGGATCGGCGATTG;

[0018] Mp2:GCAGCCTCCAACGTCCTTC.

[0019] In order to better realize the present invention, further,

[0020] The first PCR amplification, its reaction system:

[0021] 15 μl PCR mix, 1 μl each of primers Mp1 and Mp2, H 2 O 8μl, template 5μl,

[0022] PCR amplification procedure:

[0023] Pre-denaturation at 94°C for 5 min; 40 cycles at 94°C for 30 s; maintain at 57°C for 15 s, maintain at 72°C for 30 s, and finally maintain at 72°C for 5 min.

[0024] In order to better realize the present invention, further,

[0025] The second PCR amplification, its reaction system:

[0026] 6μl real-time fluorescence PCR mix, 1μl primers, 1μl probe, 1μl PCR template, HPLC 2 O 3 μl, total 12 μl;

[0027] Maintain at 50°C for 2 min, 95°C for 10 min, then do 40 cycles of: maintain at 95°C for 15 s, then reduce to 60°C for 1 min.

[0028] In order to better realize the present invention, further,

[0029] The specific detection primers and probes are as follows:

[0030] The primer gene sequences for the specific detection of Mycobacterium abscessus are as follows:

[0031] F:CTAGGGAACATAAAGTAGGGT

[0032] R:CGTTTCAATTCTTATGACAGAG

[0033] The probe gene sequences for specific detection are as follows:

[0034] TATCTACTTTGAATATGTTTTGTA;

[0035] The primer gene sequences for specific detection of Mycobacterium aichiensis are as follows:

[0036] F:AGGCCCGTGCCCGGGGAA

[0037] R:AAAGGAAGCCGGCGCCTGT

[0038] The probe gene sequences for specific detection are as follows:

[0039] TCGGTGTGGTTGCTCCATCTTTG;

[0040] The primer gene sequences for specific detection of Mycobacterium asiatica are as follows:

[0041] F:ATGGAGGGACAGTACACTTC

[0042] R:GGATGCAGGTACCGTGTG;

[0043] The probe gene sequences for specific detection are as follows:

[0044] TAGCGCCCGTGTTGTCTCAGGACCCAA

[0045] The primer gene sequences for the specific detection of Mycobacterium chelonae are as follows:

[0046] F:TTCCCAGCTGCGAATGAGCT

[0047] R:GCGTTTCAATTCTCAATTGACAG

[0048] The probe gene sequences for specific detection are as follows:

[0049] AAGCGAGTCTGTAGTGGTTACTCGCT

[0050] The primer gene sequences for the specific detection of Mycobacterium acetylsalicylicum are as follows:

[0051] F:GAGCCGTGAGTTGAACCGG

[0052] R:CCTGTTGTATCTCAAAGCCCA

[0053] The probe gene sequences for specific detection are as follows:

[0054] CCTGTAGTGCACGGTTTGGTGCAC

[0055] The primer gene sequences for specific detection of gastric mycobacterium are as follows:

[0056] F:TAAGCCGTGAGCCGGGCT

[0057] R:ACGAGTCCAACCGACAAGC

[0058] The probe gene sequences for specific detection are as follows:

[0059] CGGGGGCCGTGCGCAACAGCAAGCA

[0060] The primer gene sequence for specific detection of Mycobacterium flavum is as follows: F:GGCTTTGAGACACTACAGGC

[0061] R:AGCCTGTGCAAGCCATCTTT

[0062] The probe gene sequences for specific detection are as follows:

[0063] CTCCGCGTTCGGGGTCGGTGTGT

[0064] The primer gene sequence for specific detection of Mycobacterium malmoe is as follows: F:AACACTGCCGGCCAGTCC

[0065] R:ATTACACAAAACGGTAATACGC

[0066] The probe gene sequences for specific detection are as follows:

[0067] CTACGGGCAGCATCCGTTTAGATG

[0068] The primer gene sequence for the specific detection of non-chromogenic mycobacteria is as follows: F:TAGTGTGGGTTGTCCGGTGG

[0069] R:AAGCCGGCACCACCAGAAGT

[0070] The probe gene sequences for specific detection are as follows:

[0071] AACTCCTGGCTTGATGATTTCGA

[0072] The primer gene sequences for the specific detection of Mycobacterium phlei are as follows:

[0073] F:TGGGAGAGCGTCGCCGGC

[0074] R:ACGGGCCAGTGTTGTCTCAA

[0075] The probe gene sequences for specific detection are as follows:

[0076] TGTCCGGTGGGCACAACAAAC

[0077] The primer gene sequence for specific detection of Mycobacterium scrofulae is as follows: F:CTTAAACACACTTACTTACAC

[0078] R:AGTGGTGTCTGCCTCCATCT

[0079] The probe gene sequences for specific detection are as follows:

[0080] AATTACACATTAACGAACACGC

[0081] The primer gene sequences for the specific detection of Mycobacterium simianum are as follows:

[0082] F:GACTTCGGTTGAAGTGGTGT

[0083] R:CACAAAACGAACGCACGTAAC

[0084] The probe gene sequences for specific detection are as follows:

[0085] CCGGCGACGTTCATTTAGATGCT

[0086] The primer gene sequence for specific detection of Mycobacterium smegmatis is as follows: F:TGAGGAGCTGGTGAGCGCT

[0087] R:CAGTCCATCGATTAACAGCG

[0088] The probe gene sequences for specific detection are as follows:

[0089] TGGCGCCGTTGGTGCACAGCA

[0090] The primer gene sequence for the specific detection of Mycobacterium surga is as follows: F:GATGCGAGCCGTGGTAGGG

[0091] R:AACAGCTCTGGCCCTAAGC

[0092] The probe gene sequences for specific detection are as follows:

[0093] CTCGTCTGTAGGACGAGGGCCGG

[0094] The primer gene sequence for specific detection of Mycobacterium tumefaciens is as follows: F:GAGGCAATGCAGGCCCGTT

[0095] R:CAGTAACCAAAAATCTGCTTGT

[0096] The probe gene sequences for specific detection are as follows:

[0097] TGTTGTTGTCCTCACACTTGGTGGT

[0098] The primer gene sequence for specific detection of thermotolerant mycobacteria is as follows: F:TGCCGTGTGGTGAGTCGGT

[0099] R:AATAGTGTCCGTCCGGTGAT

[0100] The probe gene sequences for specific detection are as follows:

[0101] TAGTGGCGCCCTGGGTGCGCAACAA

[0102] The primer gene sequence for the specific detection of minor mycobacteria is as follows: F:TCAAGTGGTATGTTGAGGGC

[0103] R:CAAAGCGTGGATTGCCTCAG

[0104] The probe gene sequences for specific detection are as follows:

[0105] AGCTTGCTGTGGGCTGCCAGGCACACT

[0106] The primer gene sequence for specific detection of Mycobacterium ulcerans is as follows: F:GGAGCACCACTCGAGAAACA

[0107] R:TGGGACCCAACATCCCGAAA

[0108] The probe gene sequences for specific detection are as follows:

[0109] ACAGAGATGTTCTCAGGACCCAATAGTGT

[0110] The primer gene sequence for the specific detection of Mycobacterium bovis is as follows: F: GCACATGCCACAAACTTGG

[0111] R:GACCCTGAGCCAACGCAG

[0112] The probe gene sequences for specific detection are as follows:

[0113] TAGGGAATGCCCGAGGGAAATCATCAG

[0114] The primer gene sequence for specific detection of Mycobacterium toadense is as follows: F:GCACCGTACGAACGCATCC

[0115] R:GTTACTGCAACTGCTGCCC

[0116] The probe gene sequences for specific detection are as follows:

[0117] ACCTCGGCCCGACCACAACACGCCGAAC

[0118] The gene sequences of the primers for the specific detection of Mycobacterium avium are as follows:

[0119] F:ATCTAGATGAGCGCATGGT

[0120] R:CACTTACTTACACACAAGAG

[0121] The specific detection probe gene sequence is as follows:

[0122] TGGCCGGCGTTCATCGAAATGTG

[0123] The gene sequences of the primers for the specific detection of Mycobacterium kansasii are as follows:

[0124] F:GAGCACCACGAAAAGCAT

[0125] R:TGTCTGGCTTTGCTTGTTG

[0126] The specific detection probe gene sequence is as follows:

[0127] AACAAGTGGGGTGCAAGCCG

[0128] The gene sequences of the primers for the specific detection of Mycobacterium gordonii are as follows:

[0129] F:ACACCCTCGGGTGCTG

[0130] R:AAATTGCACAAAAAGAACAC

[0131] The specific detection probe gene sequence is as follows:

[0132] AACGACAACGCATACATTTTGATG

[0133] The gene sequences of the primers for the specific detection of Mycobacterium intracellulare are as follows:

[0134] F:GTGTTTGAGTATTGGATAGTG

[0135] R:TTACTTACACACAAAAACCAA

[0136] The specific detection probe gene sequence is as follows:

[0137] CGAGCATCTAGATGAGCGCATAGT.

[0138] In order to better implement the present invention, further, the sample to be tested is a sputum sample or a blood sample.

[0139] The invention has the following beneficial effects: the invention designs a pair of PCR primers, namely Mp1 and Mp2, through the conserved regions of the 3' end of the 16S rRNA gene and the 5' end of the 23S rRNA gene of mycobacteria, for amplifying the internal transcribed spacer (ITS) sequence of the 16S-23S rRNA gene. The Mp1 and Mp2 primers designed in the conserved regions of the mycobacteria do not have species specificity, that is, each mycobacterium is the same, so the pair of primers can amplify the ITS of each mycobacterium. Through one-time amplification of the template, the detection positive rate of mycobacterium tuberculosis and non-tuberculosis mycobacteria can be simultaneously improved. If mycobacterium tuberculosis or non-mycobacteria is infected, detection and identification can be completed in one step, and the inspection method is simpler.

[0140] The present invention adopts a single template amplification and then performs real-time fluorescence detection, thereby greatly improving the detection sensitivity, so the detection positive rate of sputum specimens can be improved, and more importantly, blood specimens with extremely low pathogen DNA concentration can be detected.

[0141] The ITS sequences of different tuberculosis mycobacteria and various non-tuberculosis mycobacteria are used as target sequences to design corresponding primers and probes for real-time fluorescence PCR detection and identification of mycobacteria. The differences are used for detection and identification, and Mycobacterium tuberculosis and different mycobacteria can be identified. The mycobacteria that can be identified include the following: Mycobacterium tuberculosis, Mycobacterium abscessus, Mycobacterium aichi, Mycobacterium asiaticum, Mycobacterium avium, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium gastricum, Mycobacterium flavosum, Mycobacterium gordonii, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium malmo, Mycobacterium colorless, Mycobacterium phlei, Mycobacterium scrofula, Mycobacterium smegmatis, Mycobacterium simum, Mycobacterium surga, Mycobacterium terrestris, Mycobacterium minor, Mycobacterium ulcerans, Mycobacterium bovis, Mycobacterium toad, etc. The 24 species selected by the present invention are non-tuberculous mycobacteria with high pathogenicity (toxicity) reporting rates. The present invention can detect pathogenic bacteria more perfectly.

[0142] The detection method of the present invention can detect both tuberculosis mycobacterium and non-tuberculosis mycobacteria, and amplifies them first and then uses real-time fluorescence PCR for detection and identification, and the positive rate is significantly improved. At the same time, blood samples can also be detected. Through experiments, it can be obtained that the positive rate of sputum samples detected by the detection method of the present invention reaches 65.0%, while the detection method in the prior art is slightly lower than 40%, which shows that the detection rate is significantly improved. The detection method provided by the present invention can still detect a positive rate of 38.1% in blood samples, thereby improving the positive rate of blood sample detection.

[0143] The invention can also collect blood samples for testing, and the positive rate of negative blood samples reaches 31.7%. Most children with tuberculosis are negative tuberculosis, so it has greater significance for the research of children with tuberculosis.

[0144] The present invention also designs 24 matching non-tuberculous mycobacterium PCR primers and corresponding fluorescent probes, which are of greater significance for the study of non-tuberculous mycobacterium infection in AIDS patients and elderly people with reduced resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0145] In order to more clearly illustrate the technical solution of the present invention, the accompanying drawings required for use in the present invention will be briefly introduced below. It should be understood that the following accompanying drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these accompanying drawings without paying creative work.

[0146] Figure 1 A schematic diagram of the locations of the target sequence detected by real-time fluorescent PCR and the target sequence amplified by template provided by the present invention in the mycobacterium genome;

[0147] Figure 2 This is a graph showing the results of the first PCR amplification (template amplification) electrophoresis test in an embodiment of the present invention. DETAILED DESCRIPTION

[0148] The technical solution of the present invention will be described below in conjunction with the accompanying drawings of the present invention.

[0149] It should be noted that similar reference numerals and letters represent similar items in the following drawings, so once an item is defined in one drawing, it does not need to be further defined and explained in the subsequent drawings. At the same time, in the description of the present invention, the terms "first", "second", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance.

[0150] Example

[0151] The steps include:

[0152] S1: Extract DNA from the sample to be tested:

[0153] The sample to be tested can be a sputum sample or a blood sample.

[0154] When the specimen is a sputum specimen, the method for extracting DNA is as follows:

[0155] Take a sputum sample, add 4 times the volume of 4% sodium hydroxide solution, shake well, liquefy at room temperature for 30 minutes, take 1-1.5mL, centrifuge at 13000rpm for 5min, discard the supernatant, mix the precipitate with 1mL of sterile saline, centrifuge at 15000rpm for 5min, repeat washing once, discard the supernatant, add 50μL PBS to the precipitate, mix thoroughly and boil in water bath for 10-15min, centrifuge at 13000rpm for 10min, take 5μL sample and add it to the PCR tube.

[0156] When the specimen is a blood specimen, the method for extracting DNA is as follows:

[0157] The steps of preparing PCR template from blood sample are as follows:

[0158] 1. Add 500ul Trizol to 500ul plasma and store at -20℃ to start DNA extraction from step 2;

[0159] 2. Vortex for 30-60 seconds and centrifuge briefly;

[0160] 3. Add 160ul chloroform and vortex for 30 seconds;

[0161] 4. Spin at 14,000 rpm for 5 minutes to separate the phases;

[0162] 5. Transfer the upper aqueous phase to a 1.5 ml tube;

[0163] 6. Add 400ul of ice-cold isopropanol, mix by inversion 5 times, and let the sample precipitate overnight at -20℃;

[0164] 7. Pellet the RNA by spinning at 14,000 rpm for 15 minutes at RT and remove the supernatant;

[0165] 8. Wash the particles in 200ul-70% ethanol-RNase-free conditions, rotating at 14000rpm for 10 minutes;

[0166] 9. Remove the supernatant, removing as much as possible without disturbing the pellet;

[0167] 10. Air dry for 8 minutes;

[0168] 11. Solidify the particles in 20ul of RNase-free deionized water;

[0169] 12. Take 5ul as regular PCR template.

[0170] S2: First PCR amplification:

[0171] Primer design: Primers Mp1 and Mp2 were designed based on the 3' end of the 16S rRNA gene and the 5' end of the 23S rRNA gene of mycobacteria;

[0172] The gene sequences of the primers Mp1 and Mp2 are as follows:

[0173] Mp1:GACGAAGTCGATTCAAGGTAG;

[0174] Mp2:GCAGCCTCGTTCGTCCTTC.

[0175] The extracted DNA of the sample to be tested was used as a template and primers Mp1 and Mp2 were used for the first PCR amplification;

[0176] S3: Real-time fluorescence PCR detection and identification of nontuberculous mycobacterial species

[0177] The first PCR amplification product was used as the real-time fluorescence PCR template;

[0178] Design multiple sets of specific detection primers and probes for the detection and identification of nontuberculous mycobacteria;

[0179] Real-time fluorescence PCR detection and identification are performed using specific detection primers and probes to maintain the specificity of real-time fluorescence PCR and enhance detection sensitivity.

[0180] The multiple sets of specific detection primers and probes are:

[0181] The primer gene sequences for M.abcessus-specific detection of Mycobacterium abscessus are as follows:

[0182] F:CTAGGGAACATAAAGTAGGGT

[0183] R:CGTTTCAATTCTTATGACAGAG

[0184] The probe gene sequences for specific detection are as follows:

[0185] TATCTACTTTGAATATGTTTTGTA;

[0186] The primer gene sequences for M.aichiense-specific detection of Mycobacterium aichiense are as follows:

[0187] F:AGGCCCGTGCCCGGGGAA

[0188] R:AAAGGAAGCCGGCGCCTGT

[0189] The probe gene sequences for specific detection are as follows:

[0190] TCGGTGTGGTTGCTCCATCTTTG;

[0191] The primer gene sequences for M.asiaticum-specific detection of Mycobacterium asiaticum are as follows:

[0192] F:ATGGAGGGACAGTACACTTC

[0193] R:GGATGCAGGTACCGTGTG;

[0194] The probe gene sequences for specific detection are as follows:

[0195] TAGCGCCCGTGTTGTCTCAGGACCCAA

[0196] The primer gene sequences for M.chelonae-chelonae specific detection are as follows:

[0197] F:TTCCCAGCTGCGAATGAGCT

[0198] R:GCGTTTCAATTCTCAATTGACAG

[0199] The probe gene sequences for specific detection are as follows:

[0200] AAGCGAGTCTGTAGTGGTTACTCGCT

[0201] The primer gene sequences for M.fortuitum-specific detection of Mycobacterium fortuitum are as follows:

[0202] F:GAGCCGTGAGTTGAACCGG

[0203] R:CCTGTTGTATCTCAAAGCCCA

[0204] The probe gene sequences for specific detection are as follows:

[0205] CCTGTAGTGCACGGTTTGGTGCAC

[0206] The primer gene sequences for M.gastri-specific detection of gastric mycobacterium are as follows:

[0207] F:TAAGCCGTGAGCCGGGCT

[0208] R:ACGAGTCCAACCGACAAGC

[0209] The probe gene sequences for specific detection are as follows:

[0210] CGGGGGCCGTGCGCAACAGCAAGCA

[0211] The primer gene sequences for the specific detection of M.gilvum-flavin are as follows:

[0212] F:GGCTTTGAGACACTACAGGC

[0213] R:AGCCTGTGCAAGCCATCTTT

[0214] The probe gene sequences for specific detection are as follows:

[0215] CTCCGCGTTCGGGGTCGGTGTGT

[0216] The primer gene sequences for the specific detection of M. malmoense are as follows:

[0217] F:AACACTGCCGGCCAGTCC

[0218] R:ATTACACAAAACGGTAATACGC

[0219] The probe gene sequences for specific detection are as follows:

[0220] CTACGGGCAGCATCCGTTTAGATG

[0221] The primer gene sequences for the specific detection of M. nonchromogenicum are as follows:

[0222] F:TAGTGTGGGTTGTCCGGTGG

[0223] R:AAGCCGGCACCACCAGAAGT

[0224] The probe gene sequences for specific detection are as follows:

[0225] AACTCCTGGCTTGATGATTTCGA

[0226] The primer gene sequences for M. phlei-specific detection of Mycobacterium phlei are as follows:

[0227] F:TGGGAGAGCGTCGCCGGC

[0228] R:ACGGGCCAGTGTTGTCTCAA

[0229] The probe gene sequences for specific detection are as follows:

[0230] TGTCCGGTGGGCACAACAAAC

[0231] The primer gene sequence for the specific detection of M. scrofulaceum is as follows: F: CTTAAACACACTTACTTACAC

[0232] R:AGTGGTGTCTGCCTCCATCT

[0233] The probe gene sequences for specific detection are as follows:

[0234] AATTACACATTAACGAACACGC

[0235] The primer gene sequences for M. simiae-specific detection of Mycobacterium simiae are as follows:

[0236] F:GACTTCGGTTGAAGTGGTGT

[0237] R:CACAAAACGAACGCACGTAAC

[0238] The probe gene sequences for specific detection are as follows:

[0239] CCGGCGACGTTCATTTAGATGCT

[0240] The primer gene sequences for M. smegmatis-specific detection are as follows:

[0241] F:TGAGGAGCTGGTGAGCGCT

[0242] R:CAGTCCATCGATTAACAGCG

[0243] The probe gene sequences for specific detection are as follows:

[0244] TGGCGCCGTTGGTGCACAGCA

[0245] The primer gene sequences for the specific detection of M. szulai-Surga mycobacterium are as follows:

[0246] F:GATGCGAGCCGTGGTAGGG

[0247] R:AACAGCTCTGGCCCTAAGC

[0248] The probe gene sequences for specific detection are as follows:

[0249] CTCGTCTGTAGGACGAGGGCCGG

[0250] The primer gene sequences for M.terrae-specific detection of Mycobacterium terrae are as follows:

[0251] F:GAGGCAATGCAGGCCCGTT

[0252] R:CAGTAACCAAAAATCTGCTTGT

[0253] The probe gene sequences for specific detection are as follows:

[0254] TGTTGTTGTCCTCACACTTGGTGGT

[0255] The primer gene sequences for the specific detection of M.thermoresisitible-thermoresistant mycobacterium are as follows:

[0256] F:TGCCGTGTGGTGAGTCGGT

[0257] R:AATAGTGTCCGTCCGGTGAT

[0258] The probe gene sequences for specific detection are as follows:

[0259] TAGTGGCGCCCTGGGTGCGCAACAA

[0260] The primer gene sequences for the specific detection of M. triviale-minor mycobacterium are as follows:

[0261] F:TCAAGTGGTATGTTGAGGGC

[0262] R:CAAAGCGTGGATTGCCTCAG

[0263] The probe gene sequences for specific detection are as follows:

[0264] AGCTTGCTGTGGGCTGCCAGGCACACT

[0265] The primer gene sequences for M.ulcerans-specific detection are as follows:

[0266] F:GGAGCACCACTCGAGAAACA

[0267] R:TGGGACCCAACATCCCGAAA

[0268] The probe gene sequences for specific detection are as follows:

[0269] ACAGAGATGTTCTCAGGACCCAATAGTGT

[0270] The primer gene sequences for M.vaccae-specific detection of Mycobacterium bovis are as follows:

[0271] F:GCACATGCCACAAACTTGG

[0272] R:GACCCTGAGCCAACGCAG

[0273] The probe gene sequences for specific detection are as follows:

[0274] TAGGGAATGCCCGAGGGAAATCATCAG

[0275] The primer gene sequences for M.xenopi-specific detection of Mycobacterium toadense are as follows:

[0276] F:GCACCGTACGAACGCATCC

[0277] R:GTTACTGCAACTGCTGCCC

[0278] The probe gene sequences for specific detection are as follows:

[0279] ACCTCGGCCCGACCACAACACGCCGAAC

[0280] The gene sequences of the primers for the specific detection of Mycobacterium avium are as follows:

[0281] F:ATCTAGATGAGCGCATGGT

[0282] R:CACTTACTTACACACAAGAG

[0283] The specific detection probe gene sequence is as follows:

[0284] TGGCCGGCGTTCATCGAAATGTG

[0285] The gene sequences of the primers for the specific detection of Mycobacterium kansasii are as follows:

[0286] F:GAGCACCACGAAAAGCAT

[0287] R:TGTCTGGCTTTGCTTGTTG

[0288] The specific detection probe gene sequence is as follows:

[0289] AACAAGTGGGGTGCAAGCCG

[0290] The gene sequences of the primers for the specific detection of Mycobacterium gordonii are as follows:

[0291] F:ACACCCTCGGGTGCTG

[0292] R:AAATTGCACAAAAAGAACAC

[0293] The specific detection probe gene sequence is as follows:

[0294] AACGACAACGCATACATTTTGATG

[0295] The gene sequences of the primers for the specific detection of Mycobacterium intracellulare are as follows:

[0296] F:GTGTTTGAGTATTGGATAGTG

[0297] R:TTACTTACACACAAAAACCAA

[0298] The specific detection probe gene sequence is as follows:

[0299] CGAGCATCTAGATGAGCGCATAGT

[0300] Supplementary electrophoresis experiments and results, such as Figure 2 shown.

[0301] Experimental example:

[0302] According to the above-mentioned embodiment method, clinical testing was carried out, and the experimental results are shown in the following table: Clinical Testing Data Table

[0303]

[0304] Total tuberculosis positive rate: 65.0% (sputum positive) + 13.3% (sputum negative / blood positive) = 78.3%

[0305] Note: The culture-positive group includes culture-positive and / or real-time fluorescence PCR-positive (i.e., positive etiological diagnosis)

[0306] The above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be included in the protection scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A real-time fluorescence PCR detection method for detecting and identifying nontuberculous mycobacteria, characterized in that: The steps include: S1: Extract DNA from the sample to be tested: S2: First PCR amplification: Primer design: Primers Mp1 and Mp2 were designed based on the 3' end of the 16S rRNA gene and the 5' end of the 23S rRNA gene of mycobacteria; The extracted DNA of the sample to be tested was used as a template and primers Mp1 and Mp2 were used for the first PCR amplification; S3: Real-time fluorescence PCR detection and identification of nontuberculous mycobacterial species The first PCR amplification product was used as the real-time fluorescence PCR template; Design multiple sets of specific detection primers and probes for the detection and identification of nontuberculous mycobacteria; Real-time fluorescence PCR was used for secondary detection and identification using specific detection primers and probes.

2. The real-time fluorescence PCR detection method according to claim 1, characterized in that: The gene sequences of the primers Mp1 and Mp2 are as follows: Mp1:GAAGGTGGGATCGGCGATTG; Mp2:GCAGCCTCCAACGTCCTTC.

3. The real-time fluorescence PCR detection method according to claim 1, characterized in that: The first PCR amplification, its reaction system: 15μl PCR mix, 1μl primers Mp1 and Mp2, 8μl H2O, 5μl template, PCR amplification procedure: Pre-denaturation at 94°C for 5 min; 40 cycles at 94°C for 30 s; maintain at 57°C for 15 s, maintain at 72°C for 30 s, and finally maintain at 72°C for 5 min.

4. The real-time fluorescence PCR detection method according to claim 3, characterized in that: The second PCR amplification, its reaction system: 6 μl real-time fluorescence PCR mix, 1 μl primers, 1 μl probe, 1 μl PCR template, 3 μl HPLCH2O, a total of 12 μl; Maintain at 50°C for 2 min, 95°C for 10 min, then do 40 cycles of: maintain at 95°C for 15 s, then reduce to 60°C for 1 min.

5. The real-time fluorescence PCR detection method according to claim 3, characterized in that: The specific detection primers and probes are as follows: The primer gene sequences for the specific detection of Mycobacterium abscessus are as follows: F:CTAGGGAACATAAAGTAGGGT R:CGTTTCAATTCTTATGACAGAG The probe gene sequences for specific detection are as follows: TATCTACTTTGAATATGTTTTGTA; The primer gene sequences for specific detection of Mycobacterium aichiensis are as follows: F:AGGCCCGTGCCCGGGGAA R:AAAGGAAGCCGGCGCCTGT The probe gene sequences for specific detection are as follows: TCGGTGTGGTTGCTCCATCTTTG; The primer gene sequences for specific detection of Mycobacterium asiatica are as follows: F:ATGGAGGGACAGTACACTTC R:GGATGCAGGTACCGTGTG; The probe gene sequences for specific detection are as follows: TAGCGCCCGTGTTGTCTCAGGACCCAA The primer gene sequence for specific detection of Mycobacterium chelonae is as follows: F:TTCCCAGCTGCGAATGAGCT R:GCGTTTCAATTCTCAATTGACAG The probe gene sequences for specific detection are as follows: AAGCGAGTCTGTAGTGGTTACTCGCT The primer gene sequence for the specific detection of Mycobacterium acetylsalicylicum is as follows: F:GAGCCGTGAGTTGAACCGG R:CCTGTTGTATCTCAAAGCCCA The probe gene sequences for specific detection are as follows: CCTGTAGTGCACGGTTTGGTGCAC The primer gene sequence for specific detection of gastric mycobacterium is as follows: F:TAAGCCGTGAGCCGGGCT R:ACGAGTCCAACCGACAAGC The probe gene sequences for specific detection are as follows: CGGGGGCCGTGCGCAACAGCAAGCA The primer gene sequence for specific detection of Mycobacterium flavum is as follows: F:GGCTTTGAGACACTACAGGC R:AGCCTGTGCAAGCCATCTTT The probe gene sequences for specific detection are as follows: CTCCGCGTTCGGGGTCGGTGTGT The primer gene sequence for specific detection of Mycobacterium malmoe is as follows: F:AACACTGCCGGCCAGTCC R:ATTACACAAAACGGTAATACGC The probe gene sequences for specific detection are as follows: CTACGGGCAGCATCCGTTTAGATG The primer gene sequence for the specific detection of non-chromogenic mycobacteria is as follows: F:TAGTGTGGGTTGTCCGGTGG R:AAGCCGGCACCACCAGAAGT The probe gene sequences for specific detection are as follows: AACTCCTGGCTTGATGATTTCGA The primer gene sequences for the specific detection of Mycobacterium phlei are as follows: F:TGGGAGAGCGTCGCCGGC R:ACGGGCCAGTGTTGTCTCAA The probe gene sequences for specific detection are as follows: TGTCCGGTGGGCACAACAAAC The primer gene sequence for specific detection of Mycobacterium scrofulae is as follows: F:CTTAAACACACTTACTTACAC R:AGTGGTGTCTGCCTCCATCT The probe gene sequences for specific detection are as follows: AATTACACATTAACGAACACGC The primer gene sequences for the specific detection of Mycobacterium simianum are as follows: F:GACTTCGGTTGAAGTGGTGT R:CACAAAACGAACGCACGTAAC The probe gene sequences for specific detection are as follows: CCGGCGACGTTCATTTAGATGCT The primer gene sequence for specific detection of Mycobacterium smegmatis is as follows: F:TGAGGAGCTGGTGAGCGCT R:CAGTCCATCGATTAACAGCG The probe gene sequences for specific detection are as follows: TGGCGCCGTTGGTGCACAGCA The primer gene sequence for the specific detection of Mycobacterium surga is as follows: F:GATGCGAGCCGTGGTAGGG R:AACAGCTCTGGCCCTAAGC The probe gene sequences for specific detection are as follows: CTCGTCTGTAGGACGAGGGCCGG The primer gene sequences for specific detection of Mycobacterium tumefaciens are as follows: F:GAGGCAATGCAGGCCCGTT R:CAGTAACCAAAAATCTGCTTGT The probe gene sequences for specific detection are as follows: TGTTGTTGTCCTCACACTTGGTGGT The primer gene sequence for specific detection of thermotolerant mycobacteria is as follows: F:TGCCGTGTGGTGAGTCGGT R:AATAGTGTCCGTCCGGTGAT The probe gene sequences for specific detection are as follows: TAGTGGCGCCCTGGGTGCGCAACAA The primer gene sequence for the specific detection of minor mycobacteria is as follows: F:TCAAGTGGTATGTTGAGGGC R:CAAAGCGTGGATTGCCTCAG The probe gene sequences for specific detection are as follows: AGCTTGCTGTGGGCTGCCAGGCACACT The primer gene sequence for specific detection of Mycobacterium ulcerans is as follows: F:GGAGCACCACTCGAGAAACA R:TGGGACCCAACATCCCGAAA The probe gene sequences for specific detection are as follows: The primer gene sequence for the specific detection of Mycobacterium bovis is as follows: F: GCACATGCCACAAACTTGG R:GACCCTGAGCCAACGCAG The probe gene sequences for specific detection are as follows: TAGGGAATGCCCGAGGGAAATCATCAG The primer gene sequence for specific detection of Mycobacterium toadense is as follows: F:GCACCGTACGAACGCATCC R:GTTACTGCAACTGCTGCCC The probe gene sequence for specific detection is as follows: ACCTCGGCCCGACCACAACACGCCGAAC The gene sequences of the primers for the specific detection of Mycobacterium avium are as follows: F:ATCTAGATGAGCGCATGGT R:CACTTACTTACACACAAGAG The specific detection probe gene sequence is as follows: TGGCCGGCGTTCATCGAAATGTG The gene sequences of the primers for the specific detection of Mycobacterium kansasii are as follows: F:GAGCACCACGAAAAGCAT R:TGTCTGGCTTTGCTTGTTG The specific detection probe gene sequence is as follows: AACAAGTGGGGTGCAAGCCG The gene sequences of the primers for the specific detection of Mycobacterium gordonii are as follows: F:ACACCCTCGGGTGCTG R:AAATTGCACAAAAAGAACAC The specific detection probe gene sequence is as follows: AACGACAACGCATACATTTTGATG The gene sequences of the primers for the specific detection of Mycobacterium intracellulare are as follows: F:GTGTTTGAGTATTGGATAGTG R:TTACTTACACACAAAAACCAA The specific detection probe gene sequence is as follows: CGAGCATCTAGATGAGCGCATAGT.

6. The real-time fluorescent PCR detection method according to any one of claims 1 to 5, characterized in that: The sample to be tested is a sputum sample or a blood sample.

Images